| Literature DB >> 35573239 |
Shilin Zhang1, Jierong Li1, Chunjing Li1, Xumin Xie1, Jun He1, Fengsheng Ling1, Bowei Li1, Huayan Wu1, Zhilin Li1, Jianwei Zheng1.
Abstract
Smooth muscle cells (SMCs) are the main functional component of urethral tissue, but are difficult to proliferate in vitro. Mesenchymal stem cells (MSCs) and mesenchymal stem cell-derived small extracellular vesicles (MSC-sEV) have been shown to promote tissue repair by regulating the proliferation and migration of different types of cells. In this study, we investigated the effect of umbilical cord mesenchymal stem cell-derived sEV (UCMSC-sEV) on the proliferation and migration of pediatric urethral smooth muscle cells (PUSMCs) and the mechanism by which sEV regulates the function of PUSMCs. We observed that UCMSC-sEV can significantly promote the proliferation and migration of PUSMCs in vitro. UCMSC-sEV exerted proliferation and migration promotion effects by carrying the CD73 to PUSMCs and catalyzing the production of adenosine. Conversely, the effect of UCMSC-sEV on the proliferation and migration of PUSMCs were no longer observed with addition of the PSB12379 as a CD73 inhibitor. It was found that the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway in PUSMCs was activated by adenosine or UCMSC-sEV intervention. In summary, UCMSC-sEV promoted proliferation and migration of PUSMCs in vitro by activating CD73/adenosine signaling axis and downstream PI3K/AKT pathway. Thus, we concluded that UCMSC-sEV may be suggested as a new solution strategy for the urethral tissue repair.Entities:
Keywords: CD73; hypospadias; mesenchymal stem cells; migration; proliferation; small extracellular vesicles; smooth muscle cells
Year: 2022 PMID: 35573239 PMCID: PMC9091373 DOI: 10.3389/fbioe.2022.895998
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primers used for real-time quantitative reverse transcription-polymerase chain reaction.
| Gene | Strand | 5–3′ Sequence |
|---|---|---|
| β-actin | Sense | GGCATCCACGAAACTACATTCAATTCC |
| Anti-sense | GTACCACCAGACAGCACTGTGTTG | |
| CD 73 | Sense | TGGGAGCTTACGATTTTGCACACC |
| Anti-sense | CGGATCTGCTGAACCTTGGTGAAG |
FIGURE 1Identification of PUMSCs, UCMSCs and UCMSC-sEV. (A) Morphology of PUMSCs. (B) Immunofluorescence staining results show that the isolated PUMSCs express α-SMA, a smooth muscle cell surface marker. (C) Growth curve of PUMSCs. (D) Flow cytometric analysis of MSC surface markers shows that UCMSCs express high levels = of CD29, CD44, CD73, and CD90 but do not express CD45 and HLA-DR. (E) Transmission electron microscopy shows that the UCMSC-sEV are cup-shaped vesicles. Scale bar = 100 nm. (F) NanoFCM analysis of the particle size of UCMSC-sEV. (G) Western blotting was used to detect the expression of the sEV marker proteins CD9, CD63, CD81, and TSG101.
FIGURE 2UCMSC-sEV promote the proliferation and migration of PUMSCs. (A) A CCK-8 assay was used to detect the proliferation of PUMSCs treated with 10 μg/ml and 50 μg/ml UCMSC-sEV for 24, 48 and 72 h (B) The EdU incorporation assay results show that UCMSC-sEV (10 μg/ml and 50 μg/ml) significantly promote the proliferation of PUMSCs. The scratch wound assay results (C) and Transwell assay results (D) are consistent. Low concentrations of UCMSC-sEV (10 μmol/L) have no effect on the migration of PUSMCs, and high concentrations of UCMSC-sEV (50 μmol/L) significantly promote the migration of PUSMCs.
FIGURE 3UCMSC-sEV promote proliferation and migration through CD73 molecules. (A) Detection of the mRNA expression level of CD73 in UCMSCs using real-time PCR (HEK293T was used as the control group). (B) Western blotting was used to detect the protein expression level of CD73 in UCMSC-sEV (HEK293T-sEV were used as the control group). (C) Immunofluorescence staining shows that PE-CD73-labeled sEV are internalized by PUMSCs. (D) CCK-8 and Transwell assay results (E) show that the inhibition of the sEV CD73 molecular activity by PSB12379 blocks the proliferation- and migration-promoting effects of UCMSC-sEV.
FIGURE 4The sEV CD73 catalyzes the production of adenosine and activates the PI3K/AKT pathway to promote proliferation and migration. (A) UCMSC-sEV use exogenous 5′AMP to produce adenosine through surface CD73. (B) CCK-8 and Transwell assay results (C) show that the addition of exogenous adenosine significantly promotes the proliferation and migration of PUSMCs in vitro. (D) Western blot detection of the expression levels of PI3K/AKT in PUSMCs.