Xi-Hui Du1, Dongmei Wu2, Heng Kang3, Hanchen Wang4, Nan Xu4, Tingting Li4, Keliang Chen4. 1. College of Life Sciences, Chongqing Normal University, Chongqing, 401331, China. duxihuimorel@outlook.com. 2. Biotechnology Research Institute, Xinjiang Academy Agricultural Reclamation of Sciences, Shihezi, 832000, China. 3. Institute of Applied Mycology, Huazhong Agricultural University, Wuhan, 430070, Hubei, China. 154889434@qq.com. 4. College of Life Sciences, Chongqing Normal University, Chongqing, 401331, China.
Correction to: IMA Fungus (2020) 11:4 10.1186/s43008-020-0027-1
Following the publication of the original article (Du et al. 2020), we were notified of two mistaken pairs of primer sequences in Table 2, as shown below.Incorrect sequence:Corrected sequence:EMAT1–1L: TGAGTCCGTTATGATTCTGGEMAT1–1R: GGACCATTCGCTTTCTCATAEMAT1–2L: GATATGCTCACCAACCGTAAEMAT1–2R: TACGATCGAATAATGGCTCCThe original article has been corrected.