| Literature DB >> 35586566 |
Xiran Yin1,2, Zhenxian Yang1,2, Mingsheng Zhu3, Cheng Chen1,2, Shan Huang1,2, Xueqing Li1,2, Hua Zhong1,2, He Wen1,2, Qing Sun1,2, Xiaojing Yu1,2, Jianjun Yan1,2.
Abstract
Background: The extensive involvement of interleukin enhancer binding factor 2 (ILF2) in RNA stability and the inflammatory response is well documented. Aberrant long noncoding RNA (lncRNA) expression contributes to the pathogenesis of psoriasis. However, little is known about the role of ILF2 in psoriasis. Objective: To investigate the role of ILF2 and KLHDC7B-DT in psoriasis.Entities:
Keywords: ILF2; KLHDC7B-DT; inflammation; proliferation; psoriasis
Year: 2022 PMID: 35586566 PMCID: PMC9110045 DOI: 10.3389/fgene.2022.890624
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Oligonucleotide sequences.
| siRNA | Sense (5′→3′) | Antisense (5′→3′) |
|---|---|---|
| siKLHDC7B-DT | GCCCAGUCAUUAUCACAUATT | UAUGUGAUAAUGACUGGGCTT |
| siILF2 | GGACAUUUGAAGUGCAAAUTT | AUUUGCACUUCAAAUGUCCTT |
| siNC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
Sequences of primers for qRT–PCR.
| RNA | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| LncRNA KLHDC7B-DT | GTTGCTAGTCCTCCGCTTCGC | GCTGGCTTGCCACAGGTTATG |
| ILF2 | CCTTAGCAGCCATCCGACAT | TTAGGGCCAAAGGCTGTCTG |
| GAPDH | GCACCGTCAAGGCTGAGAAC | TGGTGAAGACGCCAGTGGA |
| U6 | CAGCACATATACTAAAATTGGAACG | ACGAATTTGCGTGTCATCC |
FIGURE 1KLHDC7B-DT is upregulated in psoriatic tissues and M5-induced keratinocytes. (A) Differentially expressed lncRNAs detected in psoriatic and normal skin tissues using a lncRNA microarray (n = 3, Accession: GSE181318). (B) The expression level of KLDHC7B-DT in psoriatic tissues and normal controls (n = 10). (C) The expression level of KLDHC7B-DT in M5-induced NHEKs, HaCaT cells, and Ker-CT cells. (D) Fluorescence in situ hybridization showed the expression and localization of KLDHC7B-DT in HaCaT and Ker-CT cells. A Cy3-labelled probe (red) was used to show KLDHC7B-DT. DAPI (blue) was performed to show the nuclei of cells. Data are shown as the means ± SD, *p < 0.05, ***p < 0.001. All experiments were repeated at least three times. NHEK: normal human epidermal keratinocytes.
FIGURE 2KLHDC7B-DT regulates proliferation and inflammatory factor secretion in M5-induced keratinocytes. (A) The efficiency of KLDHC7B-DT knockdown was detected by qRT–PCR. (B) Proliferative effects were detected by EdU assay. (C) The cell cycle was detected by flow cytometry through PI staining. (D) Cell apoptosis was detected by flow cytometry through Annexin-V/PI staining. (E) Protein levels of IL-6 and IL-8 were detected by ELISA. Data are shown as the means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001. All experiments were repeated at least three times.
FIGURE 3The proliferative and inflammatory effects of KLDHC7B-DT overexpression in M5-induced keratinocytes. (A) The efficiency of KLDHC7B-DT overexpression detected by qRT–PCR. (B) Proliferative effects of KLDHC7B-DT overexpression on M5-treated keratinocytes detected by EdU assay. (C) The cell cycle was detected by flow cytometry through PI staining. (D) Cell apoptosis was detected by flow cytometry through Annexin-V/PI staining. (E) Protein levels of IL-6 and IL-8 were detected by ELISA. Data are shown as the means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001. All experiments were repeated at least three times.
FIGURE 4KLHDC7B-DT can bind with ILF2 protein and activate JNK/STAT3 signalling. (A) Silver staining of interacting proteins after the KLDHC7B-DT pulldown assay. (B) Mass spectrometry of ILF2. (C) Western blotting was used to detect ILF2 in the RNA pulldown product. (D) RIP experiments were performed using an antibody against ILF2 on lysates from HaCaT and Ker-CT cells; IgG was used as the control group. (E) Agarose electrophoresis detected KLDHC7B-DT in products from RIP. (F,G) mRNA and protein levels of ILF2 in KLDHC7B-DT knockdown or overexpression keratinocytes. (H) The efficiency of ILF2 knockdown was detected by Western blotting. (I) The mRNA levels of KLDHC7B-DT after ILF2 knockdown. (J) Activation of the STAT/JNK pathway after KLDHC7B-DT knockdown or overexpression. Data are shown as the means ± SD, ***p < 0.001. All experiments were repeated at least three times.
FIGURE 5ILF2 is highly expressed in psoriatic lesions. (A) The mRNA expression level of ILF2 in psoriatic tissues (n = 3). (B) The protein expression level of ILF2 in psoriatic tissues (n = 3). (C) The expression of ILF2 in normal and psoriatic tissues was detected by IHC (n = 10). The H-score was calculated based on the percentage of ILF2+ cells and staining intensity.(D) The expression level of ILF2 in M5-treated HaCaT and Ker-CT cells. (E) Subcellular localization of ILF2 in HaCaT and Ker-CT cells. Data are shown as the means ± SD, *p < 0.05. All experiments were repeated at least three times.
FIGURE 6ILF2 promotes hyperproliferation and inflammation through STAT3/JNK pathways in M5-induced keratinocytes. (A) Using an EdU assay, the proliferative effects of M5-induced keratinocytes were detected after transfection with siILF2 and siILF2+pcDNA-KLDHC7B-DT. (B) The cell cycle was detected by flow cytometry through PI staining. (C) Cell apoptosis was detected by flow cytometry through Annexin-V/PI staining. (D) Protein levels of IL-6 and IL-8 were detected by ELISA. (E) Activation of the STAT/JNK pathway detected by Western blotting. Data are shown as the means ± SD, *p < 0.05, **p < 0.01, ***p < 0.001. All experiments were repeated at least three times.