| Literature DB >> 35600892 |
Jesse A Coker1,2, Vittorio L Katis1, Michael Fairhead1, Anja Schwenzer2, Stine B Clemmensen3, Bent U Frandsen3, Willem A de Jongh3, Opher Gileadi1, Nicola A Burgess-Brown1, Brian D Marsden1,2, Kim S Midwood2, Wyatt W Yue1.
Abstract
Recombinant protein expression in eukaryotic insect cells is a powerful approach for producing challenging targets. However, due to incompatibility with standard baculoviral platforms and existing low-throughput methodology, the use of the Drosophila melanogaster "S2" cell line lags behind more common insect cell lines such as Sf9 or High-Five™. Due to the advantages of S2 cells, particularly for secreted and secretable proteins, the lack of a simple and parallelizable S2-based platform represents a bottleneck, particularly for biochemical and biophysical laboratories. Therefore, we developed FAS2FURIOUS, a simple and rapid S2 expression pipeline built upon an existing low-throughput commercial platform. FAS2FURIOUS is comparable in effort to simple E. coli systems and allows users to clone and test up to 46 constructs in just 2 weeks. Given the ability of S2 cells to express challenging targets, including receptor ectodomains, secreted glycoproteins, and viral antigens, FAS2FURIOUS represents an attractive orthogonal approach for protein expression in eukaryotic cells.Entities:
Keywords: S2 cells; glycoproteins; insect cells; recombinant proteins; secreted proteins; structural biology
Year: 2022 PMID: 35600892 PMCID: PMC9117644 DOI: 10.3389/fbioe.2022.871933
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Overview of the FAS2FURIOUS method. Step 1: constructs are designed and cloned into pExpreS2-1 class vectors using a HiFi assembly in 96-well plates. Step 2: insert-containing clones are verified by colony PCR and mini-prepped on spin-columns. Step 3: constructs are transiently transfected in parallel into S2 cells in 24-well plates. Step 4: supernatants are harvested, test-purified using 96-well filter plates, and checked for expression on SDS-PAGE. Step 5: polyclonal stable cell lines are selected using Zeocin for constructs of interest. Step 6: polyclonal cell lines are scaled up in 1L shake flasks for large-scale purification.
FIGURE 2Vectors and construct design. (A) pExpreS2-1 vector backbone included in the ExpreS2ion’s commercially available kit. (B) Exemplar F2F vector, pExpreS2-1-C3-PA-10H-SIII, modified for high-throughput structural applications. (C) Sequence-level details of pExpreS2-1-C3-PA-10H-SIII showing the BglII linearization sequence, recommended HiFi overhangs, N-terminal secretion peptide, and C-terminal affinity tags. An overview of all F2F vectors created for this study can be found in Table 1.
FIGURE 3Cloning and test expression results. (A) Colony PCR after selecting 94 colonies from 18 different constructs demonstrates >90% assembly efficiency using HiFi. Red asterisk = vector alone; orange asterisk = unidentified products. (B) SDS-PAGE after 3-ml test expression and Ni-NTA pull-down. Eighteen constructs and two controls tested in parallel. Green asterisk = target band confirmed by in-gel tryptic digest MSMS; orange asterisk = putative target band.
Overview of all the vectors used in this study and publicly available at Addgene.
| Vector name | Vector description |
| Selection marker | Cloning strategy | N-Terminal Tag | C-terminal Tag | Protease cleavage site |
|---|---|---|---|---|---|---|---|
|
| Parent vector from ExpreS2ion | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | Restriction enzyme | None | None | None |
|
| Parent vector from ExpreS2ion | 100 µg/ml Kanamycin | 4 mg/ml G418 | Restriction enzyme | None | None | None |
|
| GFP (+) transfection control | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | N/A | N/A | N/A | None |
|
| F2F expression vector | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | HiFi | BiP Signal Peptide | 10His + Twin-Strep | HRV C3 Protease |
|
| F2F expression vector | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | HiFi | BiP Signal Peptide | 10His + Twin-Strep + Protein A | HRV C3 Protease |
|
| F2F expression vector | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | HiFi | BiP Signal Peptide | Protein A | HRV C3 Protease |
|
| F2F expression vector | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | HiFi | BiP Signal Peptide | Protein A | Thrombin |
|
| F2F expression vector | 25–50 µg/ml Zeocin | 2 mg/ml Zeocin | HiFi | BiP Signal Peptide | 10His + Twin-Strep + Protein A | Thrombin |
FIGURE 4Large-scale purification of TLR4 and MD-2. (A) Construct design using pExpreS2-1-CRPA and pExpreS2-2. (B) Final purity for TLR4, MD-2, and TLR4:MD-2 complex after IgG pull-down and size-exclusion chromatography (SEC). In the TLR4 and TLR4:MD-2 samples, the Protein A tag has been removed, while in the MD-2 sample, the tag is retained for stability. All SDS-PAGE bands were confirmed by in-gel tryptic digest MSMS. (C) Analytical SEC binding assay shows that individually purified TLR4 and MD-2 associate into a complex as expected. It is to be noted that MD-2 exists as a mixed homo-oligomer by itself in solution and, therefore, elutes before the larger TLR4 monomer. (D) Activity assay confirms that TLR4:FBG-C binding is similar between S2-derived and commercially available mammalian cell-derived TLR4 from R&D Systems. Data are presented from a single biological replicate and were fit via nonlinear regression to a one-to-one saturation binding model using GraphPad Prism.
FIGURE 5Large-scale purification of CD44. (A) Construct design using pExpreS2-1-C3-10H-SIII. (B) CD44 is pure and monodisperses after SEC. (C) Binding assay confirms that S2-derived CD44 binds to its ligand hyaluronic acid (HA) with similar affinity as E. coli– or mammalian-derived CD44. Data are presented from a single biological replicate and were fit via four component (variable slope) nonlinear regression using GraphPad Prism.
FIGURE 6Diverse targets expressed in S2 Cells. Representative examples of proteins expressed with the ExpreS2/F2F system both in-house and at ExpreS2ion Biotechnologies.
| Vector | 5′ Forward overhang | 3′ Reverse overhang |
|---|---|---|
| pExpreS2-1-C3-10H-SIII | 5′- cctttgttggcctctcgctcggg | 5′- ccctgaaacagaacctccaa |
| pExpreS2-1-C3-PA-10H-SIII | ||
| pExpreS2-1-C3-PA | ||
| pExpreS2-1-CR-PA | 5′- gccgatccgcgtggcaccag | |
| pExpreS2-1-CR-PA-10H-SII |
| Primer name | Sequence | Location |
|---|---|---|
| pExpreS2-1-for1 | 5′-acaagacaggtttaaggagac | Upstream synthetic intron |
| pExpreS2-2-for1 | 5′-ccggagtataaatagaggcgc | Upstream HSP70 promoter |
| pExpreS2-rev1 | 5′-gcgcttgaaaggagtgtgta | Downstream opie pAA signal |