| Literature DB >> 35571035 |
Anjanasree K Neelakandan1, David A Wright1, Sy M Traore2, Xiangyu Chen3, Martin H Spalding1, Guohao He2.
Abstract
Peanut (Arachis hypogaea L.) seed is a rich source of edible oil, comprised primarily of monounsaturated oleic acid and polyunsaturated linoleic acid, accounting for 80% of its fatty acid repertoire. The conversion of oleic acid to linoleic acid, catalyzed by Fatty Acid Desaturase 2 (FAD2) enzymes, is an important regulatory point linked to improved abiotic stress responses while the ratio of these components is a significant determinant of commercial oil quality. Specifically, oleic acid has better oxidative stability leading to longer shelf life and better taste qualities while also providing nutritional based health benefits. Naturally occurring FAD2 gene knockouts that lead to high oleic acid levels improve oil quality at the potential expense of plant health though. We undertook a CRISPR/Cas9 based site-specific genome modification approach designed to downregulate the expression of two homeologous FAD2 genes in seed while maintaining regulation in other plant tissues. Two cis-regulatory elements the RY repeat motif and 2S seed protein motif in the 5'UTR and associated intron of FAD2 genes are potentially important for regulating seed-specific gene expression. Using hairy root and stable germ line transformation, differential editing efficiencies were observed at both CREs when targeted by single gRNAs using two different gRNA scaffolds. The editing efficiencies also differed when two gRNAs were expressed simultaneously. Additionally, stably transformed seed exhibited an increase in oleic acid levels relative to wild type. Taken together, the results demonstrate the immense potential of CRISPR/Cas9 based approaches to achieve high frequency targeted edits in regulatory sequences for the generation of novel transcriptional alleles, which may lead to fine tuning of gene expression and functional genomic studies in peanut.Entities:
Keywords: agrobacterium-mediated transformation; fatty acid; gene editing; peanut; regulatory element
Year: 2022 PMID: 35571035 PMCID: PMC9091597 DOI: 10.3389/fgene.2022.849961
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Genomic loci, transcript models and location of regulatory elements. Star denotes RY element; circle marks Initiator (INR) motif; diamond marks the 2S seed protein element. The arrows denote transcription start sites. Black rectangles denote 5′UTR, grey for coding sequence and dotted rectangles stand for 3′UTR, broken line represents the intron in the 5′UTR.
FIGURE 2Schematic representation of the FAD2 targets and the vectors used in the study. (A). Targets location and sequence in the promoter of FAD2A and FAD2B; (B). Vectors with different scaffolds [Cas9-extended scaffold (-E) and Cas9-regular scaffold (-R)].
Details of target sites and gRNAs used in hairy root assay.
|
| sgRNA Target Sequence (5′—3′) | Purpose |
|---|---|---|
| RY repeat element | GATAACATCAACATGCATGCT | Induction of indels |
| 2S Seed protein element | GATTTGAATGCCACATGTGTT | Induction of indels |
The oligo sequences used for PCR and Sanger Sequencing.
| Oligo Name | Oligo Sequence (5′—3′) | Purpose |
|---|---|---|
| AHY1006 | GTCCTCAAATAGCTCGACTG | Forward primer to amplify FAD2A distal promoter |
| AHY1007 | AGGGCCCAGAAGCAATTATGATAC | Reverse primer to amplify FAD2A distal promoter |
| AHY1078 | TTGAAGCAAAGGGGTGAGGTTTTC | Forward primer to amplify FAD2A proximal promoter |
| AHY1073 | CAAGTCAATAATCAGTAATCTAATG | Reverse primer to amplify FAD2A proximal promoter |
| AHY1012 | GAATGAGGATGGGGACCAATATTC | Forward primer to amplify FAD2B distal promoter |
| AHY1013 | AGGGCCCAGAAGCAATTACTAATG | Reverse primer to amplify FAD2B distal promoter |
| AHY1079 | GAAGTAAGGGTTGGTGAAGTTTTC | Forward primer to amplify FAD2B proximal promoter |
| AHY1015 | GCACTACTACAAAGCTAATGGTTC | Reverse primer to amplify FAD2B proximal promoter |
| AHY1074 | CCAATGTGAGTGAGACAACAAC | Sequencing primer for FAD2A & B distal promoter |
| AHY1097 | CTGGCTCCAAGTCCAAGCAATA | Sequencing primer for FAD2A and B proximal promoter |
Site-specific editing efficiency in the hairy root assay.
| Motif | Construct | Target type | Number of Roots Tested | Number of Edited Roots | FAD2A edits | FAD2B edits | Bi-Homeological edit |
|---|---|---|---|---|---|---|---|
| RY | Cas9-Ext scaffold | Single gRNA RY | 31 | 6 | 20% | 10.3% | 9.68% |
| Dual gRNA (RY-2S) | 27 | 9 | 36.84% | 30.77% | 18.51% | ||
| Dual gRNA (2S-RY) | 20 | 6 | 40% | 25% | 20% | ||
| Cas9-Reg scaffold | Single gRNA RY | 18 | 8 | 37.5% | 50% | 22.22% | |
| 2S | Cas9-Ext scaffold | Single gRNA 2S | 23 | 2 | 6.67% | 13.33% | 4.35% |
| Dual gRNA (RY-2S) | 27 | 2 | 5.26% | 3.85% | 0 | ||
| Dual gRNA (2S-RY) | 20 | 2 | 0 | 12.5% | 0 | ||
| Cas9-Reg scaffold | Single gRNA 2S | 24 | 1 | 0 | 4.55% | 0 |
The percentage of amplicons with edit in total amplicons from FAD2A or FAD2B.
The percentage of amplicons with both FAD2A and FAD2B edits in total amplicons from FAD2A and FAD2B.
FIGURE 3Site-specific modifications at RY repeat element in FAD2A and FAD2B Shown are mutations around the RY motif that were detected for the single RY targeted and duel RY and 2S targeted CRISPR/Cas9 constructs using the hairy root system. The target protospacer sequence is in red, the PAM is in dark blue, insertions are in green, bases in light blue are outside of the wild type sequence that is shown, deletions are represented by dashes, a double slash indicates a deletion larger than what is depicted and the arrow indicated the predicted double strand break site (DSB). Numbers in column A indicate indel size, numbers in columns B to E are percentages of total mutations and the E (extended) or R (standard) designation in columns B to E indicate the gRNA scaffold used.
FIGURE 4Site–specific modifications at 2S Seed protein element. Shown are mutations around the 2S motif that were detected for the single 2S targeted and duel RY and 2S targeted CRISPR/Cas9 constructs used the hairy root assays. The target protospacer sequence is in red, PAM is in blue, substitutions are in purple, insertions are in green, deletions are represented by dashes and the arrow indicated the predicted double strand break site (DSB). Numbers in column A indicate indel size, numbers in columns B to E are percentages of total mutations and the E (extended) or R (standard) designation in columns B to E indicate the gRNA scaffold used.
The content of oleic acid in the T0 seeds.
| Target | RY | — | 2S | — | |||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Oleic Acid Content | 40%–54% | 55%–60% | 61%–65% | — | — | 40%–54% | 55%–60% | 61%–65% | 66%–70% | — | |
| Genotype used | AU18-46 | 32 | 14 | 94 | 8 | 4 | — | — | 26 | ||
| GT-C20 | 17 | 1 | 7 | 3 | — | — | |||||
| Exp27-1516 | 19 | 5 | 4 | 2 | 3 | 1 | — | — | |||
| Total number of seeds harvested | 68 | 26 | 94 | 18 | 8 | 26 | |||||
| Transformation efficiency (%) | — | — | — | — | 27.66 | — | — | — | — | 26.92 | |
Same oleic acid content as wild type in some harvested seeds.
The percentage of number of seeds with increased oleic acid in total number of harvested seeds in each target.