Literature DB >> 35631040

Genetic Diversity and Haplotype Analysis of Cattle Hydatid Cyst Isolates Using Mitochondrial Markers in Turkey.

Harun Kaya Kesik1, Figen Celik2, Seyma Gunyakti Kilinc1, Sami Simsek2, Haroon Ahmed3, Yujuan Shen4,5,6,7, Jianping Cao4,5,6,7.   

Abstract

Echinococcus granulosus sensu lato (s.l.) causes cystic echinococcosis in ungulates and humans. The current study was designed to find the genetic diversity and haplotypic profiles of hydatid cysts from the lungs of cattle in three provinces in eastern Turkey. Individual cyst isolates (n = 60) were collected from infected cattle lungs after slaughter and then samples were stored in ethanol (70%) until further use. From each isolate, total gDNA was extracted from the cysts' germinal layers. A partial (875 bp) mt-CO1 gene was amplified by PCR and sequenced unidirectionally. The final size of the trimmed sequences was 530 bp for 60 sequences. Sequence and haplotype analyses were performed, followed by phylogenetic analyses. According to BLAST searches, all sequences were detected as E. granulosus s.s. (G1 and G3 strains). Forty-nine point mutations were identified. In addition, five conserved fragments were detected in all sequences. The haplotype analysis diagram showed E. granulosus s.s. haplotypes organized in a star-like configuration. The haplotypes were characterized by 1-17 mutations compared with the fundamental focal haplotype. Thirty-three haplotypes were determined in 60 samples of which 17 (28.3%) belonged to the main haplotype (Hap_06). The mt-CO1 sequences revealed 49 polymorphic sites, 34.5% (20/49) of which were informative according to parsimony analysis.

Entities:  

Keywords:  Echinococcus granulosus sensu stricto; Turkey; cattle; haplotype; hydatid disease

Year:  2022        PMID: 35631040      PMCID: PMC9145776          DOI: 10.3390/pathogens11050519

Source DB:  PubMed          Journal:  Pathogens        ISSN: 2076-0817


1. Introduction

Echinococcus granulosus sensu lato, a species complex, is responsible for cystic echinococcosis (CE) in many ungulates and humans [1]. Globally, CE is one of the most serious infectious disease because of its significant financial burden and public health implications [2]. Animals such as goats, sheep, camels, pigs, and cattle act as intermediate hosts, harboring the metacestodes in hydatid cysts that infect the liver, lungs, and other parts of the body. Moreover, the adult tapeworm resides in the intestines of definitive hosts, which are canids including domestic dogs [3]. Genetic diversity of E. granulosus s.l. complex were investigated from many species of intermediate hosts in the last five decades. [4]. Molecular characterization of the E. granulosus s.l. complex has been achieved: E. granulosus sensu stricto (s.s) (G1 and G3 strains), E. equinus (G4), E. ortleppi (G5), E. canadesis (G6–G10), and E. felidis (lion strain) [5]. In various areas of the world, CE is highly endemic and widespread, especially in rural settings in most parts of the world, such as Africa, the Middle East, Mediterranean Europe, South America, Central Asia, and Western China, e.g., rural and pastoral communities where humans and animals live in close association with each other [6]. CE is also prevalent in almost every region of Turkey [7]. In recent years, several studies reported the prevalence of CE in livestock from Turkey. The overall recorded prevalence ranged from 3.5 to 58.6%. The prevalence was determined according to the results of studies for various species of animals ranging from 3.5 to 70.9% in sheep, 1.6 to 25.1% in goats, 3 to 46.4% in cattle, and 10.2 to 41.1% in buffaloes [8,9,10,11,12,13]. CE was responsible for a total yield loss of 89.2 million USD for animals (cattle, sheep, and goats) in 2008 in Turkey [14]. In recent molecular studies, three species, E. granulosus s.s., E. eqinus, and E. canadensis (G6/G7), were observed to infect intermediate hosts, and E. granulosus s.s. was reported as a predominant species among cattle in Turkey [11,15,16]. The present study hypothesized that the mt-CO1 sequence could be used to genetically identify cattle isolates of hydatid cysts and could determine the haplotype profile of E. granulosus s.l. in three provinces of Turkey.

2. Results

We collected 60 samples of cattle hydatid cysts. All of the isolates were obtained from lungs. To determine the exact species of the isolates, PCR was performed to amplify a mt-CO1 gene fragment, and in all samples an 875 bp band was amplified. The nucleotide sequences were compared with published reference sequences and trimmed. The final size of the trimmed sequences was 530 bp for 60 sequences (BNG41-BNG100). All sequences were identified as E. granulosus s.s. (G1 and G3), according to BLAST searches. All the sequences were then submitted to GenBank and accession numbers (MW020975-MW021034) were obtained, belonging to all nucleotide sequences. After the alignment, point mutations in the sequences were identified. Nucleotide variation positions based on the reference sequence are shown in Table 1. The accession numbers of E. granulosus s.s. (G1 and G3) (AY389989, KT001408, MG808348), E. canadensis (G6/G7) (KX010870, KX010869, LC184604, LC184606), E, ortleppi (G5) (KU743926, MN886291), and E. multilocularis (AB510025) were used for phylogenetic tree construction and the Taenia saginata (KY290361) sequence was used as an outgroup.
Table 1

Nucleotide variation positions of the mt-CO1 (530 bp) gene among 33 analyzed haplotypes. A: Adenine, T: Thymine, C: Cytosine, G: Guanine.

Nucleotide Positions 6 40 112 142 143 159 180 271 302 307 355 358 361 377 383 402 422 423 428 430 438 448 458 461
NC_044548(Reference sequence)CCTTCTCCCACTTACGAGATCCTT
Hap_01T TT
Hap_02 TT
Hap_03 T
Hap_04 C T
Hap_05 T C
Hap_06
Hap_07
Hap_08
Hap_09 TT
Hap_10 A
Hap_11 T G
Hap_12 T T
Hap_13 C G
Hap_14
Hap_15 T G
Hap_16 T C T
Hap_17 T
Hap_18 T
Hap_19 T G T
Hap_20 T
Hap_21 T
Hap_22
Hap_23
Hap_24T C
Hap_25 T
Hap_26 C
Hap_27 T A
Hap_28
Hap_29
Hap_30 T AT
Hap_31 T TT
Hap_32 A C AG TG
Hap_33 A
Nucleotide Positions 479 480 482 484 486 493 497 498 499 500 502 503 504 505 506 507 511 513 515 518 522 523 525 527 528
NC_044548(Ref. sequence)GTTTTCGTTTGGGTCATTTATTGTT
Hap_01
Hap_02 C C
Hap_03
Hap_04
Hap_05 AA A CAA C
Hap_06
Hap_07 A
Hap_08C T
Hap_09
Hap_10 T A AA A A
Hap_11
Hap_12 AA A A CA
Hap_13
Hap_14 T G
Hap_15
Hap_16
Hap_17
Hap_18
Hap_19
Hap_20C A A AT
Hap_21 A
Hap_22 T
Hap_23 T
Hap_24
Hap_25 C
Hap_26 A AA A CA
Hap_27CA A A A
Hap_28 A
Hap_29 C G A A A
Hap_30
Hap_31 CA
Hap_32A A
Hap_33
As a result of haplotype analyses and subsequent to essential focal haplotype, E. granulosus s.s. was configured in orientation like a star. 1–17 mutation steps segregated it from other haplotypes; 33 haplotypes were determined in 60 samples, of which 17 (28.3%) belonged to the main haplotype (Hap_06) (Figure 1; Table 2). In the mt-CO1 gene sequences, 49 polymorphic sites were identified by performing the alignment with the reference sequence (NC044548; Table 1), among which 34.5% (20/49) were informative according to parsimony analysis. In addition, five conserved regions (7–39, 41–111, 181–270, 272–301, and 308–354 bp) were identified in all the sequences. Nine haplotypes (italic ones in Table 2) detected in this study were 100% similar to the previously published reference sequences in the Genbank while 24 haplotypes were unique and were revealed for the first time in this study.
Figure 1

The haplotype network for the mt-CO1 (530 bp) gene of E. granulosus s.s. The size of the circles is proportional to the frequency of each haplotype. The number of mutations separating haplotypes is indicated by dash marks. Hap: haplotype.

Table 2

Haplotypes of mt-CO1 sequences of E. granulosus s.s. and accession numbers of isolates forming groups. Those showing 100% similarity to reference sequences are in italics.

NoHaplotype NameNumber of IsolatesIsolate Codes (Accession Numbers)
1 Hap_01 1BNG41(MW020975)
2Hap_021BNG42(MW020976)
3 Hap_03 2BNG43(MW020977), BNG96(MW021030)
4Hap_041BNG44(MW020978)
5Hap_051BNG45(MW020979)
6 Hap_06 17BNG46(MW020980), BNG55(MW020989),BNG59(MW020993), BNG61(MW020995), BNG62(MW020996), BNG73(MW021007), BNG76(MW021010), BNG81(MW021015), BNG84(MW021018), BNG85(MW021019), BNG91(MW021025), BNG93(MW021027), BNG94(MW021028), BNG95(MW021029), BNG97(MW021031), BNG98(MW021032), BNG99(MW021033)
7Hap_071BNG47 (MW020981)
8Hap_081BNG48 (MW020982)
9 Hap_09 3BNG49(MW020983), BNG87(MW021021),BNG89(MW021023)
10Hap_101BNG50(MW020984)
11Hap_111BNG51(MW020985)
12Hap_121BNG52(MW020986)
13 Hap_13 1BNG53(MW020987)
14Hap_141BNG54(MW020988)
15Hap_151BNG56(MW020990)
16Hap_161BNG57(MW020991)
17 Hap_17 2BNG58(MW020992), BNG60 (MW020994)
18 Hap_18 7BNG63(MW020997), BNG64(MW020998), BNG66(MW021000), BNG70(MW021004), BNG74(MW021008), BNG82(MW021016), BNG83(MW021017)
19Hap_191BNG65(MW020999)
20Hap_201BNG67(MW021001)
21Hap_211BNG68(MW021002)
22Hap_221BNG69(MW021003)
23 Hap_23 1BNG71(MW021005)
24Hap_241BNG72(MW021006)
25 Hap_25 2BNG75(MW021009), BNG100(MW021034)
26Hap_261BNG77(MW021011)
27Hap_271BNG78(MW021012)
28Hap_281BNG79(MW021013)
29Hap_291BNG80(MW021014)
30Hap_301BNG86(MW021020)
31Hap_311BNG88(MW021022)
32Hap_321BNG90(MW021024)
33Hap_331BNG92(MW021026)
In current report, higher haplotype variation and lower levels of nucleotide differences were detected for the mt-CO1 gene (Table 3). Population buildup and/or refinement of selection was indicated by Tajima’s D value. Uncommon haplotypes from recent population expansion or hitchhiking were expected because of the significant negative Fu’s Fs value. Hence, the fact that 81.8% (27/33) of the haplotype groups were single haplotypes supported these results.
Table 3

Diversity and neutrality indices obtained using nucleotide data of the E. granulosus s.s. mt-CO1 gene (530 bp).

mtDNAnhnhd ± SDπd ± SDTajima’s Dp Value Fu’s Fs p Value FLDp Value FLFp Value
530 bp60330.908 ± 0.030 0.00692 ± 0.00101−2.35657p < 0.01−27.2760.0000−3.51234p < 0.02 −3.67712p < 0.02

n: number of isolates; hn: number of haplotypes; hd: haplotype diversity; πd: nucleotide diversity; SD: standard deviation; FLD: Fu and Li’s D test statistic; FLF: Fu and Li’s F statistics test.

3. Discussion

Cystic echinococcosis, an endemic zoonotic disease acquired by cestode parasite of E. granulosus s.l. It is a neglected tropical disease according to the World Health Organization (WHO), causing serious medical and economic losses every year [17]. PCR- based methods are frequently used to identify and genotype species/strains within the E. granulosus s.l. complex. Determining the prevalent strains in an endemic region such as Turkey is highly significant for investigating its pathogenicity, pattern of transmission, parasite life cycle, CE diagnosis and treatment methods, possible eradication, vaccine and drug studies, and parasite control. For the genotypic and molecular identification of E. granulosus s.l. nuclear and mitochondrial genes have been utilized. Phylogenetic analysis of closely related species, mitochondrial genes are preferred over nuclear genes because of their haploid properties, rapid sequence evolution, and large datasets [18]. E. granulosus s.l. comprises different genotypes and is further divided into E. granulosus s.s., E. ortleppi, E. equinus, E. canadensis (G6/G7, G8 and G10), and E. felidis [5]. E. granulosus s.s. is the most eminent species in Turkey [19]. E. granulosus s.s. generally has an extensive distribution in China [20], some parts of Europe [21,22,23], South America [24,25], and Africa [26] among all intermediate hosts and humans. Therefore, it is not alarming that in Turkey E. granulosus s.s. is a common species. Pigs and camels, the intermediate hosts of E. canadensis (G6/G7), are at a minimum level in Turkey. The main source of income in Turkey is the breeding of cattle and sheep, which have a high prevalence of E. granulosus s.s. One of the main aims of the present study was to investigate the possible presence of E. ortleppi in CE-infected cattle lungs, because E. ortleppi in stray dogs was reported recently in Turkey [27]. However, in this study, in all 60 samples, only E. granulosus s.s. was identified among cattle lungs infected with hydatid cysts. A recent study from Turkey reported that 39 out of the 40 cattle hydatid cyst isolates were detected as E. granulosus s.s. However, one cattle isolate matched with E. canadensis (G6/G7) according to the mt-CO1 gene sequences (758 bp) [28]. Another study was performed on 120 isolates, 114 of which showed CE infection by E. granulosus s.s. using 12S rRNA PCR, while the remaining 6 isolates showed E. granulosus s.s. infection after mt-CO1 gene analysis [16]. According to previous reports performed on cattle isolates (n = 57), E. granulosus s.s. was determined after PCR and sequence analysis in Konya province of Turkey [29]. In addition, among 85 sheep and cattle isolates from Turkey (Elazig province), 84 hydatid cyst was characterized as E. granulosus s.s. as a result of sequence analysis [30]. All these conducted investigations reported that E. granulosus s.s. was the eminent species reported in cyst samples from different areas of Turkey. In the present study, 60 cattle isolates were confirmed as E. granulosus s.s. in three provinces of Turkey using mt-CO1 gene sequencing and the sequences showed similarity with reference sequences of E. granulosus s.s. We determined 33 E. granulosus s.s. haplotypes among the 60 cattle isolates and also observed multiple nucleotide mutation positions (49 point mutations) within these 33 haplotypes. The identification of 33 haplotypes in 60 cattle isolates proved the significant genetic variability of E. granulosus s.s. A recent study indicated relatively high G1 strain haplotype diversity, because 171 haplotypes in 212 samples were determined in different regions of the world [19]. According to the haplotype analysis for the mt-CO1 gene, high haplotype diversity and low nucleotide variation were noted. Tajima’s D value indicated expansion of the population and the influence of purifying selection. The negative value of Fu’s Fs indicated the presence of rare haplotypes occurred because of hitchhiking or recent population enlargement. Hence, it was not surprising that there were 33 haplotypes out of 60 sequences. Indeed, 81.8% of the haplotype comprised a single sequence.

4. Material and Methods

4.1. Study Area and Sample Collection

A total of sixty (n = 60) cattle hydatid cysts were gathered from slaughterhouses in Bingol, Elazig, and Erzincan provinces of eastern Turkey from October 2019 to February 2020 (Figure 2). Following slaughter, the internal organs of each animal, especially the lungs, were examined by both inspection and palpation for the presence of hydatid cysts. Only one hydatid cyst sample was taken from each cattle. Germinal membranes were separated from the detected hydatid cysts using scissors, placed into 70% ethanol, and delivered to the laboratory on ice. Each collected cyst was stored at −20 °C in 70% ethanol in separate Eppendorf tubes for subsequent experiments.
Figure 2

The provinces (in yellow) from which the hydatid cyst samples were collected from Turkey.

4.2. Genomic DNA Isolation from Individual Cyst Samples

The protocol, as prescribed by the manufacturer, was performed for genomic DNA (gDNA) extraction using a Hibrigen Genomic DNA Isolation Kit (Hibrigen, Kocaeli, Turkey), according to the instructions of manufacturers company but with slight adjustments. The tissue samples were then washed five times with phosphate buffered saline (PBS) to remove excess amounts of alcohol and then the germinal layer was dissected into small segments using a scalpel, and then transferred into Eppendorf tubes (1.5 mL). Two hundred microliters of lysis solution and twenty microliters (20 mg/ml) of Proteinase-K were mixed, swirled, and incubated overnight at 65 °C. To obtain effective results, the samples were vortexed every 1 h, at least two to three times. The quantity of gDNA was determined by using a Nanodrop device (Nanodrop Technologies, Wilmington, DE, USA) and those samples containing insufficient gDNA were re-extract to obtain a sufficient amount of gDNA. The extracted gDNA was then kept at −20 °C until further use.

4.3. PCR Amplification of mt-CO1 Gene Fragment

The PCR amplification of the mt-CO1 gene (875 bp) fragment was done by using primers F/CO1 forward (5′-TTGAATTTGCCACGTTTGAATGC-3′) and R/CO1 reverse (5′-GAACCTAACGACATAACATAATGA-3′) as previously described [31]. The PCR reaction comprised the following: 5 µL of 10 × PCR buffer; 25 mM of MgCl2; each dNTPs (400 µM), primers (each 20 pmol), TaqDNA Polymerase (5 U/µL); PCR grade water (28.8 µL); and 5 µL of gDNA. The cycle parameters of the PCR reaction were as follows: initial denaturation at 94 °C for 10 minutes; 30 cycles of 30 seconds at 94 °C; 45 seconds at 52 °C; and 1 minute at 72 °C; and a final extension step for 10 minutes at 72 °C. A thermal cycler from SensoQuest GmbH (Göttingen, Germany) was used to perform PCR, and 1.4 % agarose gel electrophoresis was used to separate the PCR products.

4.4. DNA Sequence Analysis

PCR products of the mt-CO1 gene belonging to 60 individual hydatid cysts isolates were sent to the DNA Laboratory of the Genetic Disease Diagnosis Center (Istanbul, Turkey) for unidirectional Sanger DNA sequence. The resulting sequences were compared with GenBank reference sequences using BLAST.

4.5. Alignment and Phylogenetic Analysis of mt-CO1 Gene

FinchTV 1.4.0 was utilized to analyze the sequence data. BLAST search was used to compare and trim the sequences. The MEGA X tool was used to evaluate the trimmed sequences [32]. Using NCBI Pubmed published reference sequences as outgroups, alignment of the sequences was performed. The evolutionary tree was generated using the maximum likelihood method in MEGA X, after finding the most accurate and efficient model the best model was used by using the MEGA X program. [32].

4.6. Haplotype Networks, Nucleotide Polymorphism, Diversity, and Neutrality Indices

Following a published protocol [33], all sequence data were uploaded into the DnaSP6 software. The software was used to determine the diversity of population indices and neutrality indices. Population diversity indices included nucleotide diversity (πd), haplotype diversity (hd), and haplotype number (hn), while neutrality indices consisted of Tajima’s D [34], Fu’s statistics [35], Fu’s Fs [21], Fu and Li’s D test (FLD), Fu and Li’s F (FLF) statistics test, and parsimony informative analysis was performed using DnaSP6. Data in the NEXUS output format were generated using DnaSP6 software. To create the haplotype network, the minimum spanning network (MSN) method was used [36] in the PopART-1.7 tool [37].

5. Conclusions

In the current study E. granulosus s.s. species was identified as the predominant species in cattle hydatid cyst samples in the study area. Among analyzed sequences, the highly prevalent haplotypes were Hap_06 and Hap_18. Nine haplotypes were 100% similar to the published reference sequences while 24 haplotypes were unique. These corresponded to mt-CO1 haplotypes, which have been detected widely in E. granulosus s.s. studies on mt-CO1 diversity.
  35 in total

1.  Estimating the production losses due to cystic echinococcosis in ruminants in Turkey.

Authors:  Savaş Sariözkan; Cengiz Yalçin
Journal:  Vet Parasitol       Date:  2009-05-04       Impact factor: 2.738

Review 2.  Review on Epidemiology and Public Health Significance of Hydatidosis.

Authors:  Abebe Tesfaye Gessese
Journal:  Vet Med Int       Date:  2020-12-03

3.  Statistical method for testing the neutral mutation hypothesis by DNA polymorphism.

Authors:  F Tajima
Journal:  Genetics       Date:  1989-11       Impact factor: 4.562

4.  DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets.

Authors:  Julio Rozas; Albert Ferrer-Mata; Juan Carlos Sánchez-DelBarrio; Sara Guirao-Rico; Pablo Librado; Sebastián E Ramos-Onsins; Alejandro Sánchez-Gracia
Journal:  Mol Biol Evol       Date:  2017-12-01       Impact factor: 16.240

5.  MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms.

Authors:  Sudhir Kumar; Glen Stecher; Michael Li; Christina Knyaz; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2018-06-01       Impact factor: 16.240

6.  Molecular survey on cattle and sheep hydatidosis and first detection of Echinococcus canadensis (G6/G7) in sheep in Turkey.

Authors:  Sarfraz Mehmood; Sami Simsek; Figen Celik; Harun Kaya Kesik; Seyma Gunyakti Kilinc; Haroon Ahmed
Journal:  Parasitology       Date:  2020-05-14       Impact factor: 3.234

7.  Mitochondrial genetic code in cestodes.

Authors:  M Nakao; Y Sako; N Yokoyama; M Fukunaga; A Ito
Journal:  Mol Biochem Parasitol       Date:  2000-12       Impact factor: 1.759

8.  Genetic diversity and phylogeography of highly zoonotic Echinococcus granulosus genotype G1 in the Americas (Argentina, Brazil, Chile and Mexico) based on 8279bp of mtDNA.

Authors:  Teivi Laurimäe; Liina Kinkar; Vanessa Andresiuk; Karen Luisa Haag; Francisco Ponce-Gordo; Gerardo Acosta-Jamett; Teresa Garate; Luis Miguel Gonzàlez; Urmas Saarma
Journal:  Infect Genet Evol       Date:  2016-09-19       Impact factor: 3.342

9.  Genetic variability and haplotypes of Echinococcus isolates from Tunisia.

Authors:  Belgees Boufana; Samia Lahmar; Waël Rebaï; Zoubeir Ben Safta; Leïla Jebabli; Adel Ammar; Mahmoud Kachti; Soufia Aouadi; Philip S Craig
Journal:  Trans R Soc Trop Med Hyg       Date:  2014-09-11       Impact factor: 2.184

10.  International consensus on terminology to be used in the field of echinococcoses.

Authors:  Dominique A Vuitton; Donald P McManus; Michael T Rogan; Thomas Romig; Bruno Gottstein; Ariel Naidich; Tuerhongjiang Tuxun; Hao Wen; Antonio Menezes da Silva
Journal:  Parasite       Date:  2020-06-03       Impact factor: 3.000

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.