P2X4 receptors mediate induction of antioxidants, fibrogenic cytokines and ECM transcripts; in presence of replicating HCV in in vitro setting: An insight into role of P2X4 in fibrosis.

BACKGROUND & AIMS: Major HCV infections lead to chronic hepatitis, which results in progressive liver disease including fibrosis, cirrhosis and eventually hepatocellular carcinoma (HCC). P2X4 and P2X7 are most widely distributed receptors on hepatocytes.
METHODS: Full length P2X4 (1.7kb) (Rattus norvegicus) was sub cloned in mammalian expression vector pcDNA3.1+. Two stable cell lines 293T/P2X4 (experimental) and 293T/ NV or null vector (control) were established. Both cell lines were inoculated with high viral titers human HCV sera and control human sera. Successfully infected cells harvested on day 5 and day 9 of post infection were used for further studies.
RESULTS: The results revealed a significant increase in gene expression of P2X4 on day 5 and day 9 Post -infection in cells infected with HCV sera compared with cells inoculated with control sera. Quantitative real time PCR analysis revealed that HO-1 was significantly upregulated in presence of P2X4 in HCV infected cells (P2X4/HCV) when compared with control NV/HCV cells. A significant decrease was observed in expression of Cu/ZnSOD in presence of P2X4 in HCV infected cells compared to control NV/HCV cells. However, expression of both antioxidants was observed unaltered in cells harvested on day 9 post infection. Gene expression of angiotensin II significantly increased in HCV infected cells in presence of P2X4 on day 5 and day 9 of post infection when compared with control NV/HCV cells. A significant increase in gene expression of TNF-α and TGF-β was observed in HCV infected cells in presence of P2X4 on day 9 post infection in comparison with control (NV/HCV cells). However, gene expression of adipokine leptin was not affected in both experimental (P2X4/HCV) and control (NV/HCV) groups on day 5 and day 9 of post infection. Extracellular matrix proteins, laminin and elastin genes expression also significantly increased in presence of P2X4 (HCV/P2X4) on day 9 of post-infection compared to control group NV/HCV cells.
CONCLUSION: In conclusion, these findings constitute the evidence that P2X4 receptors in the presence of HCV play a significant role in the regulation of key antioxidant enzymes (HO-1, Cu/ZnSOD), in the induction of proinflammatory. cytokine (TNF-α), profibrotic cytokine (TGF-β) vasoactive cytokine (angiotensin II). P2X4 also increases the expression of extracellular matrix proteins (laminin and elastin) in the presence of HCV.

Introduction

Hepatitis C virus (HCV) is an enveloped virus with a single positive-sense strand RNA genome, isolated in 1989, belongs to the family Flaviviridae [1-8]. There are two types of infections namely; acute and chronic, acute HCV infection found to be persistent in about 85% of cases [9]. All over the world, 3.3% of the population is infected while 10% of the Pakistani population is chronically infected with HCV [10-13].

HCV has a single-stranded RNA genome comprising of 96000bp long, the polyprotein is posttranslationally cleaved by both viral/cellular proteases to produce about 10 polypeptides [13-18]. Major HCV infections lead to chronic hepatitis, which results in progressive liver disease including fibrosis, cirrhosis, and eventually hepatocellular carcinoma (HCC) [4, 12]. Approximately 30% of chronically infected patients develop liver fibrosis and cirrhosis. It is estimated that there is an annual risk of 1% to 4% among patients with cirrhosis to develop hepatocellular carcinoma (HCC) [5-7]. There is a robust link reported between chronically infected patients with HCV having genotype 3a and HCC (63.44% of tested HCC patients) in the Pakistani population [10].

The disease is manifested by viral replication within hepatocytes, generation of reactive oxidative species (ROS), triggering of innate and specific immune responses, necroinflammation with the destruction of hepatocytes, and slowly progressive development of fibrosis. Several studies are being focused to find out the association between viral-induced signaling pathways that lead towards chronic disease manifestation [13, 19]. Though the characteristics and complications of HCV are well identified, the molecular mechanisms of HCV-induced pathogenesis are yet to be fully understood [2, 19]. However, oxidative stress has emerged as a key player in the development and progression of HCV-induced pathogenesis including inflammation, fibrosis, altered gene expression. and hepatocellular carcinoma (HCC) [8]. In Purinergic signaling, adenosine 5′-triphosphate (ATP) and adenosine act as extracellular signaling molecules. There are seven subtypes of P2X ion channel receptors (P2X1-7). Adenosine 5′-triphosphate (ATP) and its metabolites constitute important signaling pathways that regulate a broad variety of biological processes [20, 21]. In the liver, numerous pieces of evidence support a significant role for extracellular ATP-induced signaling pathways in the control of tissue homeostasis. Like, ATP and other nucleotides are physiologically detected in extracellular fluids within the liver in various mammalian species including humans and rodents. Intercellular purinergic signaling within hepatocytes is important for the regulation of key cellular processes including cell survival and death [22].

It is observed that P2X4 and P2X7 are the most widely distributed receptors on liver cells. Several P2 receptors are being studied on liver hepatocytes and other functionally specialized cells and it is also noteworthy to know the effect of ATP-mediated changes on liver physiology by exploiting P2XR. [23, 24]. There is a number of agonists and antagonists that have been studied to characterize the presence of these receptors on liver hepatocytes by using different in vitro and in vivo models.

The role of purinergic signaling in HCV-induced liver fibrosis is not yet known. As these are the active receptors on hepatocytes and purinergic receptors could be active targets for drug implication. To investigate the role of purinergic mechanisms, we investigated the role of P2X4 receptor involvement in HCV-induced liver fibrosis. The vector expressing purinergic receptor P2X4 and HCV sera were introduced externally in H239T to examine their effect on cellular genes specific for liver fibrosis. This study makes a new way for understanding how HCV exploits cellular receptors to interrupt normal homeostasis.

Material and methods

Cloning of P2X4 and development of cell culture-based system using vector carrying P2X4 and human HCV serum

Subcloning of P2X4 in a mammalian expression vector pcDNA3.1+ (Construction of Expression plasmid)

Full-length P2X4 (1.7kb) cloned in plasmid PCR 3.1(pCR3.1/P2X4) was kindly provided by Dr. Ishtiaq Qadri King Abdulaziz University, Jeddah, Saudi Arabia P2X4 was excised from vector PCR 3.1 and cloned in vector pcDNA3.1+ to obtain expression plasmid, P2X4/ pcDNA3.1+.

Establishment of stable cell lines:

Two different cell lines 293T/P2X4 (stably expressing P2X4 protein, Experimental), and 293T/pcDNA3.1+ or 293T/NV (vector alone without any insert/ null vector) were established to study the role of P2X4 in the presence of HCV replicating RNA.

The followings steps were involved:

Linearization and purification of digested of plasmids

Plasmids, P2X4/ pcDNA3.1+.and pcDNA3.1+ were linearized before transfection to facilitate their stable integration in 293T cells genome. Restriction enzyme Bgl II (Fermentas) was employed to linearize pcDNA3.1+/P2X4 and pcDNA3.1+. Before using Bgl II, it had been confirmed using software NEBcutter V2.0 that this enzyme was quite safe for important sequences required for protein synthesis of the inserted gene. Bgl II cut the pcDNA3.1+ only at single site (nucleotide number 13, far away from CMV promoter. Bgl II did not cut at any nucleotide site of inserted gene P2X4 (using software NEBcutter V2.0). Plasmids were also quantified using NanoDrop® (Spectrophotometer) (ND-1000) to facilitate the optimization of linearization reaction.

Digested plasmids were run on 1% agarose gel, 80V for 90 min and analyzed under UV-light. The gel slices containing linearized/ digested products (psP2X4 and pcDNA 3.1+) were cut with sterilized blade. Plasmids were purified according to the protocol of Fermentas DNA Extraction Kit (Cat # K0513). 5μl of purified plasmid were run on 1% agarose gel with λHindIII digested marker to check concentration for transfection. Concentration was also checked on nanodrop.

Cell line and culture condition

The cell line used in this study, HEK 293T (HEK, human embryonic kidney cell line) was kindly provided by Dr. Ishtiaq Qadri King Abdulaziz University, Jeddah, Saudi Arabia (). 293T cell line was cultured in Dulbecco Modified Eagle’s Medium (DMEM) supplemented with 100U/ml of penicillin and 100ug/ml of streptomycin and 10% heat inactivated fetal bovine serum. After transfection with pcDNA3.1+ with a zeocin resistance cassette (Invitrogen) that contained full length P2X4 or vector control (293T/P2X4 and 293T/Null vector), 293T cell lines were maintained in medium supplemented with 1mg/ml G418 for more than one month for the selection of stable clones. 293T stable cell lines were grown in DMEM supplemented with 500ug/ml G418. Cells were maintained at 37°C in a humidified environment containing 5% CO2 in a cell culture incubator. The cells were sub-cultured on every 3 days.

DNA transfections

293T cells were prepared for transfection by plating onto 4 Petri-dishes (60mm) at the time of subculture, 2days before transfection in DMEM containing appropriate supplements. They were transfected with plasmid pcDNAP2X4 (experimental) and pcDNA3.1 vector alone (control).

After 2days cells became 70–80% confluent and transfections were carried out using LipofectamineTM 2000 (Invitrogen, Cat No.11668-019) following the manufacturer’s instructions.

Two different concentrations of purified, linearized plasmid DNA (2μg DNA+6μl Lipofectamine and 4μgDNA+10μl Lipofectamine) were used for optimization of transfection reaction. At 48 hrs post transfection, cells were sub cultured into 25cm2 culturing flasks and 60mm petri-dishes and were grown in DMEM supplemented with selective agent G418 (1mg/ml).

Selection of stable cell lines

After successful transfections, cell lines 293T/P2X4 and 293T/Null vector (NV) were continuously grown in complete DMEM supplemented with G418 (1mg/ml). Cells were subcultured on every day 4–5 depending upon confluency of cells. At the same time 293T cells without any transfection were also grown in the presence of selective reagent G418 (1mg/ml) as a control for optimization of selection of resistant stable clones. The cells in this flask (control) were also subcultured, old media was replaced with fresh one supplemented with G418 (1mg/ml).

293T cells in this control culture (without any transfection but continuously receiving selective agent G418 at the same concentration of transfected cell lines) were died after 20-25days. Transfected cell lines were grown in G418 (1mg/ml) continuously for more than 1 month (35days). After that, cells were sub-passage, approximately 25% grown for 2–3 day in the presence of G418 (1mg/ml). Single colonies were isolated using sterile filtered tips employed on sterile pippett, under microscope and sterile conditions. Single clones were transferred to 24- well culturing plates, grown in the presence of G418 (500μg/ml). After 15 days single clones were trypsinized and shifted into 6- well plates. Upon 70% confluence, single clones with stable expression were sub-passage into 25cm2 culturing flasks. Expression of P2X4 was verified by reverse transcriptase PCR (mRNA) and western blotting (protein) and highest expressing clones were selected for further experiments.

Verification of stable cell lines

Reverse Transcription–Polymerase Chain Reaction (RT-PCR) analysis. Previously reported primers were used for detection of transfected P2X4 mRNA (Doctor et al., 2004) while for detection of vector primers were designed at sequence T7 promoter and BGH reverse priming site using Primer3 software (http://bioinformatics.weizmann.ac.il/cgi-bin/primer/primer3.cgi).

PCR amplification of transfected P2X4

PCR conditions were 94°C (2 minutes), 35 cycles [94°C (30 seconds), 58°C (30 seconds) and 72°C (1 minute)], and 72°C (10 minutes).

The amplified product was carefully excised from the gel, using a sterilized surgical blade and transferred into a sterile eppendorf and eluted from agarose gel using gel extraction kits (Fermentas; Cat No.K0513) by following the manufacturer’s instructions.

The identity of amplified product was confirmed by sequencing using an automated sequencer.

Sequences were analyzed manually by using Chromas software version (v 1.45). Homology studies of the nucleotide sequences of amplified and sequenced P2X4 with known nucleotide sequence was done through standard Basic Local Alignment Search Tool software available at NCBI website. The sequence of P2X4 showed 100% homology with reference sequence.

PCR amplification of transfected null vector

PCR conditions were 95°C (3minutes), 30 cycles [95°C (30 seconds), 52°C (30 seconds) and 72°C (45 seconds)], and 72°C (10 minutes). Amplified product of expected size was obtained.

Western blot analysis. To study protein expression of P2X4 in stable cell line, 100μg of total protein were loaded in each well on 10% SDS–PAGE gels and electrophoretically blotted onto a nitrocellulose membrane (Bio-Rad).

The expression level of P2X4 was determined using antibody specific to P2X4. The protein concentration of cell extracts was determined using a protein assay reagent (Bio-Rad). The membranes were blocked for over–night at 4°C with phosphate–buffered saline containing 5% skim milk. After being washed with 1xPBS containing 0.1% Tween 20, the membranes were incubated with primary antibody specific to P2X4 (Chemicon International, Cat no.AB5226) for over–night at 4°C. Wash the cells three times with 1X PBST and treated with secondary antibody (Chemicon International, Cat no.AP132A) for over–night at 4°C. After being washed with PBST proteins expressions were evaluated using 5-bromo-4-chloro-3-indolyl-phosphate/4-nitro blue tetrazolium chloride / (BCIP/ NBT) solution.

Western blot and RT-PCR analysis were performed at 48h and 96 h of post transfection and after that continuous selection with G418 for of 1 month. Singles clones were also analyzed at RT-PCR level and through Western blot analysis. Highest null vector (NV) mRNA expressing and P2X4, mRNA and protein expressing clones (transfected with 4μg plasmid DNA) were selected for further studies.

Viral inoculation and sample collection. Stable cell lines 293T/P2X4 (stable clone transfected with and stably over expressing P2X4 protein) and 293T/NV (stably expressing vector alone or null vector) were grown in 60mm Petri-dishes to 70% confluency and 40% confluency in two different groups.

Required confluency obtained after 2days of sub-culturing, cells were washed with 1XPBS and 1ml of complete DMEM supplemented with G418 (500μg/ml) was added in each dish.

Cells were inoculated with human HCV sera and control sera (240μl serum was mixed gently in 1ml complete DMEM medium/ per dish). Control sera and sera from chronically infected HCV patients (local population) with high viral titers and genotype 3a were obtained from Diagnostic Research Laboratories of centre (CEMB). Control sera (normal sera) were obtained from subjects negative for Hepatitis A, B and C, CMV and HIV.

The viral load in the used HCV sera was quantified by real time PCR using HCV Real-TM Quant kit (REF, TVI-96/2FRT C SP, Sacace Biotechnologies, Italy) following the manufacturer’s instructions. After 40-48h of inoculation, adherent cells were washed two times with IX PBS to get rid of the remaining infection serum. Incubation was continued in complete DMEM containing G418 (500μg/ml). The cells were maintained overnight at 37°C in a humidified environment containing 5% CO2. On day 5th RNA was isolated from cells using Gentra RNA Isolation Kit (Puregene, Minneapolis, MN 55441, USA) according to the provided protocol.

Formula for the calculation of HCV RNA concentration

Following formula was used to calculate the concentration of HCV RNA of each sample.

Cy3 STD/Res X Coefficient IC = IU HCV/ml. Fam Std/Res

Co-efficient, IC = internal control, which is specific for each lot.

Fluorescence is observed in Real Time on the Cy3 channel for HCV RNA and FAM channel for Internal Control.

Successfully inoculated RNA samples (with significant HVC titers) were quantified and further processed for cDNA synthesis.

On day 9th, RNA was isolated, viral titers were quantified through real time PCR. RNA samples with significant viral titers were further processed for cDNA synthesis. Inoculated cell lines showed significant HCV viral titers on day 5 and day 9 but not on day 14. So, cDNA of four different cell lines P2X4/HCV, P2X4/NR, NV/HCV and NV/NR after day 5 of inoculation and day 9 of inoculation were processed for further study.

Study the role of P2X4 receptor (Purinergic Signaling) in HCV induced liver fibrosis. Fibrosis is multifactorial involving interaction of various cellular markers. Therefore, in order to study the role of P2X4 receptor (Purinergic Signaling) in HCV induced liver fibrosis, we selected eight potent genes from different categories including oxidative stress (Cu/Zn-SOD, HO-1) cytokines (TNF-α, TGF-β1, Leptin, Angiotensin II) and finally extracellular matrix proteins (Laminin, Elastin) and above mentioned cell culture based system successfully inoculated with human HCV sera (i.e cell lines P2X4/HCV, P2X4/NR, NV/HCV and NV/NR) by following different steps.

Designing of PCR primers for selected markers. Sense and anti-sense primers for the amplification of different markers including Cu/Zn-SOD, HO-1, TNF-α, TGF- β1, Leptin, Angiotensin II Laminin and Elastin were designed using primer3 software.

Following gene-specific primers were used for PCR amplification from cDNA.

The samples were preheated at 94°C for 45seconds and then run 35 cycles with the following parameters: at 94°C for 1 minute, 57°C (Cu/Zn-SOD, HO-1,Laminin and Elastin), 55°C (TNF-α), 59°C (TGF-β1), for 45 seconds and 72°C for 1 minute. Final extension was done for 10 minutes at 72°C. The amplified PCR products of expected size were obtained.

Transcriptional expression analysis. The gene expression of Cu/Zn-SOD, HO-1, TNF-α, TGF-β, Leptin, Angiotensin II, Elastin, Laminin and P2X4 (Transfected) was analyzed in cell lines 293T/P2X4-HCV, 293T/P2X4-NR, 293T/NV-HCV and 293T/NV- NR (after day 5 and day 9 post inoculation) using real time Real Time PCR.

Real time PCR reactions were run on Cepheid smart cycler II (France) at same PCR Profiles which were used to optimized PCR products at conventional PCR (ABI-2700) thermal Cycler).

Statistical analysis. All the data was analyzed by using GraphPad Prism 5 software Version 5.02 and data was represented as mean ± SEM. ANOVA test was used to compare the parameters. A significant data was denoted with a p-value of less than or equal to 0.05.

Results

Sub cloning of P2X4 gene in expression vector

To examine the effect of P2X4 on genes reported to induce liver fibrosis, in presence of all HCV structural and nonstructural proteins, it was subcloned in mammalian expression vector pcDNA3.1+. Full length P2X4 (1.7kb) (Rattus norvegicus) cloned in plasmid pCR 3.1(pCR3.1/P2X4) along with its sequenced chromatogram was kindly provided by Dr. Ishtiaq Qadri King Abdulaziz University, Jeddah, Saudi Arabia. P2X4 was excised from vector pCR 3.1 and cloned in mammalian expression vector pcDNA3.1+ to obtained plasmid, P2X4/ pcDNA31+. Figs

Confirmation of P2X4 gene in vector pcDNA3.1+ Marker: λHindIII digested marker.

Lanes 4, 10, 11, and 13 showing digested plasmid with the release of insert.

Plasmid pcDNA3.1+/P2X4 restriction digestion after mini prep.

Lane 1 showed: λHindIII digested marker, Lanes 2 and 3 showing digested plasmid with release of insert, pcDNA 3.1+ mammalian expression vector (5.0-kb), Insert P2X4 (1.7-kb).

Establishment of stable cell lines

HEK 293T cell lines stably expressing P2X4 receptor (293T/P2X4) and vector alone or null vector (293T/NV) were established by transfection of vector carrying P2X4 gene and vector alone respectively. Highest null vector (NV) mRNA expressing and P2X4, mRNA and protein expressing clones were selected for further studies. Figs

Linearization of vector pcDNA3.1+/P2X4 before transfection.

Lane 1 showed: λHindIII digested marker, Lanes 4, 5, 6 and 7 showing digested linerized plasmid pcDNA3.1+/P2X4 (6.7-kb).

RT-PCR of cell line 293T/P2X4.

Lane 1 showed: 50-bp DNA size marker, Lanes 2 &3 showing amplified product of transfected P2X4 (390-bp).

PCR of cell line 293T/NV.

Lane 1 showed: 50-bp DNA size marker, Lanes 2,3.4 and 5 showing amplified product for NV (180-bp) (T7and BGH).

RT-PCR of single clones of cell lines 293T/P2X4 and 293T/NV.

Lane 1 showed: 100-bp DNA size marker, Lanes 2 &3 showing amplified product of NV (180-bp), Lanes4-15 showed amplified product of transfected P2X4 (390-bp).

Protein expression analysis of P2X4 receptor.

Western blot of P2X4 receptor (Protein lysate of selected single clones of cell lines 293T/P2X4 and 293T/NV). The predicted molecular mass of P2X4 is ~ 46kDa, but it is generally detected near 60–70 kDa because of glycosylation.

Infection of stable cell lines with naturally occurring human HCV

To examine the role of P2X4 receptor in HCV induced liver fibrosis (P2X signaling); sera from chronically HCV- infected patients with high viral titers were used to infect stable cell lines 293T/P2X4 and 293T/NV. HCV-RNA was detected in infected cells using quantitative RT-PCR. Fig 10 depicts successfully infected clones at day 5 and day 9 of post infection were used for further studies.

Fig 10

HCV RNA was quantified by RT-QPCR after infection in stable cell lines.

All values are expressed as mean ± SEM *P≤0.05 vs. control NV/HCV.

P2X4 gene expression in presence of HCV

HEK-293 stably expressing P2X4 was inoculated with patient serum having HCV; cells were incubated with virus to measure the effect of HCV on expression of P2X4 receptor. Expression of P2X4 gene was significantly increased at day 5 and day 9 of post infection in cells infected with HCV serum when compared with control cells (inoculated with normal human serum). Results were obtained from 3 individual experiments with replicates sample in each experiment are shown.

P2X4 receptor signaling in HCV induced liver fibrosis

It is assumed that HCV have effect on purinergic signaling, the combined effect of HCV on P2X4 receptor expression and various cellular genes that are involved in liver fibrosis were examined. The expression of these genes were measured post infection with HCV serum in stably expressing HEK-293.

P2X4 in regulation of antioxidants: Mediate regulate

HCV disrupts the cellular balance of oxidant and antioxidants. Antioxidant effect was measured in stably expressing cell line in the presence of HCV. Antioxidant heme oxygenase-1(HO-1) is significantly up regulates in presence of P2X4 in HCV infected cells when compared with control NV/HCV cells. A significant decrease was observed in expression of antioxidant superoxide dismutase (Cu/ZnSOD) in presence of P2X4 in HCV infected cells when compared with control NV/HCV. However, expression of both antioxidants was observed unaltered in cells harvested on day 9 of post infection. Results were obtained from 3 individual experiments with replicates sample in each experiment are shown. Figs .

P2X4 in induction of various cytokines

Level of vasoactive cytokine angiotensin II significantly increases in HCV infected cells in presence of P2X4 on day 5 and day 9 when compared with control NV/HCV cells. Figs

Fig 15 shows a significant increase in gene expression of pro-inflammatory cytokine TNF-α and pro-fibrotic cytokine TGF-β in HCV infected cells in presence of P2X4 on day 9 of post infection when compared with HCV infected cells in the absence of P2X4 (Control NV/HCV cells). Results were obtained from 3 individual experiments with replicates sample in each experiment are shown.

Fig 15

Expression of various cytokines on day 5 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control NV/HCV.

P2X4 in induction of extracellular matrix (ECM) proteins

A significant increase was observed in levels of ECM markers, elastin and laminin on day 5, 9 of post infection in HCV infected cells in presence of P2X4 than the control NV/HCV cells. Results were obtained from 3 individual experiments with replicates sample in each experiment are shown. Figs .

Discussion

Different isoforms of P2X receptors are expressed widely in the body [25-30]. These receptors have known to have their role in inflammation and fibrosis in different organ systems caused by a number of external stimuli. However, role of P2 receptor in HCV induced inflammation and fibrosis is still under investigation.

There has been a unique pharmacological profile already observed in the brain tissue particularly for P2X4 receptor [31]. A variety of previous reports have supported evidence of presence of P2X4 isoform in liver cells that have important role in regulation of functions such as regulation of hepatic glycogen metabolism in vivo mouse models [32], in modulating biliary secretion in rat cholangiocytes. In our previous study, a significant up regulation or activation in gene expression of P2X4 in response to HCV structural proteins E1E2 showed these receptors could be of great importance in HCV pathogenesis [33-35]. So, these observations prompted for the establishment of a cell culture-based system stably expressing the full length P2X4 protein and vector alone (control) so that the role of P2X4 in regulation of genes involved in inducing liver fibrosis could be investigated. Cell lines stably expressing P2X4 proteins and expression vector alone (control) were established.

Buck et al. have successfully established the in vitro replication of HCV RNA after infecting the human HCV sera to human hepatocytes cultures. Furthermore, they detected different levels of structural and nonstructural proteins of virus in infected cultures after 24 hours of infection [36]. In present study, stable cell lines were infected with human HCV RNA (local isolates with genotype 3a) so that role of P2X4 could be studied in the presence of whole HCV genome (HCV replicating RNA). Four different groups P2X4/NR (293T stably expressing P2X4 protein and inoculated with control or normal human sera), NV/NR, (293T stably transfected with vector alone or null vector and inoculated with control or normal human sera), P2X4/HCV (293T stably expressing P2X4 protein and infected with human HCV sera) NV/HCV (293T stably transfected with vector alone or null vector and infected with human HCV sera) were established and successfully maintained till day 5 and day 9 post infection. Cells infected with HCV sera showed replicating HCV RNA till day 9 of infection as shown in the Figs 11 and 12.

Fig 11

Expression of P2X4 gene at day 5 of post infection with HCV.

All values are expressed as mean ± SEM, *P≤0.05 vs. control P2X4-NR cells.

Fig 12

Expression of P2X4 gene at day 9 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control P2X4-NR cells.

P2X4 receptor have shown a significant increase in HCV infected cells (P2X4/HCV) to compare with P2X4 cells in the absence of HCV (P2X4/NV cells). Previous studies have shown that expression of HO-1 increases in response to an acute injury in hepatocytes [37-41].

There was robust up regulation of HO-1 in P2X4 cell line in presence of HCV as compared to all other groups. The present study is in concordance with these reports that HO-1 gene expression was significantly up regulated in HCV infected cells. Whereas, Cu/ZnSOD gene expression was found significantly down regulated in HCV infected P2X4/HCV cells in comparison with NV/HCV group which is HCV infected without P2X4 Figs 13 and 14. The first antioxidant defensive enzymes in the detoxification of oxygen free radicals are the SODs (MnSOD and Cu/ZnSOD). SODs catalyse the dismutation of superoxide radicals into hydrogen peroxide and molecular oxygen [42, 43]. Levent et al had examined the serum level of CuZnSOD in chronic HCV patients. They observed that Cu/ZnSOD was significantly lower in erythrocytes of patients with chronic HCV compared with the control [44]. Findings of Elchuri et al provide ample evidence that Cu/ZnSOD deficiency in the liver leads to damage to DNA, proteins, and lipids [45]. Long term reduced level of Cu/ZnSOD can be both a potent initiator and promoter in hepatocarcinogenesis. They showed that long term effects of CuZnSOD deficiency in mutant mice lead to widespread oxidative DNA damage which leads to cell injury, cell death, perturbance in cellular homeostasis and eventually to the development of hepatocellular carcinoma in more than 70% Sod1-/- mice [45]. Different isoforms of P2X receptors have been identified in different cancer types, in both primary samples of human cancer tissue and human cell lines. The isoforms of P2X receptors mediate proliferation, differentiation and apoptosis [30]. The findings of present study suggest that P2X4 receptors seem to be contributing to HCV induced oxidative stress which is associated with low level of key antioxidant Cu/ZnSOD.

Fig 13

Expression of antioxidants on day 5 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control NV/HCV.

Fig 14

Expression of antioxidants on day 9 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control NV/HCV.

Surprisingly, on the other hand, P2X4 exhibited a positive impact as the level of HO- 1was significantly upregulated in P2X4/HCV infected cells. Liver cells respond to the acute injury with an elevated expression of HO- 1 [40]. It has been reported in literature that induction of HO-1, by chemical inducers or selective overexpression, is cytoprotective both in vitro and in vivo [40]. In this study P2X4 appears to augment the antioxidant response to acute injury in HCV infected cells by upregulating the gene expression of HO-1. There are no previous reports in literature indicating the involvement of P2X receptors in regulation the antioxidant enzymes and the present study identifies the significant role of P2X4 receptor in regulation of key antioxidants in response to HCV replicating RNA in vitro. Clinical results on radiation-induced fibrosis have shown that CuZnSOD significantly reduces the expression of the TGF-β, both at the mRNA and protein leves [46]. Consistent with this, significant upregulated CuZnSOD expression in NV/HCV cells showed a significant reduced TGF-β expression in this group as depicted in Figs 13 and 14.

Transforming growth factor-beta (TGF-β) is reported to be the main profibrotic factor in liver fibrosis [47-49]. It has been reported in literature that TGF-β was upregulated in HCV infection and induces matrix accumulation by activating hepatic stellate cells [49]. Previous studies provide evidences that among the different cellular pathways involved in fibrosis, the transforming growth factor-β1 (TGF-β1) signaling plays a critical role. TGF- β is a key regulator for extracellular matrix proteins (ECM) metabolism and functions as an autocrine and a paracrine mediator. The impact of TGF- β on liver fibrosis has been well documented in TGF-β knockout mouse model [50], in attenuating the development of liver fibrosis by using soluble type II TGF-β receptor [51].

Activation of P2X7 receptors (isoform of P2X receptors) increased TGF-β mRNA expression in type-2 rat brain astrocytes [27]. Goncalves et al studied the role of P2X receptors in inflammatory and fibrogenic response in the kidneys of unilateral ureteral obstruction (UUO) [52]. They used P2X7 knockout mice (-/-). They found significant reduced TGF-β expression in UUO P2X7 (-/-) mice comared to UUO WT mice. In this study, TGF-β gene expression was also analysed in all 4 groups. It is noteworthy that profoundly increased gene expression of P2X4 in HCV infected cells (P2X4/HCV) is accompanied with significantly elevated expression of TGF-β in P2X4/HCV cells compared to all other groups as shown in Figs 15 and 16. Thus, it demonstrates the involvement of P2X4 in the production of this profibrotic cytokine in P2X4/HCV infected cells.

Fig 16

Expression of various cytokines on day 9 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control NV/HCV.

Previous studies provide evidences that angiotensin II (Ang II) plays a pivotal role in the progression of chronic liver diseases, i.e., liver fibrosis and hepatocellular carcinoma. Previous reports demonstrate that Ang II is found to be frequently activated in HCV patients [53]. The present study showed an increased Ang II expression in HCV infected cells, NV/HCV and P2X4/HCV (Figs 13 and 14). Paizis et al reported that the blockage of Ang II inhibits TGF-β expression in experimental liver fibrosis [54]. Findings of Paizis et al were confirmed by Bataller et al, showed that Ang II increased TGF-β1 mRNA expression in cultured rat hepatic stellate cells [55]. Livers from bile duct-ligated rats infused with Ang II showed increased TGF-β content [56]. The current study is in agreement with these previous observations and reveals a significantly elevated TGF-β mRNA expression in P2X4/HCV group on day 9 post infection along with profound increased gene expression of Ang II as shown in Further, the present study demonstrates significant role of P2X4 in regulation of Ang II. A dramatic increase was observed in gene expression of Ang II in NV/ HCV cells comared to P2X4/HCV cells on day 5 post infection (shown in Figs 15 and 16). However at day 9 post infection a remarkable significant increase was observed in gene expression of Ang II in P2X4/ HCV cells in comparison with NV/HCV cells. This increase was accompanied with a significant elevated TGF-β gene expression in P2X4/ HCV group in comparison to NV/HCV group. It is noteworthy here that the significant increase in TGF-β mRNA expression along with significant raised level of Ang II in HCV infected cells is associated with the presence of P2X4. Thus the present data suggests the possible role of P2X4 (purinergic signaling) in upregulation of this important vasoactive, profibrotic cytokine, Ang II in HCV infected cells. There is no data already available in literature concerning the involvement of P2X receptors in the gene expression of Ang II. Thus the current study identifies the additional role of P2X receptors to fibrogenic responses.

TNF-α is a potent pro-inflammatory cytokine, having multiple biological activities [57]. The level of TNF-α was found to be elevated in patients with cirrhosis or acute/chronic hepatitis when compared with healthy patients in different studies [58, 59]. Increased level of TNF-α is associated with hepatic inflammation, necrosis and hepatic failure [60, 61]. In a study by Batellar et al Ang II infusion in rats undergoing biliary fibrosis, increased serum levels of Ang II and bile duct ligation-induced liver injury. It augmented the hepatic concentration of inflammatory proteins (TNF-α, IL-1β) [56]. In this study a significant increase in gene expression of TNF-α and Ang II in P2X4/ HCV cells was observed in comparison to NV/HCV cells on day 9 post infection. Liver inflammation is the hallmark of early-stage liver fibrosis and eventually results in activation of hepatic stellate cell (HSC) and extracellular matrix (ECM) deposition [62].

In addition the present study demonstrates that the significant increase in TNF-α gene expression along with significantly elevated level of Ang II in P2X4/HCV infected cells is coupled with elevated expression of P2X4 (Figs 15 and 16). Surprisingly, a significantly increased TNF-α gene expression was observed in P2X4/NR cells on day 5 post infection in comparison with other groups, NV/NR cells, P2X4/HCV cells, NV/HCV cells as shown in Figs 15 and 16.

This is consistent with previous studies which illustrate the involvement of P2X receptor activation (P2X7) in inflammation [63] and elimination of intracellular pathogens [64]. Several studies have addressed the role of P2X receptors activation on the mechanisms of immunological and inflammatory response of Leukocytes and monocytes/macrophages [65]. No previous reports are found in literature demonstrating the involvement of P2X4 isoform of P2X receptors in release of inflammatory cytokine. The current study identifies the role of P2X4 isoform of P2X receptors (P2X4) in upregulation of pro inflammatory cytokine TNF-α. Leptin, an adipocytokine is documented to regulate liver fibrogenesis. High serum leptin concentrations are present in chronic HCV patients than controls [66] and is associated with severity of fibrosis [67]. In contrast, another study revealed that there is no correlation between leptin level and fibrosis in chronic HCV patients [67]. The present study observed an ultered gene expression of leptin in all groups, NV/NR cells, P2X4/NR cells, P2X4/HCV cells and NV/HCV cells on day 5 and day 9 post infection as shown in Figs 15 and 16.

The current study indicated a significant increase in gene expression of elastin and laminin (extracellular matrix markers) in P2X4/HCV cells compared to NV/HCV cells on day 9 HCV infection as shown in Figs 17 and 18. The significant increase in mRNA expression of elastin and laminin in the presence of P2X4 in response to HCV infection suggests the involvement of P2X4 in this regard. The role of P2X receptors in matrix deposition in response to HCV induced inflammation has not been reported in literature previously.

Fig 17

Expression of ECM markers on day 5 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control.

Fig 18

Expression of various cytokines on day 9 of post infection.

All values are expressed as mean ± SEM, *P≤0.05 vs. control NV/HCV.

Thus, the present study is the first one to identify the involvement of P2X receptors (P2X4) in upregulation of gene expression of extracellular matrix markers. The results of this study suggested the involvement of P2X4 receptors in HCV induced oxidative stress, inflammation, and fibrogenic responses and matrix deposition. This study provides important clues to the mechanisms involved in the progression of chronic liver disease with the potential of hepatocellular carcinoma (Fig 19).

Fig 19

Schematic overview of the purinergic signaling in the presence of HCV.

HCV interrupts purinergic signaling Increased ATP in the extracellular mileu increases oxidative stress and fibrogenic cytokines and ECM cytokines leading towards fibrosis.

Sequence homology of full length P2X4 sequence.

(1.7-kb) (Rattus norvegicus), kindly provided by Dr. Ishtiaq Qadri with reported sequence (Sequence chromatogram not shown).

(PDF)

Click here for additional data file.

Representative chromatograms of sequence of transfected P2X4 receptor amplified from stable cell line (293T/P2X4).

(PDF)

Click here for additional data file.

Sequence homology of transfected P2X4 (stable cell line 293T/P2X4) with sequence kindly provided by Dr.

Ishtiaq Qadri along with full length gene P2X4 (1.7-kb).

(PDF)

Click here for additional data file.

293T/P2X4 cell line experimental and control in presence of G418 (a, b.

100X), 293T/NV cell line experimental and control in presence of G418(c, d. 100X). 293T/P2X4 cell line and 293T/NV cell line demonstrated better resistance to G418 in comparison to both control cell lines resulting in increased proliferation of growth.

(PDF)

Click here for additional data file.

(PDF)

Click here for additional data file.

(ZIP)

Click here for additional data file.

29 Nov 2021

14 Feb 2022

Journal Requirements

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming?

Authors’ response.The manuscript and file names have been updated according to the style requirements of PLOS ONE.

2. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Authors’ response .We are thankful your suggestion. All the references has been cross verified. There are no such references included that are retracted.

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

Authors’ response. Subject study was financed by student research funds provided to student by University as well as Higher Education Commission (HEC) of Pakistan.

Thank you for stating the following in the Acknowledgments Section of your manuscript: "Higher Education commission Pakistan for financial support."We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: "no”. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript."Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

Authors’ response. All the funding was provided to student byUniversity as well as Higher Education Commission (HEC) of Pakistan for smooth and successful completion of current study.

4. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

Authors’ response. All data that is included in this manuscript has been taken from the doctoral dissertation of first and corresponding author SobiaManzoor. Furthermore, corresponding author and her parent institution where the major part of subject study was conducted (Centre of Excellence in Molecular Biology, University of The Punjab, Lahore, Pakistan) have record of all data of current study on Laboratory data recording books as well as in the doctoral dissertation of first and corresponding author, SobiaManzoor.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

6. Authors’ response. Any part of the data that is presented in this manuscript has never been published in any public repository.

7. Please amend either the abstract on the online submission form (via Edit Submission) or the abstract in the manuscript so that they are identical

Authors’ response .We are thankful for your suggestion. We will incorporate the changes in revised manuscript.

8. Please upload a copy of Figure 34 and 35 to which you refer in your text on page 15. If the figure is no longer to be included as part of the submission please remove all

Authors’ response.We appreciate your suggestion and the said changes have been incorporated.

Response to Reviewers’ Comments

Reviewer #1: Study entitled “P2x4 Receptors in Presence of Successfully Replicating HCV Mediate Induction of Antioxidants, Cytokines and ECM Transcripts; An Insight into role of P2X4 in fibrosis” shows a notable effort by Manzoor et al., towards understanding the molecular mechanmisms underlying the HCV inection and pathogenesis and pathophysiology of P2X receptors. It is an exciting and new insight in the field of HCV research. It demonstrates the involvement of the P2X4 receptors in HCV induced pathogenesis. This study opens a new insight into HCV associated pathologies and would be a good and useful addition in existing literature. This study could be published after incorporating the suggested changes.

Major Points:

1. As there are different purinergic receptors, what was the reason to select only P2X4? And why different P2X receptors were not targeted for the determination of their role in liver fibrosis? Please address and also incorporate in manuscript.

Author’s Response: As the study published by SobiaManzooret al, 2011 it was alreadyestablished in our lab that the gene expression of identified isoforms of P2X receptors in presence of HCV structural proteins E1E2, Huh-7/E1E2 cell line (stably expressing HCV structural proteins E1E2). These findings provide molecular evidence that P2X receptors are also present in human liver cells (Huh-7 cell line), and indicated that P2X receptors respond towards HCV structural proteins E1E2 of genotype 3a, P2X4 is one of the most responsive isoforms.

2. Why did you usedthe HEK for the transfection of the P2X4 clone? Why not be tested in any other cell line?

Author’s Response: All other cell lines fully express P2X4 receptors whereas HEK-293 cells have least expression of purinergic receptors so there was need of cell line that do not already express the receptors to avoid the false positive results.

3. As I went through, I didn’t find any oxidant levels measured in the findings. Would you explain the reason for that?

Author’s Response: As the antioxidant levels were measured and it’s already reported in various findings that oxidant levels are increased during HCV infection. Muhammad Y.Sheikh ; 2008 et al.

Minor Points

The text contains several orthographic and grammatical errors, including missing spaces (often between numbers and the corresponding unit of measure) and incomplete sentences.

1. Page 23, Kindly explain the abbreviations (cy3 and fam) in the formula.

Author’s Response:Fluorescence is observed in Real Time on the Cy3 channel for HCV RNA and FAM channel for Internal Control.

2. Page 17, Rephrase the first sentence.

Author’s Response:We are thankful for your suggestion. The said changes have been incorporated.

3. Page 17, last paragraph It seems that day may not agree in number with other words in this phrase.

Author’s Response: We appreciate your response for the suggested changes. All the changes have been incorporated and highlighted in the manuscript.

4. Page 19, replace complete medium

Author’s Response: The said changes have been incorporated

5. Page 21, Rephrase the sentence in the first paragraph

Author’s Response: Sentence has been rephrased.

6. Page 22 explain the term BCIP/ NBT solution

Author’s Response:5-bromo-4-chloro-3-indolyl-phosphate), 4-nitro blue tetrazolium chloride

7. Explain heading 4.5, 4.6 and 4.7 in the results section.

Author’s Response: This was an appropriate suggestion that have been incorporated.

8. Correct spelling mistakes in the overall manuscript.

Author’s Response: All the spelling mistakes have been changed.

Reviewer #2: The study is an effort towards finding the role of P2X4 receptors in the presence of HCV. It explains how HCV plays a role in the regulation of key antioxidant enzymes (HO-1, Cu/ZnSOD) in the induction of proinflammatory cytokine (TNF-α), major profibrotic cytokine (TGF-β) and vasoactive cytokine (angiotensin II) through these receptors. Study also reveal the role of the P2X4 receptor in increasing the expression of extracellular matrix proteins in the presence of HCV. The current study is a good attempt to decipher the involvement of secondary signaling in HCV pathogenesis. However, authors are required to address the following points before formal acceptance of the manuscript.

Title:

Reconsider the tile as it isn’t suitable. There is a lot of mistakes in it. It can be changed to make the manuscript catchy.

1. Abstract

Well written.

2. Introduction

a- Reconsider the typographic and grammatically changes in the manuscript.

Author’s Response: All the typographic changes have been addressed.

b- In the introduction last paragraph authors have discussed the two vectors and HCV sera. Can they clear it which two vectors as they have only discussed only P2X4 vector?

Author’s Response:The line has been rephrased.it’s not about two vectors the word both vectors refer to the vector and sera.

c- Why they need to do over expression studies by inducing the vector of gene externally when they want to see the effect of HCV sera on the expression of P2X4 protein?

Author’s Response: As HEK cell line do not express purinergic protein, the basic idea of the study was to see the effect on P2X4 receptors in the presence of HCV.

d- Is there any reference available of HCV replication in H293T cells?

Author’s Response: There is no reference available for the replication of HCV in HEK 293 cells. Present study reports the in vitro replication of HCV in HEK 293 cells first time in literature. Established evidence suggested the replication of HCV in peripheral blood mononuclear cells (PBMCs) besides hepatic cells in patients chronically infected with HCV.

3. Material and methods

a- Brief the transfection method and selection of stable cell lines. Readjust sample collection and sera inoculation.

Author’s Response: The authors acknowledge the fact that methodology should be easily understood by the reader hence necessary changes have been made where required.

b- Can authors specify any specific reason to clone the gene from one mammalian expression vector (pCR3.1) to another expression vector (pcDNA3.1)?

Author’s Response:pcDNA3.1 is constructed to study the expression of gene of interest in mammalian expression system. That’s why gene of interest, P2X4 was sub-cloned from vector(pCR3.1) toanother expression vector (pcDNA3.1) .

c- In heading 3.7., Line ‘Following primers were used for PCR amplifications from cDNA.” there is no primer list given provide them.

Author’s Response: This suggestion is appropriate, as list was referred in the supplementary files. The line has moved from the section.

d- In heading 3.8, line, ‘Amplified product of expected size was obtained” what was the expected size? Mention it.

Author’s Response:We are grateful to you for pointing out the error. The line has been moved as the size has been discussed in the result section.

e- In heading 3.10, what was protein isolation procedure? What passage or days post transfection protein was isolated? Mention it.

Author’s Response:Since it was stable expression not a transient expression. Protein was isolated after 96 hours of post transfection.

f- What was the range of viral titer used for inoculation experiments?

Author’s Response:

g- Cite the tables and figures in the main text where first used.

Author’s Response:we are thankful for your suggestion. All the figures have been incorporated at right place.

h- Please mentioned which HCV genotype serum was used?

Author’s Response: The genome used was HCV genotype 3a.

4. Results

a. Why was there no expression checked for fibrotic markers MMP-9?

Author’s Response: Your suggestion is appropriate. As we measured other fibrotic genes but it can be incorporated in our future studies.

b. Why was cell volume regulation neglected in the presence of HCV?

Author’s Response: We appreciate your thoughtful suggestion, but it was out of scope of our study’s design. Our study design was focused to investigate the role of P2X4 in HCV associated liver fibrosis only.

c. Does P2X7 receptor was not assessed for its role in liver fibrosis?

Author’s Response: P2X4 receptor role was more prominent and significant while P2X7 studies have been done for their presence in PBMCs in the blood of chronic HCV patients. (World J Gastroenterol. 2003 Feb 15; 9(2): 291–294. Published online 2003 Feb 15. doi: 10.3748/wjg.v9.i2.291 PMCID: PMC4611331).

d. Rewrite the figure legends and improve them as they lack explanation.

Author’s Response: The suggestions incorporated in the respective section.

e. Why was angiotensin selected as a cytokine?

Author’s Response: The current study included fibrogenic cytokines TGF, angiotensin and leptin.

f. Elaborate the results. If authors are mentioning it is significant, they should write either fold change or level of significance.

Author’s Response: The said changes have been incorporated.

g. Quality of figures need to be improved. The text written in Fig 1b is not readable.

Author’s Response: we appreciate your suggestion and have been incorporated.

h. Figure 1c, Figure 2 and 3 the labeling of the gel pics is not visible. Authors need to improve it.

Author’s Response: We appreciate your suggestion. The said changes have been incorporated.

i. The gel pictures where expression is measured through Real Time PCR should be provided as supplementary material not in main article.

Author’s Response: All the said suggestions have been incorporated.

j. Authors did inoculation experiment in stably expression P2X4 gene. Are authors performed any expression studies in non-stable cell line and effect of P2X4 gene in inoculation experiment.

Author’s Response:No, current study was designed to evaluate whether P2X4 plays any role in HCV associated liver fibrosis. For this purpose, a cell line with stable expression of P2X4 was the requirement.

k. In western blot experiment authors are encouraged to measure the expression through any software like Image J etc.

Author’s Response:We appreciate your suggestion. Since the hypothesis of the study was to investigate the probable role of P2X4 in HCV associated pathogenesis (Fibrosis) in the presence of P2X4 only. That’s why we did not estimate the expression of P2X4.

l. Remove typo and grammatical mistakes throughout the document.

Author’s Response: All the said changes have been incorporated.

Conclusion: If authors give a pictorial form of their conclusion section it would be clearer.

3 Mar 2022

P2X4 receptors mediate induction of antioxidants, fibrogenic cytokines and ECM transcripts; in presence of replicating HCV in in vitro setting:  an insight into role of P2X4 in fibrosis

PONE-D-21-33744R1

Dear Dr. Sobia Manzoor

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Usman Ali Ashfaq, PhD

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Acceptable for publication in plos one in current form

Reviewers' comments:

5 Apr 2022

PONE-D-21-33744R1

P2X4 receptors mediate induction of antioxidants, fibrogenic cytokines and ECM transcripts; in presence of replicating HCV in in vitro setting:  an insight into role of P2X4 in fibrosis

Dear Dr. Manzoor:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Usman Ali Ashfaq

Academic Editor

PLOS ONE

Table 1

List of Primer sequences for cloning.

Primer Name	Primer Sequence: 5’-3’ Sequence
PX4T- F	CGTGGCGGACTATGTGATT
PX4T-R	GTGATGTTGGGGAGGATGTTC
T7	GTAATACGACTCACTATAGGG
BGH	TAGAAGGCACAGTCGAGG

Table 2

List of primers for the selected genes.

S. No.	Primer ID	Primer Sequence: 5’-3’ Sequence
1	Angiotensin II-F	CACGCTCTCTGGACTTCACA
2	Angiotensin II-R	GCTGTTGTCCACCCAGAACT
3	TGF- β1-F	TATCGACATGGAGCTGGTGA
4	TGF-β1-R	TGGGTTTCCACCATTAGCAC
5	HO-1-F	AGGTCATCCCCTACACACCA
6	HO-1-R	GTTGGGGAAGGTGAAGAAGG
7	Leptin-F	ACGTGCTGGCCTTCTCTAAG
8	Leptin-R	ACCTGGAAGCCAGAGTTCCT
9	Cu/Zn SOD-F	GGGGAAGCATTAAAGGACTG
10	Cu/Zn SOD-R	AATAGACACATCGGCCACAC
11	TNF -α-F	TCCTTCAGACACCCTCAACC
12	TNF -α-R	CAGGGATCAAAGCTGTAGGC
13	GAPDH-F	ACCACAGTCCATGCCATCAC
14	GAPDH-R	TCCACCACCCTGTTGCTGTA
15	ELAS–F	CAGGAGTTGGTGGCTTAGGA
16	ELAS- R	CTGGAGCCTTGGGCTTAACT
17	LAM- F	CACCAAGTCCTGTCACCTGT
18	LAM- R	CTGGTGTGGAACTTGAGACG