Expression of chronic myeloid leukemia oncogenes BCR-ABL P210 and BCR-ABL T315I affect cellular and humoral innate immunity in Drosophila melanogaster.

(A) Maximum intensity projection at 100X magnification showing absence of MYC (tag present at the N-terminus of both BCR-ABL P210 and BCR-ABL T315I flies) staining in GFP-positive control hemocytes (a, a’), MYC expression in GFP-positive hemocytes indicating expression of BCR-ABL P210 (b, b’) and BCR-ABL T315I (c, c’). Scale bar is 10 µm. (B) A significant increase in hemocyte count in BCR-ABL and BCR-ABL expressing larval bleed when compared to control flies and to each other. (C, D) Sketch Diagram and representative images of disruption in sessile hemocyte patterning in BCR-ABL and BCR-ABL flies. Green fluorescence indicates GFP expressed in lymph gland and circulating hemocytes under Hml Δ-Gal4; UAS-GFP driver. Regular banding of sessile patterning of hemocytes in third-instar control larva (d), partial disruption of sessile hemocyte in BCR-ABL P210 third-instar larva (d’), and complete disrupted patterning of sessile hemocytes in BCR-ABL T315I third-instar larva (d”). (E) Enumeration of banded, partially disrupted, and disrupted patterning in control, BCR-ABL P210 and BCR-ABL T315I larva demonstrating the disruptive phenotype in BCR-ABL P210 and BCR-ABL T315I larva with a significant exacerbated phenotype in the latter. (F) Analysis in larvae: Drosomycin, Diptericin A , and TotA relative expressions normalized to RP49 in control, BCR-ABL P210 and BCR-ABL T315I larva hemolymph. A significant increase of all expressions in BCR-ABL P210 and BCR-ABL T315I larva when compared to control flies except Diptericin A which is under-expressed in BCR-ABL P210 larva. A significant increase of Diptericin A and TotA in BCR-ABL T315I larva when compared to BCR-ABL P210 larva. (G) Analysis in adults: Drosomycin, Diptericin A , and TotA relative expressions normalized to RPL11 in control, BCR-ABL P210 and BCR-ABL T315I adult flies. A significant decrease in Drosomycin expression in BCR-ABL T315I adult flies when compared to control flies and BCR-ABL P210 . Diptericin A is overexpressed in BCR-ABL P210 adult flies compared to control adult flies. TotA is overexpressed in BCR-ABL T315I adult flies compared to BCR-ABL P210 and control adult flies. Error bars represent S.E.M B,D,E: n = 30 triplicates tested. F: n = 50 triplicates tested. G: n= 25 triplicates tested. One-way ANOVA with Tukey’s posthoc test (B), Chi-square test (E), and unpaired T-test (F,G) were performed to test statistical significance (*, p<0.05; **, p <0.01; ***, p<0.001).

Description

Chronic Myeloid Leukemia (CML) is a myeloproliferative neoplasm resulting from the BCR-ABL fusion protein coded by the Philadelphia chromosome which results from a reciprocal translocation between the Abelson murine leukemia gene ( ABL ) on chromosome 9 and Breakpoint Cluster Region gene ( BCR ) on chromosome 22 (Jabbour and Kantarjian 2018, Nowell and Hungerford 1960, Rowley 1973). This translocation creates the BCR-ABL oncogene which codes for the BCR-ABL fusion protein; a constitutively active tyrosine kinase (Lugo et al. 1990). Tyrosine kinase inhibitors (TKIs) are considered the gold standard treatment for CML patients (Hochhaus et al. 2008). Despite the advancement offered by the first and second-generation TKIs, there are certain resistant BCR-ABL mutant leukemic clones. For instance, the T315I mutation which results from the substitution of Threonine with Isoleucine at the 315 th position of ABL imparts resistance to first and second generation TKIs (O'Hare et al. 2011, Barouch-Bentov and Sauer 2011). One TKI that showed efficacy against the T315I mutation is ponatinib (Tanaka et al. 2010, Chan et al. 2012). However, due to its pan-activity on different kinases, ponatinib has severe side effects and high toxicity and is now administered to patients with precaution (Miller et al. 2014). Despite the extensive research on BCR-ABL, the molecular mechanisms and functional interactors in wild-type P210 and T315I mutant background are yet to be fully understood. Conservation between Drosophila melanogaster and mammalian genes (Klein 1997), in addition to the shared homology in proteins that interact with BCR-ABL (Fogerty et al. 1999, Bashaw et al. 2000), suggest that a fly model can be used to understand BCR-ABL genetic interactors (Lo Iacono et al. 2021). We previously validated a CML Drosophila model for drug screening using TKIs. We expressed BCR-ABL P210 and BCR-ABL T315I in Drosophila eyes and observed a rough eye phenotype which was more severe in T315I mutants. Furthermore, we used this eye model to test the efficacy of clinically administered TKIs (Al Outa et al. 2020). Bernardoni et al. showed similar rough eye phenotypes upon expression of BCR-ABL P210 through interaction with endogenous Drosophila Abl (Ena) indicating a conserved signal transduction pathway between humans and flies. In addition, BCR-ABL expression in the hematopoietic precursor cells of the lymph gland affected Drosophila blood cell homeostasis by increasing the number of circulating blood cells (Bernardoni et al. 2019). Nevertheless, the impact of BCR-ABL oncogene on innate immunity is yet to be understood. Fruit flies possess two forms of innate immune responses, cellular and humoral. The cellular response is mediated by Drosophila hemocytes which can be either circulating or sessile. Circulating hemocytes are present in the hemolymph while sessile hemocytes are found in pockets between the epidermis and muscular layers in the larvae (Shrestha and Gateff 1982, Lanot et al. 2001). Circulating hemocytes can be of three types, macrophage-like plasmatocytes, crystal cells, and lamellocytes. Plasmatocytes phagocytose bacteria and apoptotic debris while crystal cells are involved in the melanization process; the latter is analogous to wound healing. Lamellocytes, the largest in size among circulating hemocytes, are very low in number and differentiate only upon parasitic infection (Rizki and Rizki 1980, Franc et al. 1996). The humoral response on the other hand results in the synthesis of antimicrobial peptides (AMPs) and hemolymph coagulation and melanization. Humoral pathways help Drosophila melanogaster discriminate between pathogens based on their surface molecules such that, either one of the NF-κB transcription factors can be activated; Dorsal/Dif or Relish, which are representative of the Toll or IMD pathway, respectively. The JAK/STAT pathway on the other hand was shown to be involved in viral infection whereby Domeless activates the transcription factors Hopscotch and STAT92E, consequently activating the expression of immune and stress-responsive genes such as Tep1 and Tot A (Lemaitre et al. 1997, Lemaitre and Hoffmann 2007). Therefore, the Drosophila’s reductionist hematopoietic and immune system would aid in understanding the role of BCR-ABL expression on the immune response and hematopoiesis in general.

First, we validated the expression of BCR-ABL P210 and BCR-ABL T315I in the hemocytes. We utilized the UAS-Gal4 system to drive oncogene expression in circulating hemocytes and the cortical zone of the lymph gland using Hml Δ-Gal4;UAS-GFP (Sinenko and Mathey-Prevot 2004). Upon larval bleed, the expression of GFP was visualized in hemocytes (Figure 1A a,b,c) . Control hemocytes lacking transgene expression (Figure 1A a,a’) whilst the expression of the BCR-ABL P210 (Figure 1A b,b’) and BCR-ABL T315I (Figure 1A c,c’) were visualized in most of the GFP expressing hemocytes merged images ( Figure 1A b,c )

Next, we assessed the effect of expression of both oncogenes on circulating hemocytes (n=30 triplicates). Expression of both BCR-ABL P210 and BCR-ABL T315I in hemocytes resulted in a significant increase in circulating hemocyte number compared to control. The average number of circulating hemocytes in control flies was 2.7× 10 5 cells/ml, compared to 9.9 × 10 5 cells/ml in BCR-ABL P210 and 13.4 × 10 5 cells/ml in BCR-ABL T315I expressing flies. Notably, BCR-ABL T315I exhibited a significantly higher hemocyte number compared to BCR-ABL P210 (Figure 1B) .

Furthermore, we assessed sessile hemocyte mobilization since it is one of the key indicators of the immune burden in Drosophila melanogaster (n=30 triplicates) (Zettervall et al. 2004, Márkus et al. 2009). This is phenotypically visualized in the banding pattern of the sessile hemocytes in third-instar larvae. Three phenotypic criteria were used to categorize the degree of sessile hemocyte disruption; banded, partially disrupted, and disrupted (Figure 1C, D) . The expression of BCR-ABL P210 and BCR-ABL T315I resulted in disruption of sessile hemocyte patterning. All control larvae showed normal sessile patterning (100%). The patterning was disrupted in BCR-ABL P210 ; with 40% exhibiting partial banding and 40% showing complete disruption. Interestingly, 90% of the BCR-ABL T315I larvae showed complete disruption with merely 10% with partial banding. The increased disruption in BCR-ABL T315I sessile patterning was highly significant compared to BCR-ABL P210 and was consistent with the higher increase in circulating hemocytes (Figure 1E) .

Given the phenotypic defects observed in the cellular arm of innate immunity in BCR-ABL P210 and BCR-ABL T315I expressing larvae, we further examined the status of humoral Toll, ImD, and JAK/STAT pathways at the mRNA level by quantifying downstream effectors such as Drosomycin, Diptericin A and Turandot A ( TotA) at the 3 rd -instar larval (n=50 triplicates) and adult stages (n=25 triplicates). At the 3 rd -instar larval stage, expression of BCR-ABL P210 and BCR-ABL T315I resulted in dysregulation of all pathways. There was a significant increase in Drosomycin and TotA expression in BCR-ABL P210 and BCR-ABL T315I larva when compared to the control; a mean of 4 and 5-fold increase in Drosomycin and a mean of 15 and 30-fold increase in TotA expression in BCR-ABL P210 and BCR-ABL T315I larva, respectively. Notably, the overexpression of TotA in BCR-ABL T315I larva was significant when compared to that of BCR-ABL P210 larva. As for Diptericin A , a significant under-expression in BCR-ABL P210 larva was detected while BCR-ABL T315I larva had a mean of 2-fold increase when compared to the control (Figure 1F). Likewise, in the adult stage, the expression of BCR-ABL resulted in dysregulation of all pathways. We detected a significant downregulation in Drosomycin expression in BCR-ABL flies compared to control. However, there was no significant difference in Drosomycin expression when comparing BCR -ABL P210 to control. In addition, there was a 2.5-fold increase in Diptericin A expression in BCR-ABL flies when compared to the control flies. Furthermore, there was a significant difference in TotA relative expression between control flies and BCR-ABL T315I . BCR-ABL expressing flies showed a 66.7-fold increase compared to BCR-ABL P210 which showed a 5.1-fold increase compared to control ( Figure 1G ).

Utilizing an established Drosophila melanogaster CML model (Bernardoni et al. 2019), this study demonstrated transformative phenotypes in the hemolymph upon the expression of BCR -ABL P210 and BCR-ABL T315I which were represented by an increase in hemocyte count and sessile hemocyte patterning disruption when compared to control flies. Moreover, these phenotypic defects in the cellular arm of innate immunity were associated with a dysregulation in the humoral Toll, ImD, and JAK/STAT pathways at the mRNA level in both the 3 rd instar larval and adult stages. Interestingly, BCR-ABL T315I flies presented more severe phenotypes and a higher deviation in humoral dysregulation than BCR -ABL P210 flies when compared to the control; there were significant differences even between BCR -ABL P210 and BCR-ABL T315I flies.

The higher number of hemocytes exhibited in BCR-ABL T315I flies when compared to wild-type BCR-ABL P210 flies indicates a more prominent effect of the BCR-ABL T315I mutant on hemocyte homeostasis. The importance of this finding stems from the role hemocytes play as a primary line of defense in Drosophila melanogaster . A similar increase in the hemocyte number was observed in another study when BCR-ABL P210 was expressed in the lymph gland (Baril et al. 2017). Furthermore, since the presence of a stressor such as the expression of oncogenes might result in the recruitment of hemocytes from sessile compartments to the hemolymph (Zettervall et al. 2004), we examined whether BCR-ABL expression presents an immune burden and if BCR-ABL P210 mobilizes the sessile hemocytes differently from BCR-ABL T315I . We observed more prominent sessile patterning disruption in BCR-ABL T315I . This could highlight differential interaction of BCR-ABL T315I with the extracellular matrix (ECM) that controls hemocyte migration. For instance, Kumar et al. , suggested that BCR-ABL varies from wild-type BCR-ABL in its interaction with the ECM. Particularly, the integrin β3/ILK-mediated signaling pathway affects leukemia progression in BCR-ABL distinctly compared to wild-type BCR-ABL . BCR-ABL showed lower phosphorylation of focal adhesion kinase (FAK) and integrin-linked kinase (ILK) as well as lower disposition of Fibronectin (Kumar et al. 2020). Furthermore, Moreira et al . showed that zyxin knockdown (involved in the formation of adhesion sites that connect the ECM to the cellular cytoskeleton) resulted in a significant increase in cell speed and migration (Moreira et al. 2013). Therefore, one possible explanation for the severe disruption in sessile patterning in BCR-ABL could be its involvement in activating integrins and adhesion complexes which are required for migration of the sessile hemocytes.

The effect of BCR-ABL on the cellular immunity consequently directed us to assess the status of humoral immune pathways upon oncogene expression. The Toll pathway, for example, is an important regulator of hemocyte number in the hemolymph and their proliferation in the lymph gland (Lemaitre and Hoffmann 2007, Qiu et al. 1998). Toll pathway activation results in Drosomycin and Metchikowin activation (Hoffmann 2003, Hultmark 2003). When assessing the Toll pathway, there was a significant upregulation in Drosomycin transcript level in BCR -ABL P210 and BCR-ABL T315I flies during 3 rd instar larval stage which is maintained in adult flies of the former genotype while the latter is significantly downregulated in the adult stage. Meanwhile, concerning the ImD pathway, Diptericin A levels are usually first observed at the 3 rd instar larval stage which peak at the pupal stage only to decrease once again at the adult stage to levels lower than that of 3 rd instar larva (Graveley et al. 2011). This pattern was observed in the BCR-ABL T315I flies whereby they had a significantly higher expression at the 3 rd instar larval stage when compared to the control, only to return to comparable levels once more at the adult stage. However, interestingly BCR -ABL P210 flies shifted from having a significant under-expression at the 3 rd instar larval stage to a significant overexpression at the adult stage when compared to control flies.

As for the JAK/STAT pathway, the TotA gene is expressed during the third-instar larval stage, maintained throughout the entire pupal period with very low levels of expression in adult stages only to increase gradually once more 3-4 weeks after eclosure. However, it is induced in adults under stressful conditions such as high temperatures and bacterial challenges (Ekengren and Hultmark 2001, Ekengren et al. 2001). As such, we anticipated an increase in TotA expression in all flies at 29ºC. Interestingly, there was a significant increase in TotA expression in BCR-ABL T315I flies which was maintained from the 3 rd instar larval stage into the adult stage while BCR -ABL P210 flies demonstrated an increased expression of TotA only in the 3 rd instar larval stage and levels comparable to control flies in the adult stage. This suggests that the BCR-ABL T315I mutant is more stress-tolerant. This may be associated with an increased expression of heat shock proteins, stress-induced MAP kinase cascades, NF-κB signal transduction, and/or JAK/STAT pathway signaling events; all of which could contribute to resistance in CML patients with this mutation against TKIs. In fact, the JAK/ STAT pathway has been studied extensively in CML. STAT5 was shown to maintain the survival and growth of CML cells and JAK2 has been correlated with increased LSC persistence in a TKI background (Warsch et al 2013). Therefore, any of these stress-response signaling elements could be therapeutic targets for a combined therapy with current FDA-approved TKIs. In fact, clinical trials utilizing pegylated interferon (IFN) in combination with second generation TKIs are already underway (Patel et al. 2017). Lastly, due to the significant increase in JAK/STAT pathway in BCR-ABL T315I , reflected in the increase of Tot A maintained from 3 rd instar larval to adult stage , associated with the significant decrease in Drosomycin during the adult stage echoed the findings by Kim et al. which showed that overexpression of the JAK/STAT pathway could decrease Drosomycin via the Jra/Stat92E/Dsp1 repressosome complex (Kim et al. 2007). As such, it would be interesting to conduct bacterial challenge assays examining the JAK/STAT pathway, which might elucidate the etiology behind resistance to TKI treatment experienced by CML patients with mutant BCR -ABL and whether this strong stress response perpetuated by the JAK-STAT pathway may result in suppression of other critical immune pathways which might affect response to treatment.

Methods

Fly stocks

Fly stocks used were w1118 (wt) (BDSC #3605), Hml Δ-Gal4; UAS-GFP (BDSC #30140), UAS-BCR-ABL (p210) (Al Outa et al. 2020) and UAS-BCR-ABL (Al Outa et al. 2020). BCR-ABL1 p210 and BCR-ABL1 p210/T315I were inserted into pUAST-attB Drosophila expression vector (Custom DNA cloning). 1x Myc tag (MEQKLISEEDL) with its own start codon was added at the N-terminus before the transcription start site of BCR (EcorI-and combined speI-xbaI sites). pUAST-attB-myc BCR-ABL1 p210 and pUAST-attB-myc BCR-ABL1 p210/T315I were injected into y1 w67c23; P {CaryP} ABLattP2 (8622 BDSC) embryos to generate transgenic flies (BestGene Inc, Chino Hills, CA). Fly crosses were performed at 29˚C.

Immunofluorescence

For hemocyte staining, late wandering third instar were bled in 10 µl of 1X-PBS in a 12 well plate using a modified protocol (Evans et al. 2014). Then the bleed was transferred to slides and left to attach for 30 minutes in a humidified chamber. The bleed was washed with 1X PBS- 0.3% Triton (PBST) twice for 5 minutes, samples were then blocked in 5% Normal Goat Serum (NGS) in PBST (Dako, Santa Clara, CA) for 2 hours. Anti-Myc antibody (9E-10 kind gift from Bengt Hallberg) 1:300 was used on hemocytes overnight. Samples were washed with PBST 2x5 minutes. Samples were incubated with secondary antibody Alexa-594 1:500 in 5%NGS PBST (Abcam, Cambridge, UK). Samples were washed with PBST 2x5 minutes. Then Fluor shield Mounting Medium with DAPI (Abcam) was added and samples were then imaged using a laser scanning confocal microscope (Carl Zeiss Laser Scanning Microscopy 710, Jena, Germany).

Hemocyte bleed and count

Late wandering third-instar larvae were picked from the walls of the food vial with a pair of forceps and cleaned from food and debris by placing them in a 1X PBS containing petri plate before being transferred to a tissue paper to dry them. The larvae were kept in the petri plate on ice throughout the bleed process to minimize their movement. The larvae were placed in 13 µl of 1X-PBS that was placed on a parafilm strip under a light microscope. Using two pairs of forceps the larval cuticle was pierced and hemolymph was released. The larva was left to bleed for 30 seconds. The larva was removed with one side of the forceps so as not to lose a greater volume of the bleed. The hemolymph bleed was mixed thoroughly with a pipette before taking 10 µl of the bleed and placing it in a Neubauer chamber (Buerker-Turk, Marienfeld, Germany) with a coverslip attached. The Neubauer chamber was placed under an Axiostar plus light microscope (Zeiss, Oberkochen, Germany) and the number of cells in each of the four quadrants was noted down. Hemocyte number was then reported as hemocytes per milliliter of bleed. The average number of hemocytes was obtained from three different biological replicates (N=3) with ten third-instar larvae for each replicate. Total number of larvae used in each condition is (n=30).

Larvae handling and imaging for sessile patterns

Late wandering third-instar larvae were picked from the walls of the food vial with a pair of forceps and cleaned from food and debris by placing them in a petri plate containing 1X Phosphate Buffered Saline (PBS) (Sigma Aldrich, St. Louis, MO). After drying with a tissue paper, the larvae were placed in an Eppendorf at -80ºC for one and a half minutes. The Eppendorf was then placed on a plate on ice. The larvae were then imaged for sessile patterning using an SZX2-ILLT GFP Olympus microscope (Olympus, Tokyo, Japan) while submerged in a drop of 50% glycerol (Sigma-Aldrich, St. Louis, MO) This is a modified protocol (Anderl et al. 2016). Performed on three different biological replicates (N=3) with thirty third-instar larvae for each replicate. Total number of larvae used in each condition is (n=90).

RNA extraction

Third-instar larva:

50 larvae were bled in 20-60 microliter PBS then put in 1 milliliter of Trizol (TRI reagent, Sigma Aldrich). Centrifugated at 12,000g for 15 mins at 4ºC. Then 200 microliters of chloroform (Sigma-Aldrich) were added. Tubes were shaken well then centrifugated at 12,000g for 15 mins at 4ºC. Upper layer was transferred to another Eppendorf and added to it 0.7V of isopropanol 100%. Kept at room temperature for 10mins. Then centrifugated for 30 mins max speed at 4ºC. Isopropanol was removed then RNA pellet was washed with 1 milliliter ethanol 70% (Sigma-Aldrich) which was centrifugated at max speed for 10 mins at 4ºC. Ethanol was removed and Eppendorf was set to air dry for 10 mins under hood. Pellet was resuspended in 20 microliters Nuclease free water (Autoclaved milli-Q water). Performed on three different biological replicates (N=3) with fifty third-instar larvae for each replicate. Total number of larvae used in each condition is (n=150).

Adult flies:

Total RNA was extracted using Trizol from 25 adult flies (3 days old). After adding 150µl of Trizol, flies were ground using a pestle while working on ice. The pestle was washed with additional 150 µl of Trizol. The samples were left to incubate for 5 minutes at room temperature under the fume hood then centrifuged at (14,000 g) at 4˚C for 5 minutes. All centrifugations were done at 4˚C at maximum speed (14,000 g). Chloroform was added to the Trizol in a ratio of 1:5 (Chloroform: Trizol). The samples were mixed and incubated for 1 minute and centrifuged for 10 minutes. The upper layer was transferred, and isopropanol was added. The mixture was incubated at room temperature for 10 minutes and then centrifuged for 30 minutes. Samples were then washed with 70% ethanol twice and centrifuged for 10 minutes. the pellet was air-dried and resuspended in 30 µl Nuclease free water. Performed on three different biological replicates (N=3) with 25 adult flies for each replicate. Total number of larvae used in each condition is (n=75).

Quantitative PCR

Real time PCR was performed using SYBR green (Bio-Rad). Each sample was run in triplicates. Bio-RAD CFX96 Real time system was used for real time analysis. Relative gene expression was analyzed using the Livak and Schmittegn system (Livak and Schmittgen 2001). The assessment was repeated for three biological replicates where each biological group included 50 third-instar larva/25 adult flies. In the case of the larva, expression levels were normalized against the housekeeping gene Ribosomal protein 49 ( Rp49 ). While in the case of the adult flies, expression levels were normalized against the housekeeping gene Ribosomal protein L11 ( RpL11 ). The Forward and Reverse primers (Macrogen, Seoul, South Korea) sequences used all have an annealing temperature of 57 °C. Sequences are reported in the Reagents section. Targets tested were Drosomycin, Diptericin A, and TotA.

Statistical Analysis Results

These statistical analyses were performed on a GraphPad Prism 6.0 program. P-values lower than 0.05 were considered statistically significant.

Reagents

Table 1: Drosophila melanogaster stocks used:

UAS-BCR-ABL

UAS-BCR-ABL

UAS-BCR-ABL

UAS-BCR-ABL

Table 2: Primers used for q-PCR:

Figure Panels	Statistical Test		P-value
B	ANOVA		<0.0001
B	Tukey’s post-hoc test	wt vs. BCR-ABL P210	<0.0001
B	Tukey’s post-hoc test	wt vs. BCR-ABL T315I	<0.0001
B	Tukey’s post-hoc test	BCR-ABL P210 vs. BCR-ABL T315I	<0.0001
E	Chi-square test	Banded: wt vs. BCR-ABL P210	<0.0001
E	Chi-square test	Banded: wt vs. BCR-ABL T315I	<0.0001
E	Chi-square test	Banded: BCR-ABL P210 vs. BCR-ABL T315I	<0.001
E	Chi-square test	Partially: wt vs. BCR-ABL P210	<0.0001
E	Chi-square test	Partially: wt vs. BCR-ABL T315I	0.0115
E	Chi-square test	Partially: BCR-ABL P210 vs. BCR-ABL T315I	0.0018
E	Chi-square test	Disrupted: wt vs. BCR-ABL P210	<0.0001
E	Chi-square test	Disrupted: wt vs. BCR-ABL T315I	<0.0001
E	Chi-square test	Disrupted: BCR-ABL P210 vs. BCR-ABL T315I	<0.0001
F	Unpaired T-test	Drosomycin : wt vs. BCR-ABL P210	<0.001
F	Unpaired T-test	Drosomycin: wt vs. BCR-ABL T315I	<0.001
F	Unpaired T-test	Drosomycin: BCR-ABL P210 vs. BCR-ABL T315I	0.47
F	Unpaired T-test	Diptericin A: wt vs. BCR-ABL P210	<0.001
F	Unpaired T-test	Diptericin A: wt vs. BCR-ABL T315I	<0.001
F	Unpaired T-test	Diptericin A: BCR-ABL P210 vs. BCR-ABL T315I	<0.001
F	Unpaired T-test	TotA: wt vs. BCR-ABL P210	<0.001
F	Unpaired T-test	TotA: wt vs. BCR-ABL T315I	<0.001
F	Unpaired T-test	TotA: BCR-ABL P210 vs. BCR-ABL T315I	<0.001
G	Unpaired T-test	Drosomycin : wt vs. BCR-ABL P210	0.47
G	Unpaired T-test	Drosomycin: wt vs. BCR-ABL T315I	0.0068
G	Unpaired T-test	Drosomycin: BCR-ABL P210 vs. BCR-ABL T315I	0.0365
G	Unpaired T-test	Diptericin A: wt vs. BCR-ABL P210	0.0442
G	Unpaired T-test	Diptericin A: wt vs. BCR-ABL T315I	0.9008
G	Unpaired T-test	Diptericin A: BCR-ABL P210 vs. BCR-ABL T315I	0.0713
G	Unpaired T-test	TotA: wt vs. BCR-ABL P210	0.0578
G	Unpaired T-test	TotA: wt vs. BCR-ABL T315I	0.0022
G	Unpaired T-test	TotA: BCR-ABL P210 vs. BCR-ABL T315I	0.0030

	Genotype	Source	Stock #
w1118 (wt)	w[1118]	Bloomington Drosophila Stock Center	3605
Hml Δ-Gal4; UAS-GFP	w[1118]; P{w[+mC]=Hml-GAL4.Delta}2, P{w[+mC]=UAS-2xEGFP}AH2	Bloomington Drosophila Stock Center	30140
UAS-BCR-ABL P210	UAS-BCR-ABL P210	(Al Outa et al. 2020).	FBtp0141454
UAS-BCR-ABL T315I	UAS-BCR-ABL T315I	(Al Outa et al. 2020).	FBtp0141455

Target Gene	Primer	Sequence (5’ to 3’)
Drosomycin	Forward	TACTTGTTCGCCCTCTTCG
	Reverse	GTATCTTCCGGACAGGCAGT
Diptericin A	Forward	CCGCAGTACCCACTCAATCT
	Reverse	ACTGCAAAGCCAAAACCATC
TotA	Forward	CCCAGTTTGACCCCTGAG
	Reverse	GCCCTTCACACCTGGAGA
RP49	Forward	CGGATCGATATGCTAAGCTGT
	Reverse	GCGCTTGTTCGATCCGTA
RPL11	Forward	CGATCCCTCCATCGGTATCT
	Reverse	GCCCTTCACACCTGGAGA