| Literature DB >> 35571069 |
Xin-Yuan Liu1, Tian-Qi Zhang2, Qi Zhang1, Jing Guo1, Peng Zhang1, Tao Mao1, Zi-Bin Tian1, Cui-Ping Zhang1, Xiao-Yu Li1.
Abstract
Gastric cancer (GC) has a high incidence worldwide, and when detected, the majority of patients have already progressed to advanced stages. Long non-coding RNAs (lncRNAs) have a wide range of biological functions and affect tumor occurrence and development. However, the potential role of lncRNAs in GC diagnosis remains unclear. We selected five high-quality samples from each group of chronic non-atrophic gastritis, gastric mucosal intraepithelial neoplasia, and GC tissues for analysis. RNA-seq was used to screen the differentially expressed lncRNAs, and we identified 666 differentially expressed lncRNAs between the chronic non-atrophic gastritis and GC groups, 13 differentially expressed lncRNAs between the gastric mucosal intraepithelial neoplasia and GC groups, and 507 differentially expressed lncRNAs between the chronic non-atrophic gastritis and gastric mucosal intraepithelial neoplasia groups. We also identified six lncRNAs (lncRNA H19, LINC00895, lnc-SRGAP2C-16, lnc-HLA-C-2, lnc-APOC1-1, and lnc-B3GALT2-1) which not only differentially expressed between the chronic non-atrophic gastritis and GC groups, but also differentially expressed between the gastric mucosal intraepithelial neoplasia and GC groups. Furthermore, RT-qPCR was used to verify the differentially co-expressed lncRNAs. LncSEA was used to conduct a functional analysis of differentially expressed lncRNAs. We also predicted the target mRNAs of the differentially expressed lncRNAs through bioinformatics analysis and analyzed targeting correlations between three differentially co-expressed lncRNAs and mRNAs (lncRNA H19, LINC00895, and lnc-SRGAP2C-16). Gene Ontology and Kyoto Encyclopedia of Genes and Genomes databases were used to explore the functions of target mRNAs of differentially expressed lncRNAs. In conclusion, our study provides a novel perspective on the potential functions of differentially expressed lncRNAs in GC occurrence and development, indicating that the differentially expressed lncRNAs might be new biomarkers for early GC diagnosis.Entities:
Keywords: chronic non-atrophic gastritis; gastric cancer; gastric mucosal intraepithelial neoplasia; gene expression; long non-coding RNAs
Year: 2022 PMID: 35571069 PMCID: PMC9091194 DOI: 10.3389/fgene.2022.833857
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
Primer sequences used for RT-qPCR.
| lncRNA | Forward primer | Reverse primer |
|---|---|---|
| GAPDH | GAGTCAACGGATTTGGTCGT | GACAAGCTTCCCGTTCTCAG |
| lncRNA H19 | ACCACTGCACTACCTGACTC | CCGCAGGGGGTGGCCATGAA |
| LINC00895 | AAGAGGACACAACAAGGCACCATC | GGAAGTCCAAGATCAAGGCACCTG |
| lnc-SRGAP2C-16 | AGTGGAGATTTCAGCCGCTTTGAG | AGTTGAACGCACACATCACAAAGG |
| lnc-B3GALT2-1 | TGGTGACTGAAGCAGAGATTGGTG | TCTCTCCTCTTCCTAGCCTTGGTG |
| lnc-HLA-C-2 | AGCCATCTTCCCAGTCCACCATC | CCACAGCTCCGATGACCACAAC |
| lnc-APOC1-1 | CCCATTCCCCGAACGAATAAACCC | TCAGACCACCTTAGTCCCTTTCCC |
FIGURE 1The volcano figures of upregulated and downregulated lncRNAs. (A) The differential lncRNAs between gastritis group (gas1) and gastric precancerous lesion group (gas2). (B) The differential lncRNAs between gastritis group (gas1) and gastric cancer group (gas3). (C) The differential lncRNAs between gastric precancerous lesion group (gas2) and gastric cancer group (gas3).
The LogFC and FDR of six differentially expressed lncRNAs between the gastritis group (gas1) and the gastric cancer group (gas3) as well as between the gastric precancerous lesions group (gas2) and the gastric cancer group (gas3).
| lncRNA | gas1 and gas3 | Gas2 and gas3 | ||
|---|---|---|---|---|
| LogFC | FDR | LogFC | FDR | |
| lncRNA H19 | 5.5199968785742 | 7.64E-07 | 5.41606758341622 | 0.000502885561838305 |
| LINC00895 | 8.18159196198404 | 2.75992E-05 | 8.38571224191254 | 0.00345535762972322 |
| lnc-SRGAP2C-16 | 8.43804447367164 | 3.15351E-05 | 8.47127707185439 | 0.004456797733884 |
| lnc-HLA-C-2 | 1.73575759860498 | 0.000669082643182244 | 1.998919205213 | 0.0287657243650488 |
| lnc-APOC1-1 | 1.95442546138273 | 0.00524648132938214 | 2.63051911970753 | 0.0409010786302443 |
| lnc-B3GALT2-1 | −2.87368305530439 | 2.1373E-10 | −1.93861796711571 | 0.0229344445543282 |
FIGURE 2The expression levels of lncRNA H19 (A), LINC00895 (B), lnc-SRGAP2C-16 (C), lnc-HLA-C-2 (D), lnc-APOC1-1 (E), and lnc-B3GALT2-1 (F) in chronic non-atrophic gastritis (Gastritis) vs. gastric cancer (Gastric Cancer) tissues and in gastric mucosal low-grade/high-grade intraepithelial neoplasia (GIN) vs. gastric cancer (Gastric Cancer) tissues.
Enrichment analysis of differentially expressed lncRNAs through LncSEA.
| Enrichment set | Class | Sub_Class | Count |
| FDR | LncRNA | References |
|---|---|---|---|---|---|---|---|
| Ulcerative_colitis | Disease | LncRNADisease2.0 | 2 | 2.29E-05 | 0.00882 | H19 |
|
| IFNG-AS1 | |||||||
| Gallbladder_cancer_ | Disease | EVLncRNAs | 2 | 0.000114 | 0.0299 | H19 |
|
| FAM30A | |||||||
| invasion | Cancer Hallmark | — | 3 | 0.00421 | 0.0112 | H19 |
|
| LINC00857 | |||||||
| LINC00261 | |||||||
| migration | Cancer Hallmark | — | 3 | 0.00542 | 0.0112 | H19 |
|
| LINC00857 | |||||||
| LINC00261 | |||||||
| EMT | Cancer Hallmark | — | 2 | 0.00611 | 0.0112 | H19 |
|
| LINC00261 | |||||||
| metastasis | Cancer Hallmark | — | 2 | 0.0064 | 0.0112 | H19 |
|
| LINC00261 | |||||||
| demethylation | Methylation Pattern | — | 3 | 1.38E-05 | 6.90E-05 | H19 |
|
| DLEU1; | |||||||
| LINC00857 | |||||||
| hypermethylation | Methylation Pattern | — | 2 | 0.00275 | 0.00673 | H19 |
|
| TERC | |||||||
| differential methylation | Methylation Pattern | — | 2 | 0.00404 | 0.00673 | H19 |
|
| TERC | |||||||
| IGF2BP3 | RNA Binding Protein | starBasev2.0 | 5 | 7.00E-05 | 0.00189 | SNHG6 | N/A |
| SNHG4 | |||||||
| LINC00261 | |||||||
| TERC | |||||||
| LINC00311 | |||||||
| IGF2BP2 | RNA Binding Protein | starBasev2.0 | 5 | 0.00141 | 0.019 | H19 | N/A |
| SNHG6 | |||||||
| DLEU1 | |||||||
| SNHG4 | |||||||
| TERC | |||||||
| lincRNA | SmORF | sor.forg | 8 | 0.000222 | 0.00133 | H19 | N/A |
| FAM30A | |||||||
| SNHG6 | |||||||
| DLEU1 | |||||||
| SNHG4 | |||||||
| LINC02057 | |||||||
| LINC00857 | |||||||
| LINC00261 |
Details of H19 are provided in the Supplementary Table S5, S6
N/A, not applicable.
FIGURE 3The interaction networks of differentially expressed lncRNAs (lncRNA H19, LINC00895, lnc-SRGAP2C-16) and target mRNAs.
FIGURE 4The top 10 enriched items of differential lncRNAs targeted mRNAs in the process of chronic non-atrophic gastritis and gastric mucosal intraepithelial neoplasia to gastric cancer in GO and KEGG enrichment analysis.