Literature DB >> 35604932

Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1 paralogs.

Line Manceau1, Julien Richard Albert1, Pier-Luigi Lollini2, Maxim V C Greenberg1, Pascale Gilardi-Hebenstreit1, Vanessa Ribes1.   

Abstract

The hallmarks of the alveolar subclass of rhabdomyosarcoma are chromosomal translocations that generate chimeric PAX3-FOXO1 or PAX7-FOXO1 transcription factors. Overexpression of either PAX-FOXO1s results in related cell transformation in animal models. Yet, in patients the two structural genetic aberrations they derived from are associated with distinct pathological manifestations. To assess the mechanisms underlying these differences, we generated isogenic fibroblast lines expressing either PAX-FOXO1 paralog. Mapping of their genomic recruitment using CUT&Tag revealed that the two chimeric proteins have distinct DNA binding preferences. In addition, PAX7-FOXO1 binding results in greater recruitment of the H3K27ac activation mark than PAX3-FOXO1 binding and is accompanied by greater transcriptional activation of neighbouring genes. These effects are associated with a PAX-FOXO1-specific alteration in the expression of genes regulating cell shape and the cell cycle. Consistently, PAX3-FOXO1 accentuates fibroblast cellular traits associated with contractility and surface adhesion and limits entry into S phase. In contrast, PAX7-FOXO1 drives cells to adopt an amoeboid shape, reduces entry into M phase, and causes increased DNA damage. Altogether, our results argue that the diversity of rhabdomyosarcoma manifestation arises, in part, from the divergence between the genomic occupancy and transcriptional activity of PAX3-FOXO1 and PAX7-FOXO1.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35604932      PMCID: PMC9166405          DOI: 10.1371/journal.pgen.1009782

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   6.020


Introduction

Fusion-positive rhabdomyosarcomas (FP-RMS) are one of the most metastatic and deleterious subgroups of paediatric soft tissue cancers [1]. Their emergence and development are closely associated with the activity of two paralogous fusion transcription factors (TFs), PAX3-FOXO1 and PAX7-FOXO1 [1] (S1A Fig). They are generated by the chromosomal translocations t(2;13)(q35;q14) or t(1;13)(p36;q14), which fuse the paired DNA-binding (PrD) and homeodomain (HD) domains of PAX3 or PAX7, respectively, to the transactivation domain of FOXO1. PAX3-FOXO1 and PAX7-FOXO1 positive tumour growths have broadly similar histological features, with clusters of round cells with sparse cytoplasm separated by fibrous septa [2]. In contrast, compared to patients expressing PAX7-FOXO1, those with the PAX3-FOXO1 translocation are more frequent, generally older, tend to harbour more metastases, and have poorer survival rates [3]. The clinical differences observed between patients harbouring the different translocations could arise from distinct and nonexclusive mechanisms. First, the specific anatomic positions of PAX3-FOXO1 and PAX7-FOXO1 tumours would argue for differing cells of origin (e.g.[4]). Second, genetic aberrations that accumulate following t(2;13) or t(1;13) translocations segregate PAX3-FOXO1 and PAX7-FOXO tumours, and may orient tumours towards distinctive states [5,6]. Both tumour types often undergo genome-wide duplication and carry focal chromosomal amplifications. While these amplifications extend the chromosomal segment carrying the PAX7-FOXO1 fusion, they increase the copy number of pro-proliferative genes in PAX3-FOXO1 tumours. Finally, each of the PAX-FOXO1 chimeric proteins could direct cells towards specific transcriptional states. Supporting this idea, PAX3-FOXO1 and PAX7-FOXO1 RMS differ in their DNA methylation profile and transcriptome [7-9], reflecting an altered cis-regulatory landscape [10]. The use of reporter transgenes demonstrated that the transactivation potential of PAX3-FOXO1 and PAX7-FOXO1 is much greater than that of the intact PAX3 and PAX7 TFs [11]. Furthermore, in several animal models, the forced expression of these two factors, when associated with pro-proliferative mutations, effectively generates growth masses reminiscent of patient-derived RMS tumours [12-15]. The molecular mechanisms underlying their tumorigenic transfection activity were mainly studied using PAX3-FOXO1 as a model [16-19]. PAX3-FOXO1 binds to non-coding cis-regulatory modules (CRMs) at DNA recognition motifs for its PrD domain or both its PrD and HD domains, but rarely exclusively on HD DNA binding motifs [16,17]. Furthermore, PAX3-FOXO1-bound CRMs are enriched in E-BOX motifs recognized by bHLH TFs [16,17]. This is consistent with PAX3-FOXO1 acting with other TFs, including myogenic bHLH TFs in establishing central active CRMs in RMS cells [16, 20]. In addition, the bHLH TF MYOD1 has been shown to increase the transactivation potential of PAX7-FOXO1 as measured using transcriptional reporters [21], while both PAX-FOXO1 inhibit MYOD1-mediated myogenic differentiation [22]. Finally, characterization of the chromatin landscapes of PAX3-FOXO1-bound CRMs in FP-RMS cell lines, fibroblasts and myoblasts revealed that PAX3-FOXO1 act as a pioneer TF [16,23]. It can bind and open previously closed chromatin loci, which acquire the characteristics of potent transactivating enhancers (e.g. super enhancers). Importantly, the mechanisms by which the two fusion TFs regulate transcription have not yet been systematically compared [7,11]. Therefore, it is not known whether the recruitment and genomic trans-activity of PAX7-FOXO1 is akin to PAX3-FOXO1. To gain insights into the role of the PAX-FOXO1 fusion TFs in tumorigenesis and heterogeneity, we directly compared their activities in a transgenic cellular model. By combining transcriptomic and chromatin profiling experiments with cell morphology and cell cycle assays, our results revealed a divergent transforming potential between the two PAX-FOXO1 proteins attributed to both differential use of their DNA binding domains and distinct trans-activation potential.

Results & discussion

PAX3-FOXO1 and PAX7-FOXO1 harbour divergent genomic occupancy and transactivation potential

To compare the activities of the PAX3-FOXO1 and PAX7-FOXO1 fusion proteins, we sought to design a system in which their expression can be controlled and expressed at similar levels in an identical cellular context. Human foreskin fibroblasts (HFF) were engineered to express a copy of a FLAG-tagged version of these TFs in a doxycycline (DOX)-inducible manner from the AAVS1 safeguard locus (S1B Fig). Three independent cell lines expressing PAX3-FOXO1 or PAX7-FOXO1 were generated (S1C Fig). All three PAX3-FOXO1 and PAX7-FOXO1 lines expressed similar fusion protein levels in bulk and at the single cell level 48h after exposure to DOX (S1C and S1E Fig). Using these cell lines, we first mapped the genomic targets of PAX3-FOXO1 and PAX7-FOXO1 using Cleavage Under Targets and Tagmentation (CUT&Tag) [24] (Figs 1 and S2 and S3). We used two separate antibodies to detect the fusion TFs directed against either the N-terminal FLAG tag or the C-terminal FOXO1 domain. The latter could be used, as wild-type FOXO1 levels were low in control HFF compared to that of the transgenic PAX-FOXO1 proteins (S1C and S1D Fig). Data obtained with these two antibodies and in separate cell lines gave similar results, validating the approach (S2A Fig). In total, we selected 6000 cis-regulator modules (CRMs) with the highest PAX3-FOXO1 and/or PAX7-FOXO1 binding signals (Figs 1A, 1B and S2A and S1 Table). The majority of PAX-FOXO1-bound CRMs occupied intronic or intergenic regions (S2B Fig). These regions were mostly enriched for DNA motifs known to be recognized by PAX3 and PAX7 DNA-binding domains and poorly enriched for FOXO1 DNA binding motifs (Figs 1C, 1D and S2C and S2 Table). Hence, as shown for PAX3-FOXO1, PAX7-FOXO1 DNA sequence specific recognition is mainly mediated via its PAX7 DNA binding domains [16,17,23]. Finally, approximately 18% of these regions were previously identified as bound by PAX3-FOXO1 in an RMS cell line, some of which are in close proximity to iconic PAX3-FOXO1 target genes in RMS, including MYOD1 and PIPOX (S2D and S2E Fig) [16]. Thus, the recruitment of PAX-FOXO1s to the genome is preserved in part across cellular contexts in which they act, and examination of PAX-FOXO1 activity on the fibroblast genome is likely to shed some light on the contribution of both paralogs in establishing the molecular states of the RMS.
Fig 1

PAX3-FOXO1 and PAX7-FOXO1 recruitment to the genome and impact on H3K27ac deposition.

(a) Examples of IGV tracks showing normalized FLAG and H3K27ac CUT&Tag reads distribution in cells expressing either PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) 48h post-DOX treatment. Scales in counts per million (CPM). (b) Heatmaps of normalized FLAG and H3K27ac CUT&Tag signals obtained in control (Ctl), PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) expressing HFF 48h post-DOX treatment in three cis-regulatory modules (CRMs) clusters. The ranking of the CRMs is the same on all heatmaps and follows the occupancy levels of PAX3-FOXO1 in descending order (arrow). Cluster 1 contains CRMs onto which the occupancy rate of PAX3-FOXO1 and PAX7-FOXO1 are similar. Cluster 2 CRMs are more bound by PAX3-FOXO1 than PAX7-FOXO1, and cluster 3 is the converse of cluster 2. (c) Logos of position weight matrices of DNA recognition motifs for the PAX paired (PrD) and/or homeodomain (HD) and by bHLH TFs (E-BOX). (d) Left panels: Enrichment for DNA binding motifs displayed in c in the CRMs belonging to the clusters defined in (b) (bars: -log2(p-value)). Right panels: Average profiles of normalized H3K27ac CUT&Tag signals at CRMs belonging to the clusters defined in (b) in the indicated control (Ctl), P3F or P7F cell lines. Note that the two P7F purple curves are superimposed.

PAX3-FOXO1 and PAX7-FOXO1 recruitment to the genome and impact on H3K27ac deposition.

(a) Examples of IGV tracks showing normalized FLAG and H3K27ac CUT&Tag reads distribution in cells expressing either PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) 48h post-DOX treatment. Scales in counts per million (CPM). (b) Heatmaps of normalized FLAG and H3K27ac CUT&Tag signals obtained in control (Ctl), PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) expressing HFF 48h post-DOX treatment in three cis-regulatory modules (CRMs) clusters. The ranking of the CRMs is the same on all heatmaps and follows the occupancy levels of PAX3-FOXO1 in descending order (arrow). Cluster 1 contains CRMs onto which the occupancy rate of PAX3-FOXO1 and PAX7-FOXO1 are similar. Cluster 2 CRMs are more bound by PAX3-FOXO1 than PAX7-FOXO1, and cluster 3 is the converse of cluster 2. (c) Logos of position weight matrices of DNA recognition motifs for the PAX paired (PrD) and/or homeodomain (HD) and by bHLH TFs (E-BOX). (d) Left panels: Enrichment for DNA binding motifs displayed in c in the CRMs belonging to the clusters defined in (b) (bars: -log2(p-value)). Right panels: Average profiles of normalized H3K27ac CUT&Tag signals at CRMs belonging to the clusters defined in (b) in the indicated control (Ctl), P3F or P7F cell lines. Note that the two P7F purple curves are superimposed. For approximately half of the total bound CRMs, the occupancy of PAX3-FOXO1 and PAX7-FOXO1 were comparable (Fig 1A–1I, cluster 1 in Fig 1B). In contrast, 1429 CRMs showed increased occupancy for PAX3-FOXO1 relative to PAX7-FOXO1 (Fig 1A-II, cluster 2 in Fig 1B) and 1475 CRMs the inverse (Fig 1A-III, cluster 3 in Fig 1B). Whereas PAX7-FOXO1 binding was barely detected in CRMs preferentially bound by PAX3-FOXO1, PAX3-FOXO1 recruitment was detected on most CRMs preferentially bound by PAX7-FOXO1 (Fig 1B). Thus, the two paralog proteins have divergent recruitment patterns in the genome, with PAX3-FOXO1 being more widespread than PAX7-FOXO1. To test whether the observed differences in fusion protein occupancy may stem from a distinct use of their DNA-binding domains [25,26], we probed the different sets of CRMs for several prototypical PAX3/7- and PAX3-FOXO1 PrD, PrD+HD, and HD DNA binding motifs (see Materials and Methods; Fig 1C and S2 Table). All PAX-FOXO1-bound CRMs were enriched in PrD DNA binding motifs, to a lesser extent, in PrD+HD DNA binding motifs (Fig 1DI-III). The HD DNA recognition motifs were detected in CRMs bound by both PAX-FOXO1s (Fig 1DI). However, this motif was sparsely present in PAX3-FOXO1 CRMs (Fig 1DII) and, in contrast, most represented in PAX7-FOXO1 CRMs (Fig 1DIII). Overall, these results suggest that PAX3-FOXO1 uses its PrD and HD to bind DNA, whereas PAX7-FOXO1 preferentially uses its HD [25,26]. We then scanned PAX-FOXO1-related CRMs for E-BOX motifs recognized by class II bHLH TFs (Fig 1C and S2 Table). Apart from the PAX3-FOXO1-specific CRMs, this E-BOX was strongly represented in the other PAX-FOXO1s-bound CRMs, supporting a common interaction between bHLH TFs and both PAX-FOXO1s [16,20-22] (Fig 1DI-III). We then assessed the chromatin status of PAX-FOXO1-linked CRMs in control and PAX-FOXO1s expressing HFF using CUT&Tag by mapping the genomic distribution of H3K27ac and H3K27me3, which are respectively hallmarks of transcriptionally active and repressed CRMs (Figs 1A, 1B, 1DIV-DVI and S3). We also analysed the distribution profile of the heterochromatin histone mark H3K9me3, which borders a fraction of PAX3-FOXO1 bound genomic regions in Rh4 RMS tumour cells [23]. Both PAX-FOXO1 proteins were recruited predominantly in CRMs which are in the control cell line (Ctl) in absence of fusion protein recruitment, unmarked by these three histone modifications with their levels very low compared to the regions of the genome more enriched for these marks (S3A–S3C Fig). The distribution profile and the levels of the heterochromatic H3K27me3 and H3K9me3 marks in the vicinity of these CRMs remained unchanged upon PAX-FOXO1 recruitment (S3A–S3C Fig). On a genome-wide scale, the occupancy rate of PAX-FOXO1s correlated better with de novo deposition of the H3K27ac mark than with the deposition of the heterochromatin marks (S3B Fig). Hence, PAX7-FOXO1, as PAX3-FOXO1, induces chromatin signatures of transcriptional activation [16]. Interestingly, H3K27ac levels showed a better correlation with PAX7-FOXO1 occupancy than with PAX3-FOXO1 occupancy (S3C Fig). Accordingly, the H3K27ac level on PAX-FOXO1-bound CRMs were generally higher in the presence of PAX7-FOXO1 than PAX3-FOXO1 (Figs 1A, 1B, 1DIV-DVI, S3A and S3CI). This was particularly visible on CRMs onto which both PAX3-FOXO1 and PAX7-FOXO1 could be recruited to (cluster 1 in Fig 1B). Thus, PAX7-FOXO1 ability to establish an active enhancer chromatin signature is greater than that of PAX3-FOXO1. This is reinforced by a principal component analysis of H3K27ac occupancy in the 6000 PAX-FOXO1 bound CRMs showing that ectopic PAX7-FOXO1 generates a chromatin state more distant from that of control cells than PAX3-FOXO1 (S3F Fig). Overall, our results demonstrate that the two RMS-associated paralog fusion TFs exhibit a divergent mode of recruitment to the genome, likely due to the previously identified discrete affinities of the DNA-binding domains of PAX3 and PAX7 for specific DNA motifs [27,28]. Thus, the fusion between the PAX DNA-binding domains and the FOXO1 transactivation domain would have preserved the diversification that has occurred during evolution in the genome recruitment patterns of PAX3 and PAX7. Our data also support the idea that PAX-FOXO1 chimeras act as pioneer factors as previously shown [16,23]. Both are able to bind unmarked chromatin and have the capacity to promote its transcriptional activation. While the recruitment of PAX7-FOXO1 in most cases results in the deposition of the active enhancer mark H3K27ac, this was much less the case for PAX3-FOXO1. As previously observed [24], some PAX3-FOXO1 bound regions (mainly in cluster 2) did not engage towards transactivation. This lack of activation could be due to a lower enrichment in DNA motifs recognised by both the PrD and HD domains of the PAX-FOXO1 or by the bHLH TFs. Supporting the former, it has been shown for the intact Pax7 protein that recruitment to a PrD-like motif is less likely to result in transcriptional activation than recruitment to motifs recognised by both PrD and HD. Finally, it is notable that the repertoire of DNA motifs in the PAX-FOXO1-bound regions we identified in HFF is much less enriched in juxtaposed PrD and HD motifs than the PAX3-FOXO1-bound regions in tumour cells [26]. This could be due to a temporal dynamic in the recruitment mode of the PAX-FOXO1 factors. Indeed, it has been shown that some pioneer factors begin to be recruited to DNA first on incomplete DNA recognition motifs and then on more complete motifs [27]. Supporting this idea, in myoblasts, PAX3-FOXO1 is less recruited to PrD+HD sites after 8 hours than after 24 hours [23]. Finally, in the tumour context, the specificities in the transcriptional activity of PAX3-FOXO1 and PAX7-FOXO1 that we have revealed in fibroblasts can be expected to be amplified or diminished by other parameters, such as the presence of several isoforms with variable transcriptional potential [28], variations in the expression levels of PAX-FOXO1s [29], or the cellular context (cells of origin and history).

PAX3-FOXO1 and PAX7-FOXO1 induce unique transcriptomic landscapes

To investigate the phenotypic consequences of the divergent activity of PAX3-FOXO1 and PAX7-FOXO1 on chromatin, we first compared the RNAseq-based transcriptome of HFF expressing either chimeric TF or control HFF (Figs 2A and S4A and S3 Table). Mirroring the differential H3K27ac landscapes, the transcriptome of PAX7-FOXO1 cells diverged more from controls than the transcriptome of PAX3-FOXO1 cells (S4AI and S4AII Fig). We identified the genes whose expression varied the most between samples, which likely underlay the segregation of the transcriptome, and used K-means clustering heatmaps to highlight their behaviour in the samples (Figs 2A and S4AIII). PAX3-FOXO1 and PAX7-FOXO1 decreased the expression of the same subset of genes (cluster A in Fig 2A and S3 Table). This subset was weakly enriched in genes in the vicinity of the identified PAX-FOXO1 recruitment sites, and was therefore unlikely to be directly regulated by PAX-FOXO1s (Fig 2BI). In contrast, the three clusters of genes upregulated by PAX3-FOXO1 and/or PAX7-FOXO1 were significantly enriched in genes nearby PAX-FOXO1s bound CRMs (clusters B to D in Fig 2A and 2BII-IV and S4AIII Fig). In addition, genes more induced by PAX7-FOXO1 than by PAX3-FOXO1 were mainly enriched in CRMs preferentially bound by PAX7-FOXO1 (cluster D in Fig 2A and 2BIV and S4AII Fig). Conversely, genes on which PAX3-FOXO1 had a greater impact than PAX7-FOXO1 were predominantly enriched in CRMs bound by PAX3-FOXO1 (cluster C in Fig 2A, 2BIII and S4AIII Fig). Thus, differences in PAX-FOXO1 recruitment are responsible for differential gene activation. Consistent with this observation, genes located near CRMs that can be bound by both PAX-FOXO1s were generally induced in their presence, with higher levels in the presence of PAX7-FOXO1 than PAX3-FOXO1 (S4AV Fig, left panel). While genes close to the CRMs preferentially bound by one of the two PAX-FOXO1s displayed higher expression levels in cells expressing the PAX-FOXO1 that binds these CRMs, again with a higher activation for genes near CRMs bound by PAX7-FOXO1 than PAX3-FOXO1 (S4AV Fig, middle and right panels). Importantly, this further supports a greater trans-activation potential of PAX7-FOXO1 than PAX3-FOXO1. We next compared the transcriptomes of cells transiently expressing murine Pax3, Pax7, or PAX3-FOXO1 or PAX7-FOXO1 (S4B Fig). Genes induced by both PAX3-FOXO1 and PAX7-FOXO1 were poorly upregulated by Pax3 and Pax7. In contrast, genes that were specifically induced by one of the PAX-FOXO1 paralogs were also induced by its wild-type PAX variant and were not induced by the PAX paralog variant (Figs 2C and S4B). Therefore, the induction of specific gene cohorts by one of the PAX-FOXO1 chimeras is a property that emanates from its PAX moiety.
Fig 2

Characterization of PAX3-FOXO1 and PAX7-FOXO1 specific transcriptomic signatures.

(a) Standardized and normalized expression levels of genes assayed by RNAseq and belonging to the 4 K-means clusters defined in S4AIII Fig and showing significant variations in their expression between control, PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) expressing cells. (b) Left panels: Enrichment for genes in the vicinity of cis-regulatory modules (CRMs) defined in Fig 1B (PFs CRMs, P3F CRMs, P7F CRMs are respectively clusters 1,2,3 in Fig 1B) in the gene clusters defined in (a). Right panels: Enrichment for genes associated with FP-RMS11 (FP-RMS sig.) and genes associated with PAX3-FOXO1 (P3F FP-RMS sig.) and PAX7-FOXO1 (P7F FP-RMS sig.) in RMS biopsies in the gene clusters defined in (a). Bars: -log2(p-value). (c) Heatmap of K-means clustered genes that displayed higher expression in P3F and/or P7F transfected cells compared to control cells. Fold changes across Pax3, Pax7, P3F and P7F samples are colour coded in blue (lower level) and in red (higher level). (d) Volcano plot comparing gene expression levels assayed by microarray between PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) biopsies, with statistical significance (-log10(p-value)) on the y-axis versus the magnitude of change (log2(fold change in PAX7-FOXO1 samples compared to PAX3-FOXO1)) on the x-axis. Grey dots: not significantly differentially expressed genes, green dots: significantly upregulated genes in PAX3-FOXO1 samples, purple dots: significantly upregulated genes in PAX7-FOXO1 samples. (e) GSEA plots showing the enrichment for genes associated to PAX3-FOXO1 activity in RMS [16] or to PAX3-FOXO1 and PAX7-FOXO1 activity in RMS (cf. d) in differentially expressed genes between control (Ctl) HFF and HFF expressing either PAX-FOXO1s (PF) or PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) or between P3F and P7F samples. NES: normalized enrichment score; FDR: false discovery rate.

Characterization of PAX3-FOXO1 and PAX7-FOXO1 specific transcriptomic signatures.

(a) Standardized and normalized expression levels of genes assayed by RNAseq and belonging to the 4 K-means clusters defined in S4AIII Fig and showing significant variations in their expression between control, PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) expressing cells. (b) Left panels: Enrichment for genes in the vicinity of cis-regulatory modules (CRMs) defined in Fig 1B (PFs CRMs, P3F CRMs, P7F CRMs are respectively clusters 1,2,3 in Fig 1B) in the gene clusters defined in (a). Right panels: Enrichment for genes associated with FP-RMS11 (FP-RMS sig.) and genes associated with PAX3-FOXO1 (P3F FP-RMS sig.) and PAX7-FOXO1 (P7F FP-RMS sig.) in RMS biopsies in the gene clusters defined in (a). Bars: -log2(p-value). (c) Heatmap of K-means clustered genes that displayed higher expression in P3F and/or P7F transfected cells compared to control cells. Fold changes across Pax3, Pax7, P3F and P7F samples are colour coded in blue (lower level) and in red (higher level). (d) Volcano plot comparing gene expression levels assayed by microarray between PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) biopsies, with statistical significance (-log10(p-value)) on the y-axis versus the magnitude of change (log2(fold change in PAX7-FOXO1 samples compared to PAX3-FOXO1)) on the x-axis. Grey dots: not significantly differentially expressed genes, green dots: significantly upregulated genes in PAX3-FOXO1 samples, purple dots: significantly upregulated genes in PAX7-FOXO1 samples. (e) GSEA plots showing the enrichment for genes associated to PAX3-FOXO1 activity in RMS [16] or to PAX3-FOXO1 and PAX7-FOXO1 activity in RMS (cf. d) in differentially expressed genes between control (Ctl) HFF and HFF expressing either PAX-FOXO1s (PF) or PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) or between P3F and P7F samples. NES: normalized enrichment score; FDR: false discovery rate. Importantly, the genes induced by PAX3-FOXO1 and by PAX7-FOXO1 in HFF were significantly enriched for gene signature characteristics of fusion positive RMS (Figs 2EI-II and S5A). Thus, we next wondered whether they could explain fusion subtype-dependent variation in transcriptomic status of RMS tumours [8,9,30]. We first evaluated the specific gene signatures of the PAX-FOXO1 paralog in RMS using previously published microarray data on 99 PAX3-FOXO1 and 34 PAX7-FOXO1 biopsy samples [15] (Fig 2D and S4 Table). We identified 988 genes more enriched in PAX3-FOXO1 biopsies than in PAX7-FOXO1 biopsies and 856 genes specifically enriched in PAX7-FOXO1 tumours. Functional annotation of these genes highlighted that the PAX3-FOXO1-specific signature was enriched in regulators of cell cycle, cell migration, and metabolism (S5B Fig and S5 Table). The genes associated with PAX7-FOXO1, on the other hand, encoded regulators of embryonic lineage differentiation as well as genes involved in cytoskeletal remodelling (S5C Fig and S5 Table). Thus, paralog-specific transcriptional states could confer particular cellular traits to the cell transformation. Importantly, enrichment analyses indicated that PAX3-FOXO1 and PAX7-FOXO1 specific gene signatures in RMS and HFF were significantly overlapping (Fig 2BV-VIII and 2EIII-IV). Hence, PAX-FOXO1-dependent genetic signatures established in the cell of origin would be preserved despite the accumulation of genetic aberrations during cell transformation [5,6] and could provide specific tumorigenic features [3]. Consistent with this idea, the function of genes differentially expressed between PAX3-FOXO1- and PAX7-FOXO1-expressing HFF was reminiscent of those differentially expressed between (t2;t13)- and (t1;t13)-carrying RMS cells (S5D and S5E Fig and S5 Table).

PAX7-FOXO1 induces greater alterations of cell architecture and cell cycle than PAX3-FOXO1

The enrichment for genes encoding cell cycle and cell shape regulators in the specific signatures of PAX-FOXO1s (S5 and S6 Figs), led us to analyse their functional impact on these two cellular parameters. First, transcriptional analyses revealed that control fibroblasts and those expressing PAX3-FOXO1 and PAX7-FOXO1 differentially expressed specific members of the integrin, cadherin, semaphorin, small GTPase, guanine nucleotide exchange factor (GEF), GTPase activating protein (GAP), or actin binding and processing protein families (S6A Fig and S3 Table). Hence, they likely possess their mechanism for regulating acto-myosin network dynamics and cell adhesions (S6A Fig). Accordingly, cell morphology in these samples was distinct. This was revealed by monitoring the functional architecture of the cytoskeleton using phalloidin-labeled F-actin and focal adhesions immunostained with anti-Paxillin (Figs 3A and S7I-V). While control and PAX3-FOXO1-expressing cells predominantly exhibited a spindle or triangular shape, more than 35% of PAX7-FOXO1 cells became rounded (Figs 3AI-IX and S7IV). Stress fibres terminated by focal adhesions were barely visible in PAX7-FOXO1 cells (Figs 3AIV and S7IV-V); instead, these cells displayed filopodia-like F-actin microspikes (arrowheads in Fig 3AIV’). In contrast, in cells expressing PAX3-FOXO1, stress fibers were greater in number and thicker than in control cells (Figs 3AIII’ and S7II-III). This indicates that each PAX-FOXO1 paralog differentially alters actin network dynamics, with PAX3-FOXO1 favouring contractile actomyosin bundles. Further demonstrating the PAX-FOXO1 paralog specific cell shape dynamics were variations in the nucleus shape, one of the key organelles of cell proprioception [31] (Fig 3AV-VIII and X-XI). Expression of both PAX-FOXO1 chimeric proteins is associated with the enlargement of HFF nuclei (Fig 3A-X). Yet, consistent with the loss of actin-based tension in PAX7-FOXO1 cells, their nuclei lost their roundness and adopted a bean or multilobed shape (Fig 3A–3C and 3XI). Overall, these results indicate that PAX3-FOXO1 enhances cellular features related to cell contractility and surface adhesions already present in HFF. In contrast, PAX7-FOXO1 orients cells towards a distinctive amoeboid-like morphological state. With such clear differences in the morphological characteristics of HFF expressing PAX3-FOXO1 and PAX7-FOXO1, it is tempting to hypothesise that the two factors may confer on the cells distinct capabilities in terms of tissue invasions [32].
Fig 3

PAX3-FOXO1 & PAX7-FOXO1 activities differentially impact the shape of cells and their cycling behaviour.

(a)(i-viii) Immunodetection of Paxillin and GFP, phalloidin based F-actin labelling and DAPI staining on the indicated HFF cell lines treated for 48h with DOX. (ix-xi) Proportion of cells harbouring the indicated cell morphology (ix), quantification of nuclei perimeter (x) and solidity (xi) in the indicated cell lines treated with DOX for 48h (bars: mean ± s.d.; dots: mean value in independent cell lines; Mann-Whitney U test p-value: *: p< 0.05, **: p< 0.01, ***: p< 0.001, ns: p> 0.05). (b)(i-iii) FACS plots displaying EdU levels and DNA content (DAPI levels) in control cells and in the GFP+ population of a PAX3-FOXO1 and PAX7-FOXO1 cell line treated for 48h with DOX. (iv) Percentage of cells in the indicated cell cycle phase established from plots in i (mean over three experiments and three independent lines). (c-e)(i-iii’) Immunodetection of pRB1, Ki-67, γH2AX, 53BP1 and GFP and DAPI staining on the indicated HFF cell lines treated for 48h with DOX. (c-e)(iv) Levels of expression of pRB1, Ki-67 and γH2AX in control, GFP+ PAX3-FOXO1 and GFP+ PAX7-FOXO1 cells treated for 48h with DOX (dots: cell values, bars: mean ± s.e.m., two-way-ANOVA p-values evaluating the similarities between PAX3-FOXO1 and PAX7-FOX1 cells lines: ****: p<0.0001).

PAX3-FOXO1 & PAX7-FOXO1 activities differentially impact the shape of cells and their cycling behaviour.

(a)(i-viii) Immunodetection of Paxillin and GFP, phalloidin based F-actin labelling and DAPI staining on the indicated HFF cell lines treated for 48h with DOX. (ix-xi) Proportion of cells harbouring the indicated cell morphology (ix), quantification of nuclei perimeter (x) and solidity (xi) in the indicated cell lines treated with DOX for 48h (bars: mean ± s.d.; dots: mean value in independent cell lines; Mann-Whitney U test p-value: *: p< 0.05, **: p< 0.01, ***: p< 0.001, ns: p> 0.05). (b)(i-iii) FACS plots displaying EdU levels and DNA content (DAPI levels) in control cells and in the GFP+ population of a PAX3-FOXO1 and PAX7-FOXO1 cell line treated for 48h with DOX. (iv) Percentage of cells in the indicated cell cycle phase established from plots in i (mean over three experiments and three independent lines). (c-e)(i-iii’) Immunodetection of pRB1, Ki-67, γH2AX, 53BP1 and GFP and DAPI staining on the indicated HFF cell lines treated for 48h with DOX. (c-e)(iv) Levels of expression of pRB1, Ki-67 and γH2AX in control, GFP+ PAX3-FOXO1 and GFP+ PAX7-FOXO1 cells treated for 48h with DOX (dots: cell values, bars: mean ± s.e.m., two-way-ANOVA p-values evaluating the similarities between PAX3-FOXO1 and PAX7-FOX1 cells lines: ****: p<0.0001). To assess the impact of PAX-FOXO1s on the cell cycle, we labelled replicating cells with a 1h30 pulse of thymidine analogue EdU prior to harvest. We then used flow cytometry to quantify DNA content and replication using DAPI and EdU levels (Fig 3B). Both PAX-FOXO1s altered the distribution of cells across cell cycle phases (Fig 3B). The number of cells in the replication (S) phase was reduced in the presence of both chimeras, but this reduction was much greater in the presence of PAX3-FOXO1 than PAX7-FOXO1 (Fig 3B). Consistently, CYCLIN-CDK-dependent phosphorylation levels of Rb1 and the cell proliferation marker Ki-67 (MKI67) were further reduced in PAX3-FOXO1 cells compared to PAX7-FOXO1 cells (Figs 3C, 3D and S7VI-XV). This is also in agreement with the decreased expression of core cell cycle genes and the upregulation of cell cycle inhibitors by both PAX-FOXO1s (S6B Fig). Interestingly, whereas the G1 cell population was dominant in PAX3-FOXO1-expressing HFF, PAX7-FOXO1 expression was associated with an increased percentage of cells in G2 (Fig 3BII-IV). This observation was reinforced by the enrichment of PAX7-FOXO1 molecular signature for genes encoding regulators of the G2 to M transition, whereas PAX3-FOXO1 specifically induced inhibitors of the G1 to S transition (S6B Fig and S3 Table). PAX3-FOXO1 expression levels and transcriptional potential in several PAX3-FOXO1 positive RMS models have been shown to be potentiated during the G2 phase [33]. We thus verified that the pausing in G1 of PAX3-FOXO1+ cells and in G2 of PAX7-FOXO1+ does not alter either the expression of PAX-FOXO1 under the control of the DOX promoter or the PAX-FOXO1-specific response of the target genes (S8 Fig). Finally, we tested whether PAX-FOXO1s-mediated cell cycle dysregulation could be correlated with DNA damage. Indeed, such lesions are likely to block cell cycle progression [34]. Immuno-labelling of 53BP1+ and γH2AX+ DNA double-strand break foci showed that PAX7-FOXO1 was more prone to cause genomic instabilities than PAX3-FOXO1 (Figs 3E and S7XVI-XX). The distinct effects of the different PAX-FOXO1 fusion proteins on cell cycle and DNA damage raise the question of the mechanisms by which the two PAX-FOXO1s bypass their cell cycle block. In the case of PAX3-FOXO1, the appearance of genetic aberrations increasing the expression of MYCN and CDK4 [6], two regulators of the G1 to S transition, presents an efficient and necessary means for the generation of tumour growths [12-15]. In addition, the respective PAX-FOXO1 activity could also promote cell cycle continuation [33]. Indeed, in a mouse model of RMS, PAX3-FOXO1 activity has been shown to facilitate checkpoint adaptation and is, for example, required for the entry into mitosis of DNA-damaged cells. The effect of PAX7-FOXO1 expression on the cell cycle remains unexplored. Nevertheless, the more pronounced impact of PAX7-FOXO1 on the transcriptional landscape of cells and their morphology, but also on features such as DNA breaks that are known to ultimately lead to cell death [35], leads us to propose that in the presence of PAX7-FOXO1, cells will be faced with greater obstacles to tumour formation than in the presence of PAX3-FOXO1. Although this hypothesis remains to be tested, it offers a plausible explanation for the lower occurrence of PAX7-FOXO1 tumours compared to PAX3-FOXO1 tumours. The extinction of PAX7-FOXO1 expression, despite amplifications of the genomic region carrying the fusion, supports the idea that cells are less tolerant to PAX7-FOXO1 than to PAX3-FOXO1 [29]. Overall, our study indicates that within 48 hours the paralogous oncogenic fusion factors PAX7-FOXO1 and PAX3-FOXO1 each impose specific molecular and cellular characteristics on fibroblasts. Among the underlying mechanisms, recruitment to distinct genome sites and divergence in their ability to transactivate these sites may be of particular importance. Finally, the presence of certain molecular characteristics associated with a given PAX-FOXO1 in both fibroblasts and tumours suggests that their specific mode of action remains preserved in different contexts of the cells and/or the tumorigenesis process. Yet, the variations in the response of several embryonic cell lineages to PAX3-FOXO1 [14] and the large spectrum of cells that could participate to the emergence of the rhabdomyosarcoma, including connective tissue cells and myoblasts [12,36] urge to understand how cell context could modulate in the modes of action of the two fusion proteins. It will be also important to assess in the future how the activity of these paralogous factors, but also of other fusions between the DNA-binding domains of PAX and transcriptional regulators other than FOXO1, such as NCOA1 [37], modulates the response of cells in models recapitulating the physiology of tissue interactions, in order to determine whether their differential transcriptional activity is able to generate diversity in tumour manifestation.

Material and methods

Plasmid constructs

2xFLAG-PAX3-FOXO1-IRES-NLS-GFP and 2xFLAG-PAX7-FOXO1-IRES-NLS-GFP cassettes were PCR amplified from previously described constructs [15,38] using the primers P1,P2 (see below), respectively and cloned in pAAVS1-PDi-CRISPRn plasmid [39] between PacI and NotI restriction sites using Gibson assembly technology. pAAVS1-PDi-CRISPRn was a gift from B. Conklin (http://n2t.net/addgene:73500; RRID:Addgene_73500). In these constructs, PAX3-FOXO1 sequences encode for the Q+PAX3-FOXO1 isoform and PAX7-FOXO1 sequences encode for the Q+GL+ PAX7-FOXO1 isoform [28]. All constructs were verified by DNA sequencing (MWG, Eurofins). P1: CTACCCTCGTAAACTTAAGGTTAATGTCTCATCATTTTGGCAAAGAATTG P2: CAAGTTGGGGTGGGCGATCGATTGCGTCGACGGTGCAGGT

Cell lines description and maintenance

Control and engineered Human Foreskin Fibroblasts (HFF) [40] were grown as described [41]. Doxycycline (DOX) was used at a concentration of 1μg/ml.

Generation of stable cell lines

To create DOX-inducible PAX-FOXO1 HFF lines, 2-3x105 plated cells at a passage 7 were transfected with pAAVS1-PDi-CRISPRn containing a 2xFLAG-PAX-FOXO1-IRES-NLS-GFP cassette and the sgRNAs gRNA_AAVS1-T1 (http://n2t.net/addgene:41817; RRID:Addgene_41817) and gRNA_AAVS1-T2 (http://n2t.net/addgene:41818; RRID:Addgene_41818) (Gifts from G. Church [42]) using Lipofectamine 2000 (Life technologies, Carlsbad, CA, USA) and the manufacturer’s recommendations. 24h later, puromycin (2μg/ml) was added to the medium. After 2 days, cells were split. 10 days later, resistant cells were treated with 1μg/ml of DOX during 48h and then GFP+ cells were sorted with FACSAria Fusion (BD-Biosciences). The sorted cells were then grown and amplified without DOX. Three independent PAX3-FOXO1 and three PAX7-FOXO1 lines were obtained, referred to here as P3F-1 to 3 and P7F-1 to 3.

CUT&Tag, sequencing and analyses

CUT&Tag was performed as in Kaya-Okur et al. [9], following the procedure described in “Bench top CUT&Tag V.2” available on protocols.io. We used 100 000 cells per sample and the anti-FLAG (Merck F3165), anti-FOXO1 (Cell Signaling #2880), anti-H3K27ac (Diagenode C15410196), anti-H3K27me3 (Diagenode C15410195) and H3K9me3 (Diagenode C15410193) primary antibodies and anti-rabbit IgG (ABIN6923140) or anti-mouse IgG (ABIN6923141) secondary antibodies. For FLAG, FOXO1 and H3K27ac libraries, we used pA-TN5 from Tebu-Bio (Epicypher #15–1017). For H3K27me3 and H3K9me3 libraries, we used a homemade purified pA-TN5 protein following a previously published protocol [10]. Libraries were analysed using 4200 TapeStation system (Agilent) and sequenced 150pb (paired-end) with HiSeq X-ten (BGI). The quality of paired-end read sequences was assessed using FastQC (v0.11.9). Low quality nucleotides and Illumina adapter sequences were removed using Trimmomatic (v0.39) [11] and PCR duplicate reads were removed using BBmap clumpify (v38.87) [12]. Filtered reads were aligned to the hg19 reference genome using Bowtie2 (v2.4.1) [13, 14] as described previously [15]. Genome-wide coverage tracks (bigwigs) were generated using deeptools (v3.3.0) [43] and normalised by library size (Counts Per Million, CPM) with default parameters. Peaks were called using SEACR (v1.3) [16] with parameters:—relaxed—threshold 0.000001 and manually curated. Reads coverage on defined CRMs was calculated using VisRseq (v0.9.2) [44] and normalised by library size. The top 6000 PAX-FOXO1s bound peaks identified with anti-FLAG and/or anti-FOXO1 were kept. Differential analysis on these 6000 peaks was performed using Deseq2 (v1.30.1): 3091 were bound by both PAX-FOXO1s (cluster 1), 1429 were statistically enriched (p-adj<0,01) for more PAX3-FOXO1 (cluster 2) and 1475 were statistically enriched for more PAX7-FOXO1 (cluster 3). Histone marks signal peaks common to all cell lines analysed (cf. S3 Fig) were identified using bedtools multiple intersect on the Galaxy web platform. Heatmaps and average plots were generated using deeptools (v3.3.0) [17] computeMatrix followed by plotHeatmap or plotProfile. PCA plots were generated with deeptools MultiBamSummary and visualized with plotPCA with the—transpose parameter enabled. The nearest gene to each peak was determined using bedtools closest (v2.27.0). Heatmaps of relative expression levels were generated using Morpheus (https://software.broadinstitute.org/morpheus/). Correlograms were generated with the Morpheus Similarity Matrix tool using Spearman rank correlations of RPKM values calculated over 10kb genomic bins with VisRseq [44].

Motifs analyses

Position weight matrices (PWMs) for PAX-FOXO1s binding sites were taken from JASPAR database [45] or created de novo from Pax3, Pax7 or PAX3-FOXO1 ChIP-Sequencing data [16,26] using RSAT [46,47]. Pax3, Pax7 and PAX3-FOXO1 peaks location data were retrieved for the top 500 ChIPseq peaks and 100bp sequences either side of their centre were fetched using Galaxy (usegalaxy.org). In total, 21 PWM were identified and used to calculate the relative enrichment of each of PAX as well as E-BOX and FOXO1 related DNA motifs in CUT&Tag data using AME [48] from MEME-suite (S2 Table). The logos of the 5 most recurring motifs were generated from PWM using https://ccg.epfl.ch/pwmtools/pwmscan.php (Figs 1C and S2C). Results for these motifs are shown in the left panels of Fig 1D and in S2CII Fig.

RNA extraction, sequencing and analyses

RNAs were extracted using the NucleoSpin RNA kit (Macherey-Nagel) following manufacturer’s instructions, elution was done with RNase-free water and concentrations were measured with DeNovixDS-11-FX series. RNAs were sent to Fasteris (Switzerland) where libraries were prepared and their quality checked using a Bioanalyzer Pico chip. 0.2–0.5μg was then either sequenced on Paired-end reads 100 base runs, on an Illumina Novaseq instrument (Stable HFF cell lines) or on paired-end reads 75 base runs on a HiSeq instrument (Transient transfection in HFF). After demultiplexing, reads were trimmed and mapped on the hg19 (Stable HFF cell lines) or hg38 (Transient transfection in HFF) human genome (GSE180919).

Transcriptomic analyses

Pairwise differential analysis of RNAseq data was performed using Cufflinks (Fasteris). Genes with a q-value <0.05 after Benjamini-Hochberg correction for multiple-testing were considered to be significant. Hierarchical clustering was performed with one minus Pearson correlation using Morpheus. MDS was performed using the Cummerbund package. The normalized FP-RMS biopsies transcriptomes evaluated using microarrays have been previously described [15]. Genes differentially expressed between the 99 PAX3-FOXO1 and 34 PAX7-FOXO1-positive RMS were evaluated using paired t-test and the cut-off was set for a p-value <0.05. Biological pathways GO terms enrichment analyses were performed with EnrichR (http://amp.pharm.mssm.edu/Enrichr/). Homemade enrichment analyses between data sets were performed using hypergeometric tests (phyper function on R). A homemade lists of genes coding for regulators of cell morphology, cell adhesion and motility and of cell cycle linked genes were generated based on literature reviewing and were used to picture the effects of the PAX-FOXO1s onto these biological processes (S6 Table and S6 Fig).

Immunohistochemistry

Cells were plated in 24-well culture plates containing coverslips and allowed to adhere at 37°C O/N with DOX. After 48h, cells were fixed with 4% paraformaldehyde (PFA) for 8 minutes and processed for immunostaining [49]. The following antibodies diluted in PBS, 1% BSA, 0.1% triton were used. Primary antibodies: rabbit anti-53BP1 (Novus, NB100-304SS; 1/1000), chicken anti-GFP (Abcam, ab13970; 1/1000), rabbit anti-FOXO1 (Cell signaling, #2880; 1/1000), mouse anti-γH2AX (Millipore, 05–636; 1/200), rabbit anti-Ki-67 (Abcam, ab15580; 1/1000), mouse anti-PAX3/7-HD (clone DP312 Nipam Patel’s lab; 1/100), mouse anti-Paxillin (Santa-Cruz, sc390738; 1/100), rabbit anti-phosphorylated RB1 (pRB1)(R&D systems, MAB6495, 1/500). Secondary antibodies: donkey against mouse and rabbit IgG or chicken IgY coupled to Alexa Fluorophores A488, A568 or A647 (Thermo Fisher Scientific) were diluted 1:500 and used with DAPI (500ng/ml, Sigma, 28718-90-3) or Hoechst (1/10000, Thermo Fisher Scientific, H3570). F-actin was marked by adding to the secondary mix Rhodamine Phalloidin (Cytoskeleton, PHDR1; 1/500). Immunofluorescence microscopy was carried out using a Leica TCS SP5 confocal microscope, a Leica DMR Upright or Zeiss LSM980 spectral Airyscan 2. All the images were processed with Image J v.1.43g image analysis software (NIH) and Photoshop 13.0 software (Adobe Systems, San Jose, CA, USA). All quantifications were performed using CellProfiler v3.1.5 (http://www.cellprofiler.org/). Statistical analyses and graphical representation were performed using a Mann-Whitney U or t-tests or two-way ANOVA test in GraphPad Prism and p-values are given in figure legends.

Western blots

Cells were lysed in a buffer composed of 10mM Tris-Cl pH7.5, 5mM EDTA, 150mM NaCl, 30mM Sodium pyrophosphate, 50mM Sodium fluoride, 10% glycerol, 1% NP40 and Complete Protease Inhibitor Cocktail (Sigma-Aldrich). 10μg of cellular extracts were separated on 10% SDS-PAGE under reducing conditions and transferred onto polyvinylidene difluoride membranes with iBlotTM2 Gel Transfer Device (Thermo Fisher Scientific). After protein transfer, the membranes were blocked for 1 hour in TBST buffer containing 10% milk followed by incubation with primary antibodies (rabbit anti-FOXO1, #2880, Cell Signaling; 1/1000; rabbit anti-βACTIN, #4967, Cell Signaling; 1/1000) overnight at 4°C. After washes, membranes were incubated for 2 hours with secondary antibody (Goat anti-Rabbit Secondary, Alexa Fluor 700, Invitrogen; 1/10000). Fluorescent bands were visualized on LI-COR Odyssey and their intensity quantified and normalized using Image J v.1.53i image analysis software (NIH). Statistical analyses and graphical representation were performed using two-way ANOVA test in GraphPad Prism and all the p-values are given in figure legends.

Cell cycle analyses

10μM EdU were added to cells 48h post-DOX induction. After 1h30, they were harvested and washed twice with PBS. Cells were incubated for 30 min with chicken anti-GFP (Abcam, ab13970; 1/2000) and then 30 min with Alexa Fluorophores A488 coupled secondary antibodies (Thermo Fisher Scientific; 1/2000). After three PBS washes, click-it reactions were performed using the Click-iT Plus EdU Alexa Fluor 647 Flow Cytometry Kit (Thermo Fischer Scientific) according to the manufacturer’s recommendations. Cells were counterstained with DAPI for 30 min. Sample measurements were done on a BD FACSAria Fusion flow cytometer (BD Biosciences) and with FACSDiva Software (v8.0.1, BD Biosciences). Alexa Fluor 488 signal was measured by 488nm laser excitation with a 530/30 bandpass filter, Alexa Fluor 647 by 633nm laser with a 670/30 nm bandpass filter and DAPI by 405nm laser with a 450/40 nm bandpass filter. Data analysis was performed with FlowJo v10.7.1 Software (BD Biosciences). Cells were identified on a Side Scatter (SSC) vs Forward Scatter (FSC) dot plot and cell debris and aggregates were excluded from analysis based on FSC signals. Cell cycle was studied on three independent cell lines, in three independent experiments.

RT-quantitative real-time-PCR on FAC sorted G1 and G2 cells

Three sets of control HFF and the three independent PAX3-FOXO1 (P3F-1 to 3) and PAX7-FOXO1 (P7F-1 to 3) cells were treated with DOX for 48h and with Hoechst 33342 (Thermo Fisher Scientific; concentration used: 5μg/ml) for 15 minutes before harvest. GFP+ and GFP- cells, as well as cells in G1 and G2 phases were sorted using BD Influx Sorter (BD Biosciences; see S8A Fig for typical gating plots). Total RNA was extracted from 50 000 cells following RNAqueous Total RNA isolation kit (Life technologies) instructions. cDNA was synthesized from 150ng of RNA using SuperScript IV (Life Technologies) according to manufacturer’s instructions. Real time quantitative PCR were performed with the Prime Pro 48 real time qPCR system (Techne) using Absolute SYBR Capillary Mix (Thermo Fisher Scientific) and the primers below. The expression of each gene was normalised to that of TBP. Data representation and statistical analyses using t-test were performed in GraphPad Prism. P03: LMO4-Fw: GGCACGTCCTGTTACACCAA P04: LMO4-Rev: CGCCCTCATGACGAGTTCAC P05: NGFR-Fw: GCCTGTACACACACAGCGG P06: NGFR-Rev: ACCACGTCGGAGAACGTCAC P07: PAX3-FOXO1-Fw: TCCAACCCCATGAACCCC P08: PAX3/7-FOXO1-Rev: GCCATTTGGAAAACTGTGATCC P09: PAX7-FOXO1-Fw: CAACCACATGAACCCGGTC P10: PIPOX-Fw: ACCCGGATGATGCATGAGTG P11: PIPOX-Rev: ACCCTCTGCCTCGACAGATT P12: SERPINI1-Fw: AAAATGTAGCCGTGGCCAACTA P13: SERPINI1-Rev: GGCAGCATCAAAATCCCTTGG P14: SKP2-Fw: TTTGCCCTGCAGACTTTGCTA P15: SKP2-Rev: TCTCTGACACATGCGCAACA P16: TBP-Fw: CACGAACCACGGCACTGATT P17: TBP-Rev: TTTTCTTGCTGCCAGTCTGGAC P18: TFAP2α-Fw: GAGGTCCCGCATGTAGAA P19: TFAP2α-Rev: CCGAAGAGGTTGTCCTTGT (a) Schematics showing the homogenous and diverging structural protein domains of PAX3-FOXO1 and PAX7-FOXO1. The two proteins share 77% of their amino-acid sequence. The position of the domains displaying divergence in their amino-acid sequence are highlighted by colour coded stars; green stars: <5% of divergence; orange stars: <20% of divergence; red stars: >20% of divergence. HD: homeodomain; OP: octapeptide; PrD: Paired DNA binding domain. (b-e) Levels of expression of PAX3-FOXO1 and PAX7-FOXO1 in DOX inducible HFF lines. (b) Stable HFF lines were generated by introducing a DOX-inducible 2xFLAG-PAX3-FOXO1 or 2xFLAG-PAX7-FOXO1 cassette between exons 1 and 2 of the PPP1R12C gene at the AAVS1 locus. (c)(i) Western blots using FOXO1 and βACTIN antibodies on protein extracts from three independent HFF cell lines (1 to 3) expressing either PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F), untreated (Ø) and treated with DOX for 48h (DOX). Arrows indicate PAX-FOXO1 band, black arrowheads point at FOXO1 band and the blue one at βACTIN. (ii) Relative PAX-FOXO1 levels to that of βACTIN quantified from western blots in (i). (d) DAPI staining and immuno-staining using antibodies recognizing GFP, PAX homeodomain (HD) and FOXO1 C-terminal domain on the indicated HFF cell lines treated for 48h with DOX (bottom panels) or without (top panels). Only upon DOX treatment a specific nuclear signal is revealed by the three antibodies in the 3 independent lines expressing PAX3-FOXO1 or PAX7-FOXO1 (#1 to 3). Scale bar: 10μm. (e) Quantification of the levels of PAX-HD signal in GFP+ cells showing an equivalent dispersion of signal levels in PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) expressing cell lines (dots: value for a cell in arbitrary units (AU); bars: mean ± s.d.; ns: ANOVA p-value higher than 0.05). (TIF) Click here for additional data file.

Reproducibility and validation of PAX3-FOXO1 and PAX7-FOXO1 genome occupancy assessment using CUT&Tag.

(a) Heatmaps of normalized CUT&Tag signals obtained using either an anti-FLAG or an anti-FOXO1 in control (Ctl) or 3 independent PAX3-FOXO1 (P3F-1 to 3) and PAX7-FOXO1 (P7F-1 to 3) expressing HFF 48h post-DOX treatment in clusters of cis-regulatory modules (CRMs) defined in Fig 1B. Peaks were arranged vertically following the order of signals obtained in P3F-1 sample (cf. arrow). (b) Distribution of the selected 6000 PAX-FOXOs bound CRMs in functional genomic regions (expressed as percentage). TSS: Transcriptional Start Site. (c) i. Logos of position weight matrix of DNA recognition motifs for FOXO1. ii. Enrichment for FOXO1 DNA recognition motif displayed in i in the CRMs belonging to the clusters defined in Fig 1B (bars: -log2(p-value)). (d) Venn diagrams showing the overlap between the 6000 PAX-FOXO1 bound CRMs identified in HFF and all possible PAX3-FOXO1 bound CRMs that have been identified in Rh4, Rh3, SCMC [1] (i) and the overlap between the 6000 PAX-FOXO1 bound CRMs identified in HFF and the list of high confidence PAX3-FOXO1 bound CRMs defined by [1] (ii). (e) IGV tracks showing normalized FLAG and H3K27ac CUT&Tag reads distribution in HFF expressing either PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) 48h post-DOX treatment at four previously identified PAX3-FOXO1 target loci in Rh4 RMS cells [1]. Scales in counts per million (CPM). The peaks of reads overlap greatly with genomic regions identified by ChIPSeq as bound by PAX3-FOXO1 in Rh4, highlighted in blue [1]. (TIF) Click here for additional data file.

Chromatin status of PAX3-FOXO1 and PAX7-FOXO1 bound regions.

(a) IGV tracks showing normalized FLAG, H3K27ac, H3K27me3 and H3K9me3 CUT&Tag reads distribution in HFF expressing either PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) 48h post-DOX treatment. Scales in counts per million (CPM). They demonstrated the efficiency of the CUT&Tag approach to reveal heterochromatic regions. They also showed at the TNNT2 and KCNN3 loci a poor overlap between PAX-FOXO1 recruitment sites and peak signals for the deposition of the H3K27me3 and H3K9me3 marks. Conversely, they indicated that signals for PAX-FOXO1 binding and H3K27ac deposition coincide. (b) Correlogram displaying the spearman correlations between the genome-wide distributions of FLAG, H3K27ac, H3K27me3 and H3K9me3 CUT&Tag reads in control HFF (Ctl), P3F and P7F cells 48h post-DOX treatment. The correlation between PAX-FOXO1 binding and the H3K27ac deposition signals (blue rectangles) was stronger than that between PAX-FOXO1 binding signals and H3K9me3 or H3K27me3 deposition signals (black rectangles). (c) Average profiles (top panels) and heatmaps (bottom panels) of normalized CUT&Tag signals for the deposition of the indicated histone mark at the 6000 PAX-FOXO1s-bound CRMs defined in Fig 1B (PF+ CRMs) and signal peaks for the indicated histone mark common to all cell lines analysed (common peaks). CUT&Tags were performed in Ctl HFF or expressing P3F and P7F 48h after DOX treatment. The ranking of the CRMs in the heatmaps follows the signal distribution in the P3F sample (cf arrow). Levels of deposition of all three histone marks in common CRMs were comparable between cell lines testifying the robustness in the normalization of CUT&Tag signals. The data presented in both panels also demonstrated that PAX-FOXO1 bound regions were mainly unmarked by the histone modifications, H3K27ac, H3K27me3 and H3K9me3, in control HFF. These regions remained poorly enriched for the deposition of the two heterochromatic histone marks upon PAX-FOXO1s expression. In contrast, a significant number of these regions displayed enhanced H3K27ac deposition signal in presence of PAX-FOXO1. In PAX3-FOXO1 samples less CRMs were mediated H3K27ac deposition than in PAX7-FOXO1 samples. (d) Average profiles (top panels) and heatmaps (bottom panels) of normalized H3K9me3 CUT&Tag signals at the 3 CRMs clusters defined in Fig 1B. These were obtained in Ctl HFF or expressing P3F and P7F 48h after DOX treatment. The ranking of the CRMs in the heatmaps, marked with a white arrow, follows the signals distribution in the P3-F sample. (e) Scattered plots showing the levels of P3F or P7F signals (Log10(FLAG CUT&Tag signal)) as the function of the levels of deposition of the indicated histone mark (Log10(CUT&Tag signal for the mark) at the 6000 single CRMs that can be bound by PAX-FOXO1 in HFF. None of the signals were correlated, but the binding signal for PAX7-FOXO1 with the H3K27ac deposition signals. (f) Principal component analysis (PCA) projection of the chromatin state assessed using H3K27ac enrichment onto the 6000 PAX-FOXO1 bound CRMs of the indicated cell lines 48h post-DOX treatment. (TIF) Click here for additional data file.

Comparative analysis of the transcriptome of cells expressing Pax3, Pax7, PAX3-FOXO1 or PAX7-FOXO1.

(a) Data obtained on stable HFF lines described in Hierarchical clustering based on Jensen-Shannon divergence of RNAseq based transcriptomes of cells described in (Fig 2A) and treated with DOX for 48h. Main segregation nodes have been numbered. The top segregation node separated all PAX-FOXO1 expressing cells from control cells, supporting a primary common mode of action of the two fusion factors. The secondary node clustered all PAX7-FOXO1 (P7F) samples apart from PAX3-FOXO1 (P3F) samples, arguing thus for each PAX-FOXO1 subtype imposing specific transcriptomic traits to cells. (aii) Correlogram displaying the Jensen-Shannon distances between the transcriptomes of control HFF (Ctl), P3F and P7F cells 48h post-DOX treatment. This shows that the transcriptome of P7F cells is more distant from that of Ctl cells than that of P3F cells. (aiii) Heatmap of 4 K-means clusters of genes showing significant variations in their expression between control, PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) expressing cells. Fold changes across samples are colour-coded in blue (minimum levels) to red (maximum levels). (aiv) IGV tracks showing normalized FLAG, H3K27ac, H3K27me3 and H3K9me3 CUT&Tag reads distribution in HFF expressing either PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) 48h post-DOX treatment. Scales in counts per million (CPM). The loci chosen were nearby genes encoding for either cell cycle (left column) or cell shape and motility (right column) regulators and that belong to the gene clusters defined in ii. The bar graphs display the levels of expression assayed by RNAseq for the gene present at these loci in Ctl, P3F and P7F samples. (av) Standardized and normalized expression levels of genes assayed by RNAseq and in the vicinity of CRMs bound by P3F and/or P7F and belonging to the three clusters of CRMs defined in Fig 1B (dots: expression of a given gene; bars: mean±s.e.m.; ANOVA p-value: ****: <0.0001). This indicates that genes nearby CRMs that are bound by P3F and P7F were induced by both PAX-FOXO1s, yet displayed higher expression levels in presence of P7F than in presence of P3F (left graph). Genes nearby CRMs preferentially bound by P3F were more induced by P3F than P7F (middle graph). Similarly, those nearby CRMs preferentially bound by P7F displayed much higher expression levels in presence of P7F than P3F (right graph). (b) Data obtained on HFF 72 hours post-transfection with plasmids expressing either Pax3 (P3), Pax7 (P7), PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) or the empty pCIG plasmid (Ctl) and the GFP bicistronically. (bi) DAPI staining and immuno-staining using antibodies recognizing GFP, PAX homeodomain (HD) and FOXO1 C-terminal domain (recognizing both PAX-FOXO1 and FOXO1 proteins) on the indicated transfected HFF. Scale bar: 10μm. (bii) Quantification of the levels of PAX-HD signal (top graph) or of FOXO1 (bottom graph) in GFP- cells (first bar) and GFP+ cells (the remaining bars) (dots: value for a cell in arbitrary units (AU); bars: mean ± s.d.; ns: t-test p-value higher than 0.05; t-test p-value: **<0.005; ****: <0.0001). The levels expression of all four TFs vary between cells as in stable lines; this dispersion is comparable between the PAX3-FOXO1, Pax7, and PAX7-FOXO1 samples, in Pax3 samples more cells display weaker levels of PAX-HD. (biii) Multidimensional scaling 2D visual projection of the transcriptomic state of three or six independent HFF batches. The transcriptome of P7 cells were the most diverging from that of control. P7F cells were further away from control cells than P3F cells and P3 cells were positioned between control and P3F cells. (TIF) Click here for additional data file.

Functional annotations of genes differentially expressed between PAX3-FOXO1 and PAX7-FOXO1 in patient biopsies and HFF.

(a) GSEA plots showing the enrichment for genes associated to RMS [2] in differentially expressed genes between control (Ctl) HFF and HFF expressing either PAX-FOXO1s (PF) or PAX3-FOXO1 (P3F) or PAX7-FOXO1 (P7F) or between P3F and P7F samples. NES: normalized enrichment score; FDR: false discovery rate. (b, c) Gene ontology enrichment for biological processes applied to genes enriched in PAX3-FOXO1 RMS biopsies compared to PAX7-FOXO1 FP-RMS biopsies (a) and conversely to genes associated to PAX7-FOXO1 RMS biopsies (b). (d, e) Gene ontology enrichment for biological processes applied to genes enriched in PAX3-FOXO1 expressing HFF compared to PAX7-FOXO1 expressing HFF (c) and conversely to genes associated to PAX7-FOXO1 HFF (d). Related biological processes are highlighted in colour. Bars: -log2(adjusted p-value). (TIF) Click here for additional data file.

Transcriptional dynamics of genes coding for cell-architecture and cell cycle regulators in HFF upon PAX3-FOXO1 and PAX7-FOXO1 exposure.

Heatmaps of K-means clustered genes differentially expressed between control HFF, PAX3-FOXO1 and PAX7-FOXO1 stable lines 48h post-DOX treatments. In (a) are clustered genes selected based on the function of the protein they encoded in regulating cell morphology, cell-cell, cell-matrix adhesions, cell motility, while in (b) are grouped genes coding from known cell cycle regulators. In presence of either PAX-FOXO1s, core cell cycle genes, such as checkpoints (CHEK1/2) and Aurora A (AURKA) kinases, the cyclins (CCNA2, B1 and B2) and their dependent kinases (CDK1/2) or the cell-cycle TF MYC are downregulated. Conversely, anti-proliferating genes, including BTG1, CDKL5, CCNG2 or SIRT6 [3-6] are up regulated by both PAX-FOXO1s. PAX7-FOXO1 signature harboured actors of the G2 to M and M to G1 transitions, including members of the anaphase promoting complex (ANAPC2, CDC27) and of the chromosomal passenger complex (AURKC), and modulators of these transitions (CDC14A, SKP2) [7-9]. Conversely, genes more induced by PAX3-FOXO1 were enriched for negative regulators of the G1 to S transition, such as the cyclin inhibitor CDKN1A (p21Cip1) or JUNB [10,11]. Fold changes across P3F and P7F expressing and control HFF are colour coded in blue (lower level) and in red (higher level). Names of genes have been coloured coded as a function of gene families. (TIF) Click here for additional data file.

PAX-FOXO1 subtype specific cell morphology and cycle phenotypes are penetrant across independent cell lines.

Immunodetection against the indicated proteins, phalloidin staining of F-actin filaments and DAPI labelling in control or two independent PAX3-FOXO1 (P3F-1, 2) and PAX7-FOXO1 (P7F-1, 2) cell lines 48h post-DOX treatment. Arrowheads indicate GFP positive cells showing abnormally low levels of pRB1 or Ki-67 and arrows point at GFP positive cells in which these two proteins can still be detected. All the cells in panel xvii to xx are GFP positive (not shown). Scale bars: 15μm. (TIF) Click here for additional data file.

The transactivation potential differential between PAX3-FOXO1 and PAX7-FOXO1 occurs regardless of cell cycle phase.

(a) Schematics showing that cells were treated for 48h with DOX and for 15 minutes with Hoechst before preparation for FACS sorts (i). Typical FACS plots illustrating the segregation of GFP+ (PAX-FOXO1+) from GFP- cells (ii; y axis: GFP signal levels; x axis: Hoechst signal intensity) and the selection windows of cells in the G1 (blue) and G2 (pink) phases (iii; y axis: cell count; x axis: Hoechst signal intensity). (b,d) Levels of expression of indicated genes in G1 or G2 phases and in presence or not of PAX3-FOXO1 (P3F) and PAX7-FOXO1 (P7F) (circles: values obtained for independent cell lines, bars: mean ± s.e.m.). This shows that the expression levels of PAX3-FOXO1 and PAX7-FOXO1 induced by DOX from the AAVS1 locus are not submitted to variation throughout the cell cycle (b). For all PAX-FOXO1 targets analysed, their expression levels varied between G1 and G2 phases. In contrast, these targets are in both phases induced by PAX-FOXO1 and their specific sensitivity to PAX3-FOXO1 or PAX7-FOXO1 remains the same. (d). Thus, PAX3-FOXO1 induced NGFR and SERPINI1 to a greater extent than PAX7-FOXO1 regardless of the cycle phase. Similarly, SKP2 and PIPOX showed higher expression levels in the presence of PAX7-FOXO1 than PAX3-FOXO1 in G1 and G2. (c) Graph representing the ratio of the expression levels of the indicated genes in PAX3-FOXO1 cells to those in PAX7-FOXO1 cells in the G1 and G2 phases of the cell cycle, illustrating that the differential response of the cells to a given type of PAX-FOXO1 is not affected by the phase of the cell cycle (bars: log2 of the average over three independent cell lines). (TIF) Click here for additional data file.

Position and normalized reads count distribution at the best 6000 PAX-FOXO1s bound cis-regulatory modules (CRMs) after CUT&Tag using FLAG, FOXO1, H3K27ac, H3K9me3 and H3K27me3 antibodies in control, PAX3-FOXO1, PAX7-FOXO1 cell lines (Genome Ref: hg19) and the closest gene.

(XLSX) Click here for additional data file.

Nature and distribution of PAX-FOXO1 related motifs in PAX-FOXO1s bound cis-regulatory modules (CRMs).

Sheet 1: PWM for 21 DNA binding motifs previously identified for PAX3, PAX7 and PAX3-FOXO1 as well as bHLH and FOXO1. Sheet 2: Distribution of all 21 PWM across cluster 1, 2 and 3 defined in Fig 1B. The adjusted p-value was calculated by AME of the MEME-suite and correspond to “The optimal enrichment p-value of the motif according to the statistical test, adjusted for multiple tests using a Bonferroni correction. If the best p-value is p before adjustment, and the number of multiple tests is n, then the adjusted p-value is 1 - (1-p)”. (XLSX) Click here for additional data file.

Differential analyses of PAX3-FOXO1 and PAX7-FOXO1 expressing HFF transcriptomes.

Sheet 1: Stable HFF lines. Genes RPKM for all samples; results of the pairwise differential analysis performed using Cufflinks. Genes with a q-value <0.05 after Benjamini-Hochberg correction for multiple-testing were considered to be significant; Cluster (A, B, C, D defined in Fig 2A); Functional association with cell morphology; Association with cell cycle regulation. Sheet 2: Transient transfected HFF. Genes RPKM for all samples; results of the pairwise differential analysis performed using Cufflinks. Genes with a q-value <0.05 after Benjamini-Hochberg correction for multiple-testing were considered to be significant. (XLSX) Click here for additional data file.

Differential analysis of PAX3-FOXO1 and PAX7-FOXO1 expressing biopsies transcriptome [12].

Genes mean expression in PAX3-FOXO1 or PAX7-FOXO1 biopsies. Results of paired t-test (P3F/P7F). Only genes with a p-value <0.05 are shown. Association with PAX3-FOXO1 or PAX7-FOXO1. (XLSX) Click here for additional data file.

GO term-analyses of PAX3-FOXO1 and PAX7-FOXO1 associated transcriptomes in RMS biopsies and HFF stable lines.

The table displays GO term, adjusted p-value and genes associated for each GO. GO with a p-value<0.05 are colour highlighted. Sheet 1: Results for genes associated with PAX3-FOXO1 in RMS biopsies. Sheet 2: Results for genes associated with PAX7-FOXO1 in RMS biopsies. Sheet 3: Results for genes associated with PAX3-FOXO1 in HFF stable lines. Sheet 4: Results for genes associated with PAX7-FOXO1 in HFF stable lines. (XLSX) Click here for additional data file.

Matrices of the western blots, immunostaining and q-RT-PCR data graphed in the manuscript Figures.

(XLSX) Click here for additional data file. 5 Oct 2021 Dear Dr Ribes, Thank you very much for submitting your Research Article entitled 'Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1 paralogs' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important problem, but raised some substantial concerns about the current manuscript. Based on the reviews, we will not be able to accept this version of the manuscript, but we would be willing to review a much-revised version. We cannot, of course, promise publication at that time. Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool.  PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions. Yours sincerely, Mark E. Hatley Guest Editor PLOS Genetics David Kwiatkowski Section Editor: Cancer Genetics PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #1: minor comments: (1) "Both PAX-FOXO1s result in related cell transformation in animal models, but both mutations are associated with distinct pathological manifestations in patients". Of note, PAX-translocations are not "mutations" but rather alterations. Defining the chromosomal translocations as mutations is incorrect and potentially confusing. (2) "the identified pronounced deleterious effects of PAX7-FOXO1 provide an explanation for the low frequency of the translocation generating this factor in patients with rhabdomyosarcoma" In patients, PAX7 fusions often have better clinical outcomes than PAX3 fusions. The statement, as written might be confusing to readers, suggesting that PAX7-fusions have worse clinical outcomes. major comments: (1) It is of note that PAX3 and PAX7 fusions are expressed as distinct splice forms. This has been known for more than 15 years (PMID: 15688409). In the literature on this topic, PAX7 fusions seem to be co-expressed with about four distinct splice variants, while often the subject of gene amplification events. Merely expressing the fusions in differentiated cells will not recapitulate the clinical/physiological features of these genes as they are expressed in human cancer. (2) "Finally, each of the PAX-FOXO1s could have its own transcriptional activity. Supporting this idea, PAX3-FOXO1 and PAX7-FOXO1 RMS differ in their DNA methylation profiles and transcriptome". What is the relationship between chromatin binding and transcription for these fusions? As written it seems that the authors define DNA-methylation as a bridge between molecular recognition of DNA and altered transcription. However, DNA methylation occurs on very slow timescales, while transcriptional activity occurs on very rapid timescales. (3) "PAX3-FOXO1 binding to non-coding cis-regulatory modules (CRMs) is mediated by its PrD alone or in combination with its HD, but rarely by its HD alone [15,16]" The conclusion that the FOXO domains do not play a role in chromatin recognition seems to be based on incomplete evidence. What is the evidence that both parts of the fusion do not regulate DNA recognition? The experimental design is potentially problematic, "Human foreskin fibroblasts (HFF) were engineered to express a copy of a FLAG-tagged version of these TFs in a doxycycline (DOX)-inducible manner from the AAVS1 safeguard locus (Figure S1b)." By introducing a tag onto the fusion oncoprotein, the sterics of chromatin recognition will likely be altered. Thus, conclusions from this type of tag-based system are specific for the FLAG-fusions, more so than the endogenous PAX3/7-FOXO fusions found in patients. (4) "Using these cell lines, we first mapped the genomic targets of PAX3-FOXO1 and PAX7- FOXO1 using Cleavage Under Targets and Tagmentation (CUT&Tag) experiments [22] (Figure 92 1; S2)." The molecular basis of Cut&Tag relies on an "input" sample that is essentially ATAC-seq, or open chromatin. Then, the “IP” relies on the pre-condition of chromatin that is already accessible in order to isolate epitope specific DNA-protein binding events. The system is based on selecting accessible DNA-binding sites for the fusion oncoproteins. Recent evidence in the field suggests that repressive or quiescent chromatin might serve as key targets for these fusions, and this information cannot be captured with this experimental system. This experimental selection for accessible chromatin is further underscored with the "Recruitment of PAX3-FOXO1 and PAX7-FOXO1 to the genome was generally correlated with de novo deposition of H3K27ac (Figure 1a,b,civ-vi)" statement. The correlation of high levels of K27ac (accessible chromatin, overlapping with ATAC signals) and PAX fusion binding is a product of the experimental design, and likely not the true biology and chromatin recognition of the system. (5) Throughout the text, it is suggested that the HD and PD domains (PAX domains) of the fusions regulate DNA binding. However, then it is stated that "the induction of specific gene cohorts by one of the PAX-FOXO1 chimeras is a property that emanates from its PAX moiety, whereas the induction of common genes is property of the fusion protein." It is difficult to “rule out” any contributions form the FOXO domain in chromatin recognition of unique sites, to result in distinct transcriptional outcomes. Moreover, it is not discussed in the text whether there are apparent gene-repressive roles for the fusions as well. This should be stated, and elaborated upon. Presenting or focusing only on gene-activating roles is inconsistent with key studies in the field, and potentially driven from the experimental techniques used in this study. This should be included, but the limitations of the CUT&Tag system (see above) might make the argument for gene repression more difficult to describe with the proposed experimental model. (6) The cell cycle features of the two oncoproteins are meritorious of further mechanistic examination. The preference for G1/S vs G2/M phases for the PX3 and PAX7-fusions should be discussed also in the context of previous established studies on "checkpoint adaptation" for PAX3FOXO1 (PMID: 24453992). Altogether, the study is promising, but the methodological limitations especially for the genome-wide binding studies make it challenging to evaluate the conclusions in the context of the approaches and data presented. Connections with cell cycle specific expression (PMID: 24453992), gene amplification for fusions (PMID: 15688409), and sampling chromatin outside of accessible regions would strengthen this study. Reviewer #2: 1. The authors show sites of PAX3- and PAX7-FOXO1 binding, and related H3K27ac that tracks along with clusters 1/2/3 that have P3F/P7F. At these same sites, what is the signal from publically available H3K27ac (cell lines and tumors) or PAX3-FOXO1 signal (in cell lines)? Note: H3K27ac data from PAX7-FOXO1 primary tumor has been deposited, but not analyzed for the kinds of comparisons done between P7F and P3F in this paper. It would be interesting here if the authors directly compared H3K27ac from a PAX7-FOXO1 tumor (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM2214089 ) to H3K27ac from a PAX3-FOXO1 tumor (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM4058221 ). PAX3-NCOA1 ChIP-seq is in the iScience paper (https://pubmed.ncbi.nlm.nih.gov/32416589/) but also hasn’t been analyzed genome wide (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM4058219 ). 2. Two of the most iconic locations of PAX3-FOXO1 binding are at the MYOD1 and FGFR4 super enhancers. Are either of those recapitulated in these CUTandTag experiments? 3. Figure 1 panel C would benefit from showing the PrD and HD domains (showing the actual motifs) and using, once, the full name next to the abbreviations PrD and HD. 4. Toward the middle of the manuscript, associated with Figure 2, the authors describe differences in transcriptional output downstream of PAX3-FOXO1/PAX7-FOXO1 activity. In the cell line models, no gene ontology is reported, yet for the primary tumor analysis of public microarray data they do describe sets of gene ontology (ie, cell cycle, cell migration, and metabolism for PAX3-FOXO1 selectively upregulated genes, and embryonic lineage differentiation as well as genes involved in cytoskeletal remodelling for PAX7-FOXO1). The authors need to (a) perform gene ontology from the cell lines models and see if it agrees with their existing analysis, and (b) make two “gene sets” of these 988 and 856 genes (Figure 2d) and use them to perform GSEA on the log2 fold change of expression from their experiments in Figure 2a/c. 5. The paper is all about “Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1” and generated new CUTandTag data and new RNA-seq data from a model system in fibroblasts. Based on this, it would be expected that at least 2 types of example gene loci (genome browser shots) would be shown: 1 PAX3-FOXO1 bound and selectively upregulated gene, 1 PAX7-FOXO1 bound and selectively upregulated gene, and 1 gene bound by and upregulated by either P3F/P7F. This kind of “zoom in” to illustrate the transcriptional divergence shown in Figure 2 are warranted. 6. The authors would do well to perform GSEA on the RNA-seq data in cells +/-PAX3-FOXO1 and PAX7-FOXO1, specifically using some of the MolSigDB genesets known for PAX3-FOXO1” https://www.gsea-msigdb.org/gsea/msigdb/cards/EBAUER_MYOGENIC_TARGETS_OF_PAX3_FOXO1_FUSION https://www.gsea-msigdb.org/gsea/msigdb/geneset_page.jsp?geneSetName=GRYDER_PAX3FOXO1_ENHANCERS_KO_DOWN https://www.gsea-msigdb.org/gsea/msigdb/geneset_page.jsp?geneSetName=DAVICIONI_PAX_FOXO1_SIGNATURE_IN_ARMS_UP 7. “Deeper alterations of cell architecture and cell cycle induced by PAX7-FOXO1 than by PAX3-FOXO1” is missing a verb, such as “are induced”. I would recommend active voice here anyway, so “PAX7-FOXO1 induces deeper alterations in cell architecture and cell cycle than PAX3-FOXO1”. Reviewer #3: In their manuscript, Manceau et al. present a deep analysis of the effects of PAX3-FOXO1 and PAX7-FOXO1 on the function of normal human fibroblasts. The goals of the study are clear – to describe the distinct and common functions of these chimaeric fusion genes on the transcriptome, epigenome and cell biology of untransformed cells. This is conducted through the generation of models of epitope-tagged PAX3-FOXO1 and PAX7-FOXO1 in HFF cells, followed by study of genome-wide localization of these fusion proteins by CUT&TAG, then analysis of transcriptomics including some fusion with their epigenomic data, and finally, a study of the cell biology of this de novo system. In general, the data is internally consistent, well presented and intriguing. I do, however, have three major concerns and several minor concerns that should be addressed prior to the manuscript being suitable for publication. The goals of my comments are to strengthen this manuscript and ensure experimental rigor. Major concerns: 1. In their CUT&TAG analysis, the authors present data to demonstrate that levels of the H3K27ac mark is higher in PAX7-FOXO1 expressing samples, compared with PAX3-FOXO1 expressing samples. In a review of their text, legends and methods section, I am unable to determine if these samples were spiked-in with an exogenous control of some sort. E.coli DNA would be standard for CUT&TAG analysis, and this would be used for normalization of the data. In the absence of this important control, the statement that PAX7-FOXO1 binding is higher than PAX3-FOXO1 binding is difficult to draw and challenging to intepret. Was this control performed? If not, how were the data normalized? 2. In general, I find several examples of data that are over-interpreted. The manuscript is of interest by itself, and does not require the data to be “sold.”I am listing several examples below, which should be corrected, however, there may be further examples. a. Line 127: “Therefore, both factors induce active chromatin signatures in healthy cells.” The data here argues that PAX/FOXO fusion proteins are found at sites marked by H3K27ac. Presence of the factor is not the same as chromatin remodeling and establishment of H3K27ac – essentially, induction of the chromatin signature. Recent work by Ben Stanton’s group (iScience 2021) seems to suggest PAX3-FOXO1 is a pioneer factor, which would argue this point, but the data as presented in the paper does not substantiate the claim. Rather, it reflects a correlation. Also, the point of “healthy” cells is unclear. Do the authors mean untransformed cells? b. Line 153: “Thus, PAX7-FOXO1 also emerges as a more potent transactivator than PAX3-FOXO1 in fully transformed contexts.” This claim is based on the finding that H3K27ac is higher in one PAX7-FOXO1+ cell line (RMZ-RC2), and not in another (CW9019) which has lower levels of PAX7-FOXO1. Most importantly, co-binding is not evidence of gene transactivation, which requires evidence of gene upregulation (not discussed until later in the manuscript). This statement should be softened appropriately. c. Line 231: “This would certainly lead to two discrete modes of tissue invasions.” This statement immediately follows a segment describing changes in nuclear architecture. I believe the authors have demonstrated intriguing data on actin stress fiber formation. This may be what the authors are referring to, though even actin stress fiber formation is not causal for tissue invasion. If the authors wish to include this statement in the manuscript, it would be important to substantiate that these cells are, in fact, invasive, and that PAX3-FOXO1 and PAX7-FOXO1 positive cells have different methods of tissue invasion. In the absence of this data, I would strongly suggest this statement be removed and the text be clarified. d. Line 252: “PAX7-FOXO1 was more prone to cause genomic instabilities than PAX3-FOXO1.” This statement is over-interpreted. The authors demonstrate increased gamma-H2AX foci, which is a marker of DNA double strand breaks. Is it possible that PAX7-FOXO1 causes a preferential defect of DNA repair mechanisms? Fundamentally, increased double strand breaks are not the same thing as whole genome instability. This statement should be softened/clarified. 3. The authors present an intriguing analysis of PAX3-FOXO1 and PAX7-FOXO1 signature genes in Figure S4a. Does this signature correlate to the signature induced in the HFF cells? I can imagine that it may not, due to expression of the transgenes in untransformed cells, though if there are correlations, then this would be interesting to comment on. If there are not, the authors should explain why not in the text. Minor Concerns: 1. Many contractions are not defined in the manuscript – notable “CRMs,” “PrD”, “HD,” “bHLH,” “TF” and so on. Careful attention to the writing of the manuscript should be paid in order to ensure that abbreviations are defined and the manuscript is clear. 2. As a control in Figure 1d, the authors should present H3K27ac data in normal HFF cells. 3. The western in Figure S1 appears to demonstrate that FOXO1 expression is increased by doxycycline – is this true/recurrent? Is it due to the transgene or doxycycline? The authors should explain this. 4. H3K27ac is a chromatin mark. The term “occupancy” refers to transcription factors or other proteins that bind to DNA. 5. The authors should include a statement that other translocations are found in the disease (i.e. NCOA2, VGLL2). 6. Some evidence of expression of murine Pax3 or Pax7 should be presented – either qPCR or ideally a western blot – to support Fig 2c. Further, the authors refer only to expression in “cells” – do they mean HFF cells? 7. Are RDabl cells the same as RD? 8. Are there effects from integrating into the PPP1R12C locus? ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: Yes Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Berkley E. Gryder Reviewer #3: No 25 Feb 2022 Submitted filename: Manceau_et_al_Letter_to_reviewers.pdf Click here for additional data file. 30 Mar 2022 Dear Dr Ribes, Thank you very much for submitting your Research Article entitled 'Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1 paralogs' to PLOS Genetics. The manuscript was fully evaluated at the editorial level and by independent peer reviewers. The reviewers appreciated the attention to an important topic but identified some concerns that we ask you address in a revised manuscript We therefore ask you to modify the manuscript according to the review recommendations. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. To enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Yours sincerely, Mark E. Hatley Guest Editor PLOS Genetics David Kwiatkowski Section Editor: Cancer Genetics PLOS Genetics Dear Dr. Ribes, Thank you for your patience during the review process. In general, the reviewers were satisfied with your re-submitted manuscript and how it addressed the original review. Reviewers 3 and 4 have noted things that should be addressed either with further explanation or removal from the text. No new experiments were requested (or necessary), but please consider the reviewers' comments when revising your manuscript. Best regards, Mark Hatley Reviewer's Responses to Questions Comments to the Authors: Please note here if the review is uploaded as an attachment. Reviewer #2: The authors have nicely addressed all my concerns, and the paper is improved greatly. I'm happy to recommend publication. Reviewer #3: Manceau et al present a revised manuscript, defining the effects of PAX3-FOXO1 and PAX7-FOXO1 on the transcriptome and epigenome of fibroblasts. It is clear they have done much work in this revision, and the manuscript is improved as a result. Despite this, I still find issues that must be addressed for this manuscript to be acceptable for publication. I do not think further experiments need to be done - rather, I think that the authors need to carefully edit this manuscript for clarity and to ensure their statements reflect their findings. 1. The authors broadly overstate their findings in several places. The most concerning of these overstatements is found in the abstract, summary, results and discussion, where the authors claim that PAX7-FOXO1 has "higher transactivation potential" than PAX3-FOXO1. Their data as presented does not support this very broad claim. At no point do the authors demonstrate that the whole transcriptomic effects of PAX7-FOXO1 expression are greater than those of PAX3-FOXO1. This could be achieved by a violin plot of all expressed genes in these different scenarios. Alternatively, the authors could focus on genes bound by both PAX3-FOXO1 and PAX7-FOXO1 and examine the actual gene expression values in their RNAseq data. Is the expression higher for PAX7-FOXO1 than PAX3-FOXO1 at loci bound by both these proteins? The authors attempt an analysis like this in Fig 2C, however, this is a row-normalized heatmap, and a scatterplot or bar plot with an appropriate statistical test would actually prove this. Regardless, this point is actually not exceptionally important. PAX3-FOXO1 and PAX7-FOXO1 bind to similar and distinct regions of the genome, both function as pioneer factors, and cause distinct functional outcomes. Claims of higher or lower transactivation, in the absence of showing actual gene transactivation, are really unnecessary. To this end, I strongly recommend the authors simply remove this concept of "higher" or "lower" transactivation from their manuscript. Their data does not support this statement, and it doesn't really add much to their paper. Other examples of broad overstatements: Line 168-175: Here, the authors describe that H3K27ac is deposited at CRMs higher at P7F loci than P3F loci. The authors go on to discuss that this means that there is higher transactivation potential for P7F. H3K27ac is a histone mark, associated with promoters and enhancers. It correlates with expressed genes, but is also found at poised loci which are not expressed. It is an overreach to claim that more H3k27ac means more gene transactivation, without providing further evidence. Line 302-304: Here, the authors describe that they will test whether PAX-FOXO cell cycle deregulation is linked to DNA damage. They then go on to show that DNA ds breaks are elevated in PAX7-FOXO1 expressing cells, compared with PAX3-FOXO1, and then claim that these means more genome instability. This section needs to be re-written. The authors have shown correlative data to suggest that PAX7-FOXO1 expression is associated with increased DNA ds breaks, and have not linked this to cell cycle control at all. Further, the presence of DNA ds breaks is not the same thing as genome instability. 2. Minor text edits: Line 123-124: The authors state that they identified 6000 CRMs with PAX3-FOXO1 and/or PAX7-FOXO1 binding signals. In the methods, however, they state that they took the "top 6000" binding signals. Which is true? Comments on RMS cell lines should be taken out of the text, now that they are not used in this manuscript anymore. The discussion of EWS-FLI and drawing parallels to PAX3-FOXO1 and PAX7-FOXO1 in the discussion is confusing. Reviewer #4: Manceau et al directly compares the genome binding of PAX3-FOXO1 and PAX7-FOXO1, associated histone marks, and transcriptional consequences in the context of human fibroblasts. This has been a longstanding question in the rhabdomyosarcoma field, why PAX7-FOXO1 has different clinical outcomes than PAX3-FOXO1 positive tumors. This is a challenging question to address given the lack of animal models and high toxicity of the fusion-oncogenes in cell culture systems. This study represents a first step to understand PAX3/7-FOXO1 divergent activities and ties their genomic data to phenotypic consequences detailed in Figure 3 related to cellular morphology, cell cycle arrest, and DNA integrity. The authors have addressed the reviewer comments satisfactorily and have presented new data that has improved the overall study. Additional clarification on whether these fibroblasts have the capacity to transform would help frame this study and claims in the context of the field (see below). Major Comments 1. Additional explanation on the rationale for choosing fibroblasts to express the PAX3/7-FOXO1 fusions. Elaborate on why fibroblasts were chosen for this study instead of myoblasts. Do these PAX3/7-FOXO1 expressing fibroblasts have the capacity to transform, and if not, how would you interpret these findings as being related to the disease? This could be included as part of the discussion. Minor Comments 1) There is no limit to PLOS Genetics manuscript length and the methods can be included in the main text. 2) Figure 2A legend does not describe the presented data. 3) Figure 3A is a red/green overlay and should be modified so it is accessible to colorblind individuals. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #2: Yes Reviewer #3: Yes Reviewer #4: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: Yes: Berkley E Gryder Reviewer #3: No Reviewer #4: No 19 Apr 2022 Submitted filename: Manceau_et_al_Referees_Revision2_Final.pdf Click here for additional data file. 25 Apr 2022 Dear Dr Ribes, We are pleased to inform you that your manuscript entitled "Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1 paralogs" has been editorially accepted for publication in PLOS Genetics. Congratulations! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional acceptance, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about making your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Yours sincerely, Mark E. Hatley Guest Editor PLOS Genetics David Kwiatkowski Section Editor: Cancer Genetics PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-21-01090R2 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 18 May 2022 PGENETICS-D-21-01090R2 Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1 paralogs Dear Dr Ribes, We are pleased to inform you that your manuscript entitled "Divergent transcriptional and transforming properties of PAX3-FOXO1 and PAX7-FOXO1 paralogs" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Anita Estes PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  49 in total

1.  PAX3 and PAX7 exhibit conserved cis-acting transcription repression domains and utilize a common gain of function mechanism in alveolar rhabdomyosarcoma.

Authors:  J L Bennicelli; S Advani; B W Schäfer; F G Barr
Journal:  Oncogene       Date:  1999-07-29       Impact factor: 9.867

Review 2.  Alveolar rhabdomyosarcoma: is the cell of origin a mesenchymal stem cell?

Authors:  Elizabeth Charytonowicz; Carlos Cordon-Cardo; Igor Matushansky; Mel Ziman
Journal:  Cancer Lett       Date:  2008-11-12       Impact factor: 8.679

3.  The nucleus measures shape changes for cellular proprioception to control dynamic cell behavior.

Authors:  Valeria Venturini; Fabio Pezzano; Frederic Català Castro; Hanna-Maria Häkkinen; Senda Jiménez-Delgado; Mariona Colomer-Rosell; Monica Marro; Queralt Tolosa-Ramon; Sonia Paz-López; Miguel A Valverde; Julian Weghuber; Pablo Loza-Alvarez; Michael Krieg; Stefan Wieser; Verena Ruprecht
Journal:  Science       Date:  2020-10-16       Impact factor: 47.728

4.  Pax7-FKHR transcriptional activity is enhanced by transcriptionally repressed MyoD.

Authors:  Hugo C Olguín; Natalie E Patzlaff; Bradley B Olwin
Journal:  J Cell Biochem       Date:  2011-05       Impact factor: 4.429

5.  Comprehensive genomic analysis of rhabdomyosarcoma reveals a landscape of alterations affecting a common genetic axis in fusion-positive and fusion-negative tumors.

Authors:  Jack F Shern; Li Chen; Juliann Chmielecki; Jun S Wei; Rajesh Patidar; Mara Rosenberg; Lauren Ambrogio; Daniel Auclair; Jianjun Wang; Young K Song; Catherine Tolman; Laura Hurd; Hongling Liao; Shile Zhang; Dominik Bogen; Andrew S Brohl; Sivasish Sindiri; Daniel Catchpoole; Thomas Badgett; Gad Getz; Jaume Mora; James R Anderson; Stephen X Skapek; Frederic G Barr; Matthew Meyerson; Douglas S Hawkins; Javed Khan
Journal:  Cancer Discov       Date:  2014-01-23       Impact factor: 39.397

6.  CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs.

Authors:  Mohammad A Mandegar; Nathaniel Huebsch; Ekaterina B Frolov; Edward Shin; Annie Truong; Michael P Olvera; Amanda H Chan; Yuichiro Miyaoka; Kristin Holmes; C Ian Spencer; Luke M Judge; David E Gordon; Tilde V Eskildsen; Jacqueline E Villalta; Max A Horlbeck; Luke A Gilbert; Nevan J Krogan; Søren P Sheikh; Jonathan S Weissman; Lei S Qi; Po-Lin So; Bruce R Conklin
Journal:  Cell Stem Cell       Date:  2016-03-10       Impact factor: 24.633

7.  Orchestration of DNA Damage Checkpoint Dynamics across the Human Cell Cycle.

Authors:  Hui Xiao Chao; Cere E Poovey; Ashley A Privette; Gavin D Grant; Hui Yan Chao; Jeanette G Cook; Jeremy E Purvis
Journal:  Cell Syst       Date:  2017-10-25       Impact factor: 10.304

8.  Immunohistochemical detection of PAX-FOXO1 fusion proteins in alveolar rhabdomyosarcoma using breakpoint specific monoclonal antibodies.

Authors:  David O Azorsa; Peter K Bode; Marco Wachtel; Adam Tai Chi Cheuk; Paul S Meltzer; Christian Vokuhl; Ulrike Camenisch; Huy Leng Khov; Beata Bode; Beat W Schäfer; Javed Khan
Journal:  Mod Pathol       Date:  2020-12-09       Impact factor: 8.209

9.  deepTools2: a next generation web server for deep-sequencing data analysis.

Authors:  Fidel Ramírez; Devon P Ryan; Björn Grüning; Vivek Bhardwaj; Fabian Kilpert; Andreas S Richter; Steffen Heyne; Friederike Dündar; Thomas Manke
Journal:  Nucleic Acids Res       Date:  2016-04-13       Impact factor: 16.971

10.  The PAX-FOXO1s trigger fast trans-differentiation of chick embryonic neural cells into alveolar rhabdomyosarcoma with tissue invasive properties limited by S phase entry inhibition.

Authors:  Gloria Gonzalez Curto; Audrey Der Vartanian; Youcef El-Mokhtar Frarma; Line Manceau; Lorenzo Baldi; Selene Prisco; Nabila Elarouci; Frédéric Causeret; Daniil Korenkov; Muriel Rigolet; Frédéric Aurade; Aurélien De Reynies; Vincent Contremoulins; Frédéric Relaix; Orestis Faklaris; James Briscoe; Pascale Gilardi-Hebenstreit; Vanessa Ribes
Journal:  PLoS Genet       Date:  2020-11-11       Impact factor: 5.917

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.