Literature DB >> 35588168

Distribution characteristics of the sabA, hofC, homA, homB and frpB-4 genes of Helicobacter pylori in different regions of China.

Mengyang Fang1,2, Zhijing Xue2, Lihua He2, Yuanhai You2, Yanan Gong2, Dongjie Fan2, Lu Sun2, Kangle Zhai2, Yaming Yang2, Jianzhong Zhang1,2.   

Abstract

BACKGROUND: Helicobacter pylori (H. pylori) encodes numerous outer membrane proteins (OMPs), with considerable geographic heterogeneity and related to different clinical outcomes. This study aimed to investigate the distribution characteristics of five important OMP genes (sabA, hofC, homA, homB and frpB-4) in different regions of China. MATERIALS AND
METHOD: A total of 266 strains were isolated from 348 stomach biopsy specimens in Shandong, Guangxi, Heilongjiang, Hunan, and Qinghai provinces. The presence of sabA, hofC, homA, homB and frpB-4 gene was detected by polymerase chain reaction (PCR) from H. pylori genomic DNA.
RESULTS: Among the strains in five regions, the prevalence of frpB-4 was 100% and that of hofC was 97.7%. The prevalence of homB in the isolates from Qinghai (45.5%) was significantly lower than that in Shandong (75.3%), Guangxi (76.9%) and Hunan (69.6%) (P<0.05). The frequency of homA in Shandong (30.1%) was significantly lower than in Guangxi (57.7%) and Qinghai (63.6%) (P<0.05). The prevalence of the sabA gene in Shandong, Guangxi, Heilongjiang, Hunan and Qinghai provinces was 21.9%, 59.7%, 45.9%, 52.2%, and 18.2%, respectively (P<0.05). The sabA "on" status was significantly more frequent in isolates from Guangxi (46.8%), Heilongjiang (37.8%), and Hunan (47.8%) than Qinghai (3.0%) (P<0.05). The presence of homA and sabA genes may be negatively correlated with the development of gastritis. There was no significant association between the frpB-4, hofC, homB gene and clinical outcomes.
CONCLUSION: The prevalence of homA, homB, and sabA genes and the sabA "on" or "off" status have significant geographical differences among five provinces in China. The presence of homA and sabA genes may be protective factors of gastritis.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35588168      PMCID: PMC9119684          DOI: 10.1371/journal.pone.0268373

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Helicobacter pylori (H. pylori) is a Gram-negative, helix-shaped, microaerophilic, flagellated bacterium, which colonizes the mucus layer of the gastric epithelium [1]. H. pylori infection leads to peptic ulcer disease (PUD) in 15%-20% of the infected population, dyspepsia in 5%-10% of the infected population, and gastric cancer (GC) or mucosa-associated lymphoid tissue (MALT) lymphoma in 1% of the infected population [2]. While the exact molecular mechanisms by which H. pylori infection induces a severe clinical outcome have not yet been clearly elucidated, they are thought to involve various elements, including host genetic and environmental factors, as well as certain bacterial virulence genes [3]. The outer membrane is the outer barrier of Gram-negative bacteria, which consists of two highly asymmetric layers: the inner monolayer contains only phospholipids and the outer monolayer consists mainly of outer membrane proteins (OMPs) that are resistant to the external environment [4, 5]. About 4% of H. pylori genome encodes OMP [6]. According to their functions, they can be divided into five homologous gene families [6]: Hop (outer membrane porins) and Hor (Hop-related proteins) proteins, Hof (H. pylori OMP) proteins, Hom (H. pylori outer membrane) proteins, iron-regulated OMPs, and efflux pump OMPs families. HopP belongs to the Hop family, also known as sialic acid-binding adhesion (SabA). SabA specifically binds to sLex antigen on gastric mucosa epithelial cell and plays an important role in H. pylori colonization and inflammation mediation [7, 8]. SabA expression level can quickly adapt to changes in the human gastric environment by “on” or “off”. The “on” status of sabA was negatively correlated with the degree of gastric acid secretion, suggesting that the pH or antigen expression of atrophic mucosa may affect the expression of SabA. HofC is a member of a paralogous Hof family which consists of eight members. HofC encodes a non-thermal denatured protein with 528 amino acid residues, which has a hydrophobic C-terminal sequence motif of many outer membrane proteins [6]. HofC proteins are involved in passive diffusion and adhesion of cations such as antibiotics [9]. The hofC gene is highly variable in global strains and shows many America-differentiated SNPs and region-differentiated SNPs within the Americas [10]. Hom family is a small OMP family composed of HomA, HomB, HomC, and HomD. The homA gene, which presents more than 90% identity to homB [6]. Interestingly, homA was more frequently found in strains isolated from non-ulcer dyspepsia (NUD). In vitro, HomB promotes the secretion of the interleukin-8 (IL-8) and increases H. pylori adhesion. The homA and homB sequences have considerable geographic heterogeneity [11]. The prevalence of the homA and homB genes is different in strains all over the world, and there are significant differences between East Asian and Western strains [12]. H. pylori contains six iron-regulated OMPs. These OMPs can be divided into two groups based on homology. One of them is homologous of the Neisseria gonorrhoeae ferric enterobactin receptor FrpB, encoded by frpB-1, frpB-2/3, and frpB-4 [6, 13]. A gene containing multiple highly differentiated SNPs is frpB-4, encoding for the first TonB-dependent nickel transport system across a bacterial outer membrane [14]. Studies have shown that the protein encoded by frpB-4 will show specific amino acid changes in different regions, and these changes may affect the transport of nickel, thereby affecting the activity of urease [10]. China is a country with a vast territory and a large population. The five provinces selected in this study cover the eastern (Shandong), northern (Heilongjiang), western (Qinghai), southern (Guangxi), and central (Hunan) regions of China. The current infection rate of H. pylori in China is about 40–50%. H. pylori is one of the causes of gastric cancer (GC), which is the second most common cancer in China. Shandong (30.50/100000) and Qinghai (48.76/100000) provinces are considered to have a high incidence of GC, while Heilongjiang (15.53/100000), Guangxi (19.68/100000) and Hunan (10-20/100000) provinces have a relatively low incidence of GC [15, 16]. Meanwhile, the economic development level, living environment and dietary habits of these selected regions are quite different, which is more helpful for us to analyze the diversity of H. pylori distribution in China. At present, studies on OMP pay more attention to its correlation with diseases and other mechanisms. Only a few studies have analyzed the differential characteristics of H. pylori OMP coding genes in different regions. Therefore, we studied the distribution characteristics of sabA, hofC, homA, homB, and frpB-4 in different regions of China and their association with clinical outcomes.

Materials and methods

Study subjects

A total of 266 patients were included in this study, including 73 cases in Weihai, Shandong province, 77 cases in Nanning, Guangxi province, 46 cases in Yiyang, Hunan province, 37 cases in Jiamusi, Heilongjiang province, and 33 cases in Haidong, Qinghai province, as previously reported [17]. Endoscopic examination showed PUD in 15 patients, chronic superficial gastritis (CSG) in 81 patients, chronic erosive gastritis (CEG) in 87 patients, chronic atrophic gastritis (CAG) in 42 patients. Their gastric biopsy specimens were obtained during upper gastrointestinal endoscopy with informed consent. This study was approved by Ethical Committee of National Institute for Communicable Disease Control and Prevention Chinese Center for Disease Control and Prevention (approval No. ICDC-2013001).

H. pylori culture and identification

The strains were obtained from patients with varying gastric diseases as diagnosed by routine endoscopy and biopsy sampling. H. pylori strains were cultured on Karmali agar base plates supplemented with 5% defibering sheep blood and 1% combined antibiotics. The plates were grown at 37°C under microaerobic conditions (5% O2, 10% CO2 and 85% N2) approximately for 3–5 days. The organisms were identified as H. pylori based on colony morphology and Gram staining, as well as positive reactions in oxidase, catalase and urease biochemical tests, and also subsequently the results of H. pylori-specific polymerase chain reaction (PCR). All isolates were maintained at -80°C in sterile brain heart infusion (BHI) broth with 20% glycerol.

DNA isolation and PCR amplification

Genomic DNA was extracted by QIAamp DNA Mini Kit according to the manual instruction. The DNA was stored at -20°C for molecular studies. All PCR amplification reactions were performed by standard methods in a final volume of 25 μL containing forward and reverse primers (0.2 μM each), 2 ng/μL DNA template, 12.5 μL 2×EasyTaq PCR SuperMix (Transgen, China) and 9.5 μL nuclease-free water. The PCR protocol (35 cycles) included a denaturing step at 94°C for 30 sec, annealing at 55, 56, 55, 55 and 60°C for hofC, frpB-4, homB, homA and sabA, respectively, for 30 sec, and extension at 72°C for 1 minutes followed by a 10-minute extension step at 72°C. The sabA gene was detected by PCR, which was additionally sequenced to define its functional status as either “on” or “off”. The nucleotide sequences of the sabA gene were submitted to China National Microbiological Data Center. The accession numbers are NMDCN0000R8M to NMDCN0000RBU. The functional status of sabA is regulated by the number of CT-dinucleotide repeats. The information of the PCR primer for each amplicon is summarized in Table 1. PCR products were then electrophoresed for 35 min at 130 Volt on 1.5% agarose gel in the presence of Gelstain and illuminated by the gel documentation system (Bio-Rad, USA).
Table 1

Primers used for PCR amplification of hofC, frpB-4, homB, homA, and sabA genes.

GenePrimerprimer sequence (5’→3’)Product size (bp)
hofC hofC-F GCTTGCCACTRTTGTTCACT 907
hofC-R CGACCGTATTCAGCGTTATT
frpB-4 [18]frpB-4-F AGCCGTCTCTTAAGGGTAAC 407
frpB-4-R TCGCTATTGCTTGGATCTTG
homB [19]homB-F AGAGGGTGTTTGAAACGCTCAATA 161
homB-R GGTGAATTCTTCTGCGGTTTG
homA [19]homA-F AGAGGGTGTTTGAAACGCTCAATA 128
homA-R GGTGAATTCTTCTGCGGTTTG
sabA [20]sabA-F GTGGATCCCTTTAAGGAACATTTTATGAAAA 600
sabA-R GGAATTCGGTTAGGATAAAAGCGCAAAGATTGT

DNA sequencing

Samples without target genes of sabA were discarded at the identification stage of the product. The positive PCR products of isolates were purified and then the DNA samples were submitted and performed as a service by the Beijing Genomics Institute for the sequence of sabA genes. The sabA gene resulting PCR products were used for DNA sequencing to determine the number of CT-dinucleotide repeats.

Statistical analysis

Statistical analysis was performed by chi-squared test for independence. All data analysis were performed using the SPSS software version 25. All tests of significance were two-tailed with a P-value<0.05 taken as significant.

Result

A total of 266 H. pylori isolates from five geographic regions of China were obtained, of which 73 isolates were from Shandong, 77 from Guangxi, 46 from Hunan, 33 from Qinghai and 37 from Heilongjiang. The hofC, frpB-4, homB, homA and sabA genes were detected by PCR in all isolates and the results were summarized in Table 2.
Table 2

Distribution of OMP genes among 267 H. pylori-positive patients with different geographic regions.

GenetypesShandongGuangxiHeilongjiangHunanQinghaiTotalχ2P-value
(n = 73)(n = 77)(n = 37)(n = 46)(n = 33)(n = 266)
hofC + 70 (95.9)*77 (100)37 (100)45 (97.8)31 (93.9)260 (97.7)5.9370.204
hofC - 3 (4.1)001 (2.2)2 (6.1)6 (2.2)
frpB-4 + 73 (100)77 (100)37 (100)46 (100)33 (100)266 (100)
homB + 55 (75.3)59 (76.6)23 (62.2)32 (69.6)15 (45.5)184 (69.2)12.8700.012
homB - 18 (24.7)18 (23.4)14 (37.8)14 (30.4)18 (54.5)82 (30.8)
homA + 22 (30.1)44 (57.1)17 (45.9)19 (41.3)21 (63.6)123 (46.2)15.7660.003
homA - 51 (69.9)33 (42.9)20 (54.1)27 (58.7)12 (36.4)143 (53.8)
sabA + 16 (21.9)46 (59.7)17 (45.9)24 (52.2)6 (18.2)109 (41.0)32.024<0.001
sabA - 57 (78.1)32 (40.3)20 (54.1)22 (47.8)27 (81.8)158 (59.0)
sabA“on”11 (15.1)36 (46.8)14 (37.8)22 (47.8)1 (3.0)84 (31.6)16.2100.003
sabA“off”5 (6.8)10 (13.0)3 (8.1)2 (4.3)5 (15.2)25 (9.4)

*Values in parentheses are percentages

*Values in parentheses are percentages

hofC status and frpB-4 status

The 907-bp PCR product indicating the presence of hofC gene of H. pylori was determined in 260 patients (97.7%), whereas 6 (2.2%) patients were classified as hofC-negative. Of these hofC-positive strains, 70 (95.9%) strains were isolated from Shandong, 45 (97.8%) from Hunan, 31 (93.9%) from Qinghai, 100.0% from Guangxi and Heilongjiang. There were no significant differences between the hofC gene and clinical outcomes (χ2 = 5.937, P>0.05). The frpB-4 gene was found in all 266 (100.0%) isolates.

homB and homA status

The homB gene was determined in 184 isolates (69.2%), whereas 82 isolates (30.8%) were classified as homB-negative. The prevalence of homB in the isolates from Qinghai (45.5%) (χ2 = 12.870, P<0.05) was significantly lower than that in Shandong (75.3%), Guangxi (76.6%), and Hunan (69.6%). For another hom family gene, 123 (46.2%) patients were infected with homA and 143 (53.8%) patients were homA-negative. The frequency of homA in Shandong (30.1%) (χ2 = 15.766, P<0.05) was significantly lower than in Guangxi (57.1%) and Qinghai (63.6%). There was no association between the homB genes and clinical outcomes in all five regions. However, in the strain from all provinces, homA showed significant differences between CSG and CAG, suggesting that homA may be associated with the severity of gastritis, as shown in S1 Table (χ2 = 6.707, P<0.05). The presence of homA may be a protective factor for gastritis (OR = 0.364).

sabA status

Sixteen sabA genes from Shandong province, 46 from Guangxi province, 17 from Heilongjiang province, 24 from Hunan province, 6 from Qinghai province contained a run of CT repeats. The sabA frequency was significantly more prevalent in Guangxi (59.7%), Hunan (52.2%), and Heilongjiang (45.9%) than in Shandong (21.9%) and Qinghai (18.2%) (χ2 = 32.024, P<0.001). Moreover, the presence of the sabA gene in H. pylori isolates was correlated with the severity of gastritis. The severity of CSG, CEG, and CAG increased successively. The sabA-positive gene was significantly related to the differences of CSG and CAG (χ2 = 10.539, P<0.05). The sabA gene was negatively correlated with the development of gastritis (OR = 0.253). All sabA genes tested displayed different CT-repeat lengths ranging from 2 to 10 repeats between different H. pylori strains. In all cases, the CT repeats were associated with the 5’ region of sabA genes. In addition, the repeated pattern of CT dinucleotide in the coding region was found and classified. In 109 sabA-positive gene sequencing results, 84 (77.1%) of which had a switch on status while 25 (22.9%) had an off status. The sabA functional status was significantly more frequent in isolates from Guangxi (46.8%), Heilongjiang (37.8%), and Hunan (47.8%) than Qinghai (3.0%) (χ2 = 16.210, P<0.05). Furthermore, the repeated pattern of CT dinucleotide varied in the sequences which were different from sabA (Table 3). The pattern containing 2 CT repeats was the most frequently associated with the “on” status (58/109, 53.2%), and the pattern with 6 CT repeats was the most prevalent for a nonfunctional (“off”) sabA gene (9/25, 36%). However, the differences between the sabA status and clinical outcome were not statistically significant.
Table 3

Frequency of the sabA CT repeats patterns.

StrainCT repeatSequence of the signal peptide coding regionAmino acid sequencesabA statusNumber(%)
HP-12 ATG-CTCTAT-CTGAAGATA-TTTTTGTGA MKK-LSLSL-FL*Off1 (0.9)
HP-22 ATG-CTCTAT-GCTGAAGAC-TTTTTTGTGAGC MKK-LSL-AED-FFVSOn58 (53.2)
HP-34 ATG-CTCTCTCTCG-GCTGAAGAT-TTTTTTGTGAGC MKK-LSL-AED-FFVSOn9 (8.3)
HP-45 ATG-CTCTCTCTCTCG-TTTTAA MKK-LSLSL-F*Off3 (2.8)
HP-55 ATG-CTCTCTCTCTCG-GCTGAAGAC-TTTTTTGTGAGC MKK-LSLSL-AED-FFVSOn4 (3.7)
HP-66 ATG-CTCTCTCTCTCTCGC-GCACGCTGA MKK-LSLS-AR*Off9 (8.3)
HP-77 ATG-CTCTCTCTCTCTCTCG-CGCTGA MKK-LSLSL-R*Off3 (2.8)
HP-87 ATG-CTCTCTCTCTCTCTCG-GCTGAAGAC-TTTTTTGTGAGC MKK-LSLSL-AED-FFVSOn6 (5.5)
HP-98 ATG-CTCTCTCTCTCTCTCTCG-ACGCTGAAG-TTTTTGTGA MKK-LSLSLSL-FL*Off3 (2.8)
HP-108 ATG-CTCTCTCTCTCTCTCTCG-ACGCTGAAG-TTTTTGTGA MKK-LSLSLSL-FFVSOn6 (5.5)
HP-119 ATG-CTCTCTCTCTCTCTCTCTCG-TTTTTATGA MKK-LSLSLS-FL*Off5 (4.6)
HP-1210 ATG-CTCTCTCTCTCTCTCTCTCTCG-GCTGAAGAC-TTTTTTATAAGC MKK-LSLSLSL-AED-FFISOn1 (0.9)
HP-1310 ATG-CTCTCTCTCTCTCTCTCTCTCGCT-CGCTGA MKK-LSLSLSL-R*Off1 (0.9)

*Indicates stop codon

*Indicates stop codon

Combined presence of OMP encoding genes frpB-4, hofC, homB, homA, and sabA in different regions

The presence of homA was associated with the presence of homB (χ2 = 124.332, P<0.001) and sabA (χ2 = 5.482, P<0.05). A statistically significant correlation between homA and homB and sabA gene was detected. The relationship between homA and homB is even closer (r = 0.564) (Table 4).
Table 4

Comparison and statistical analysis of H. pylori OMP genes.

Comparisonχ2P-valuer
hofC vs frpB-4//
hofC vs homB0.3380.5610.063
hofC vs homA0.3610.5480.062
hofC vs sabA0.0E01.0000.024
frpB-4 vs homB///
frpB-4 vs homA///
frpB-4 vs sabA///
homB vs homA 125.597 * 3.7671E -29 0.566
homB vs sabA2.9840.0840.105
homA vs sabA 5.760 0.016 0.146

*Numbers in boldface type indicate a significant correlation between the two genes

*Numbers in boldface type indicate a significant correlation between the two genes As frpB-4 and hofC genes were almost all positive in all 266 strains, and the correlation between the two genes and geographical distribution was not statistically significant, we selected strains that were both positive for frpB-4 and hofC when analyzing the association between gene combination and geographical origin, and also excluded confounding factors. When considered in five genes associated combinations (Table 5), the frequency of hofC/frpB-4/homB/homA genotypes and hofC/frpB-4/homB/homA/sabA genotypes was significantly in Guangxi (33.8%) (χ2 = 27.364, P<0.001 and χ2 = 39.397, P<0.001) higher compared to the other four provinces. The frequency of hofC/frpB-4/homB/sabA genotypes in Shandong, Guangxi, Heilongjiang, Hunan and Qinghai provinces were 12.3%, 44.2%, 18.9%, 37.0%, 3.0%, respectively (χ2 = 33.509, P<0.001). Furthermore, the hofC/frpB-4/homA/sabA genotypes frequency was significantly more prevalent in Guangxi (39.0%) (χ2 = 24.127, P<0.001) than in Shandong (8.2%), Hunan (17.4%) and Qinghai (12.1%). The hofC/frpB-4/homA/sabA genotypes were significantly more frequent in Heilongjiang (27.0%) (χ2 = 24.127, P<0.001) than in Shandong (8.2%).
Table 5

Prevalence of combined H. pylori hofC, frpB-4, homA, homB, sabA in different regions.

GenetypeShandongGuangxiHeilongjiangHunanQinghaiTotalχ2P-value
(n = 73)(n = 77)(n = 37)(n = 46)(n = 33)(n = 266)
hofC+&frpB-4+&homB+&homA+*4 (5.5)27 (33.8)3 (6.8)5 (10.9)4 (12.1)42 (15.8)27.364<0.001
hofC-|frpB-4-|homB-|homA-*69 (94.5)51 (66.2)34 (91.9)41 (89.1)29 (87.9)224 (84.2)
hofC+&frpB-4+&homB+&sabA+9 (12.3)34 (44.2)7 (18.9)17 (37.0)1 (3.0)68 (25.6)33.509<0.001
hofC-|frpB-4-|homB-|sabA-64 (87.7)43 (55.8)30 (81.1)29 (63.0)32 (97.0)198 (74.4)
hofC+&frpB-4+&homA+&sabA+6 (8.2)30 (39.0)10 (27.0)8 (17.4)4 (12.1)58 (21.8)24.127<0.001
hofC-|frpB-4-|homA-|sabA-67 (91.8)47 (61.0)27 (73.0)38 (82.6)29 (87.9)208 (78.2)
hofC+&frpB-4+&homB+&homA+&sabA+1 (1.4)18 (23.4)01 (2.2)020 (7.5)39.397<0.001
hofC-|frpB-4-|homB-|homA-|sabA-72 (98.6)59 (76.6)37 (100)45 (97.8)33 (100)246 (92.5)

*‘&’ indicate ‘and’, ‘|’ indicate ‘or’, values in parentheses are percentages

*‘&’ indicate ‘and’, ‘|’ indicate ‘or’, values in parentheses are percentages The above four gene combinations were negatively correlated with gastritis, which may be protective factors of gastritis. The specific OR values are shown in S1 Table.

Discussion

H. pylori is one of the most successful pathogens that colonizes the stomach of half the world’s population for a long time [21]. H. pylori infection can cause serious clinical consequences such as chronic gastritis, PUD, gastric atrophy, and GC [22, 23]. The prevalence of H. pylori depends on geographic regions, age, occupation, social and economic status, and living environment [24]. Outer membrane proteins are very important during infection and can influence the levels of bacterial colonization [25]. In this study, the distribution of frpB-4, hofC, homB, homA, and sabA genes in H. pylori isolated from patients suffering from gastric diseases in China was determined by PCR, and the relationship between these OMP encoding genes was assessed. The results showed that there were significant statistical differences in the distribution of homA, homB, and sabA genes in different provinces of China. The distribution of different gene combinations in the five provinces was also showed significant statistical differences. This may be related to the selective adaptation of genes in different regions. China, as a country with vast territory, its geographical distribution of population has been in a relatively stable state for a long time, which may lead to H. pylori infection in different regions of China with more significant OMP distribution characteristics. H. pylori carries two paralogous OMP, HomA and HomB, which have recently been suggested to be important determinants of disease severity [12]. In our study, the homB gene was significantly more prevalent than the homA gene (χ2 = 125.597, P<0.001). The positive rate of homB was the highest in Shandong province and the lowest in Qinghai Province, while homA was the opposite. The presence of the homA gene was significantly associated with the absence of homB gene since only 43 (16.2%) simultaneously harbored both genes. In western countries, the prevalence of homA was 61.9% and that of homB was 61.2%, which were approximately the same. There was no significant difference in homB prevalence between Colombian and American strains [12]. Compared with our result, the prevalence of homA (46.2%) was significantly different. Another study showed that homA and homB genes were heterogeneously distributed worldwide, with significant differences between East Asian and Western strains. Moreover, homB was found more frequently in East Asian strains than homA, but were not associated with clinical outcome. The presence of both genes in the same genome was detected in 10.4% of strains [26]. This is consistent with the results of our study. In addition, it was also pointed out that the copy number polymorphism of homB and homA had obvious geographical specificity [26]. Further sequence analysis using H. pylori strains from different geographic backgrounds in this study can assess whether different alleles could be associated with the severity of clinical outcomes or different geographic origin [26, 27]. In this study, the prevalence of sabA-positive gene was 41.0% (109/266) and that of sabA “on” was 31.6% (84/266). The prevalence of Portugal, the Netherlands, and Italy were 63.2%, 49.0%, and 35.5%, respectively [28-30]. The sabA-positive strains accounted for 85.3% of the Iranian studies, but the prevalence of sabA “on” status was not reported [31]. In contrast, the prevalence of sabA functional status was higher in Japan (81.5%) [20]. Analysis from Taiwan showed that 80.0% of strains had the sabA gene, while only 31.0% (45/145) strains carried sabA [8]. These large differences may be due to different disease sources of the strains or genetic diversity in different parts of the world. In addition, the association between sabA functional status and disease has not been fully established, and there is significant geographical diversity. In this study, 100% of H. pylori strains carried the frpB-4 gene and 97.7% carried the hofC gene, which has nothing to do with geographic origin and clinical outcome. Specific positive rates of frpB-4 and hofC in different regions have not been reported. However, it was found that frpB-4 was a gene containing multiple highly differentiated SNPs in strains from different regions of the world, especially in northeast China. The hofC gene is highly variable in global strains and shows many America-differentiated SNPs and region-differentiated SNPs within the Americas [9]. In Fujian, China, an area with a high incidence of cancer, HofC also contains the most differentiated SNPs [10, 32]. Therefore, we should analyze the relationship between the two and the disease and geographic distribution from a more microscopic perspective. There are still some limitations to our research. At present, we only studied the distribution characteristics of H. pylori outer membrane protein encoding genes in different regions of China, mainly comparing the positive rate of genes in different regions, gene interaction, genotype and gene combination with regional distribution and clinical outcomes. We have not thoroughly studied the function and mechanism of one or several genes in H. pylori colonization and pathogenicity. We will supplement it in the following study.

Conclusion

The homA, homB and sabA genes of H. pylori have significant geographical differences among five provinces in China. The homA and sabA genes were negatively correlated with the severity of gastritis.

Frequency of 267 H. pylori OMP genes in patient with CSG, CEG and CAG.

(DOCX) Click here for additional data file.
  32 in total

1.  Traces of human migrations in Helicobacter pylori populations.

Authors:  Daniel Falush; Thierry Wirth; Bodo Linz; Jonathan K Pritchard; Matthew Stephens; Mark Kidd; Martin J Blaser; David Y Graham; Sylvie Vacher; Guillermo I Perez-Perez; Yoshio Yamaoka; Francis Mégraud; Kristina Otto; Ulrike Reichard; Elena Katzowitsch; Xiaoyan Wang; Mark Achtman; Sebastian Suerbaum
Journal:  Science       Date:  2003-03-07       Impact factor: 47.728

2.  Fifth Chinese National Consensus Report on the management of Helicobacter pylori infection.

Authors:  Wen Zhong Liu; Yong Xie; Hong Lu; Hong Cheng; Zhi Rong Zeng; Li Ya Zhou; Ye Chen; Jiang Bin Wang; Yi Qi Du; Nong Hua Lu
Journal:  Helicobacter       Date:  2018-03-07       Impact factor: 5.753

Review 3.  Helicobacter pylori: molecular basis for colonization and survival in gastric environment and resistance to antibiotics. A short review.

Authors:  Sharmila Fagoonee; Rinaldo Pellicano
Journal:  Infect Dis (Lond)       Date:  2019-03-25

Review 4.  Prevalence of Helicobacter pylori infection in China: A systematic review and meta-analysis.

Authors:  Shuai Ren; Pengpeng Cai; Yaqian Liu; Tianpei Wang; Yan Zhang; Qian Li; Yuanliang Gu; Liqin Wei; Caiwang Yan; Guangfu Jin
Journal:  J Gastroenterol Hepatol       Date:  2021-12-13       Impact factor: 4.029

5.  Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases.

Authors:  Nastaran Farzi; Abbas Yadegar; Hamid Asadzadeh Aghdaei; Yoshio Yamaoka; Mohammad Reza Zali
Journal:  Infect Genet Evol       Date:  2018-02-13       Impact factor: 3.342

6.  Correlation between the geographical origin of Helicobacter pylori homB-positive strains and their clinical outcomes: a systematic review and meta-analysis.

Authors:  Masoud Keikha; Mohsen Karbalaei
Journal:  BMC Gastroenterol       Date:  2021-04-20       Impact factor: 3.067

7.  Genomic differentiation within East Asian Helicobacter pylori.

Authors:  Yuanhai You; Kaisa Thorell; Lihua He; Koji Yahara; Yoshio Yamaoka; Jeong-Heon Cha; Kazunari Murakami; Yukako Katsura; Ichizo Kobayashi; Daniel Falush; Jianzhong Zhang
Journal:  Microb Genom       Date:  2022-02

8.  Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

Authors:  Monica Oleastro; Rita Cordeiro; Yoshio Yamaoka; Dulciene Queiroz; Francis Mégraud; Lurdes Monteiro; Armelle Ménard
Journal:  Gut Pathog       Date:  2009-06-22       Impact factor: 4.181

9.  Geographic distribution of the cagA, vacA, iceA, oipA and dupA genes of Helicobacter pylori strains isolated in China.

Authors:  Zhijing Xue; Hong Yang; Dongxing Su; Xiangfeng Song; Xin Deng; Changhong Yu; Chunhua Sun; Lihua He; Yuanhai You; Yanan Gong; Dongjie Fan; Lu Sun; Xiurui Han; Ruyue Fan; Maojun Zhang; Xiaomei Yan; Jiaming Qian; Jianzhong Zhang
Journal:  Gut Pathog       Date:  2021-06-15       Impact factor: 4.181

Review 10.  Helicobacter pylori virulence genes.

Authors:  Anja Šterbenc; Erika Jarc; Mario Poljak; Matjaž Homan
Journal:  World J Gastroenterol       Date:  2019-09-07       Impact factor: 5.742

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.