Marker-Assisted Improvement of Bread Wheat Variety HD2967 for Leaf and Stripe Rust Resistance.

The mega wheat variety HD2967 was improved for leaf and stripe rust resistance by marker-assisted backcross breeding. After its release in 2011, HD2967 became susceptible to stripe rust and moderately susceptible to leaf rust. The leaf rust resistance gene LrTrk was transferred into HD2967 from the durum wheat genotype Trinakria. Then, HD2967 was crossed with Trinakria to produce F1 plant foreground selection for LrTrk and background selection for the recurrent parent genotype was carried out in BC1F1, BC2F1 and BC2F2 generations. Foreground selection was carried out with the linked marker Xgwm234, while polymorphic SSR markers between parents were used for background selection. Background selection resulted in the rapid recovery of the recurrent parent genome. A morphological evaluation of 6 near isogenic lines (NILs)-2 resistant to leaf and stripe rust, and 4 resistant to leaf rust only-showed no significant differences in yields among NILs and the recurrent parent HD2967. All of the 6 NILs showed the presence of 2NS/2AS translocation, carrying the linked genes Lr37/Sr38/Yr17 present in HD2967 and the targeted leaf rust resistance gene LrTrk. Two NILs also showed additional resistance to stripe rust. Therefore, these NILs with rust resistance and an at par yielding ability of H2967 can replace the susceptible cultivar HD2967 to reduce yield losses due to disease.

1. Introduction

Bread wheat (Triticum aestivum L.) is one of the major food crops of the world, accounting for 20% of the calories consumed by humans globally [1]. The production of wheat is affected by several biotic and abiotic factors. Among the biotic factors, rust diseases caused by Puccinia spp. inflict significant damage to the crop of susceptible cultivars, resulting in substantial yield losses [2,3]. There are three rust diseases: viz. leaf rust (Puccinia triticina Eriks.); stem rust (Puccinia graminis f. sp. Tritici); and stripe rust (Puccinia striiformis), which infecting wheat under different agro-ecological conditions. Wheat growing areas are differentially suited to the development of leaf, stem, and stripe rust [4]. The leaf rust pathogen has a wide range of adaptation to different environments; and, it therefore occurs in all wheat growing areas, causing significant yield losses in susceptible cultivars globally [5,6,7]. Stripe rust is a devastating disease affecting wheat worldwide, especially under cool and moist conditions [8,9]. Stem rust develops under relatively warmer conditions [10,11] and it can cause substantial yield losses, especially under epidemic conditions [12,13,14]. In India, among all the three rusts, leaf rust is the most widespread and prevails in all the wheat-growing zones, while stripe rust occurs predominantly in the cooler areas of the north–western plains and northern hill states in the Himalayas. Stem rust is a disease of warmer areas and occurs mainly in central and peninsular India. Although fungicides can control rust diseases, developing rust-resistant cultivars is an environment friendly and economical method of disease control [15,16]. The evolution of new and virulent pathotypes of the rust pathogen renders the existing cultivars susceptible. There is a need for the identification of new and effective sources of resistance and their utilization in breeding programs [17,18,19]. There is a continuous need for developing new cultivars with effective resistance genes to replace the susceptible cultivars. With developments in molecular genetics and genomics, marker-assisted breeding has emerged as a major tool in varietal development. Marker-assisted backcross breeding provides a precise method to transfer rust resistant genes in an agronomically well-adapted cultivar that has become susceptible due to the evolution of new virulent pathotypes [20,21,22,23]. Two wheat varieties—Unnat PBW343 and Unnat PBW550—were developed using marker-assisted backcross breeding [24,25] and they were released for cultivation in 2017 to replace the popular but susceptible wheat varieties of India PBW343 and PBW550, respectively. These varieties are giving higher returns to farmers [26].

Developed at the Indian Agricultural Research Institute in New Delhi, wheat variety ICAR-HD2967 is a mega variety released for general cultivation in India’s North Western Plain Zone under timely sown irrigated conditions in 2011 [27]. Variety HD2967 soon became popular and occupied more than 10 million hectares [28]. Due to its adaptability and its high yield, HD2967 was also recommended for cultivation in the North Eastern Plain Zone. However, over a period of time, HD2967 became susceptible to stripe rust and it showed moderate susceptibility to leaf rust. Both stripe rust and leaf rust are important diseases of the NWPZ (North Western Plain Zone) as well as the NEPZ (North Eastern Plain Zone) due to conducive environmental conditions during the crop season. Due to its yield advantage and its adaptability, HD2967 remains popular among farmers; therefore, the transfer of leaf and stripe rust resistance genes to HD2967 can protect farmers from yield losses and reduce spending on fungicides. Durum wheat genotype Trinakria showed leaf and stem rust resistance under field conditions [29]. Trinakria also showed a high degree of stripe rust resistance at the seedling and the adult plant stages. In the present study, Trinakria was used as a donor for leaf and stripe rust resistance in an effort to improve leaf and stripe rust resistance in HD2967.

2. Results

2.1. Development of NILs Carrying Leaf Rust Resistance Gene LrTrk and Leaf and Stripe Rust Resistance Gene LrTrk/YrTrk

Crosses were made between the recurrent parent (RP) HD2967 and the donor parent (DP) Trinakria (Tetraploid donor) to produce the F1 generation. The co-dominant SSR marker Xgwm234 was linked with the leaf rust resistance gene LrTrk to confirm the heterozygosity of F1 plants. Five true F1 plants were backcrossed with HD2967 to produce the BC1F1 generation. The BC1F1 seeds were found to be a mixture of normal-filled and shriveled seeds. A total of 145 normal-filled BC1F1 seeds were sown; out of that, 60 plants were found to carry LrTrk in the heterozygous state when screened with the Xgwm234 marker (Table 1). Out of the 60 BC1F1 plants, 10 plants that looked phenotypically similar to HD2967 were selected for marker-assisted background analysis. A parental polymorphism survey between HD2967 and Trinakria with 700 SSR markers (Table A1) identified 83 polymorphic markers (Table A2). A background analysis with polymorphic SSR markers of 10 phenotypically selected BC1F1 plants showed that RPG recovery varied from 78.91% to 83.13% (Table 1). The plant carrying maximum RPG recovery of 83.13% was backcrossed with HD2967 to produce the BC2F1 generation. As compared to the BC1F1 generation, BC2F1 seeds were found to be normal and well-filled. A total of 66 BC2F1 plants were screened for the leaf rust resistance gene LrTrk with the linked SSR marker Xgwm234. Thirty-nine plants were identified as carrying LrTrk in heterozygous conditions (Table 1). Again, ten plants that looked phenotypically similar to HD2967 were selected for background analysis using SSR markers. In the ten selected plants in the BC2F1 generation, RPG recovery varied from 90.36% to 93.37% (Table 1). The plant with a maximum RPG recovery of 93.37% was selfed to produce the BC2F2 generation. Foreground selection among 200 BC2F2 plants was undertaken that identified 98 and 61 plants carrying the leaf rust resistance gene LrTrk (a 269 bp band) in heterozygous and homozygous states, respectively (Figure 1; Table 1). A background analysis revealed that RPG recovery in 61 BC2F2 plants homozygous for LrTrk ranged from 95.18% to 98.79%. Thirty-two homozygous BC2F2 plants with RPG recovery above 97% were selfed to produce BC2F3 families (Table 1).

Table 1

Number of gene-positive plants identified in each backcross generation and their background recovery.

Recipient Parent	Target Gene	Generation	No. of Plants Screened with Linked Molecular Marker	No. of Plants Carrying Target Gene		No. of Plants Selected for Background Selection	Number of Plants Backcrossed/Selfed/Selected	Recurrent Parent Genome (RPG) Recovery (%)
				Heterozygous	Homozygous
HD2967	LrTrk	BC1F1	145	60	-	10	1	78.91–83.13
		BC2F1	66	39	-	10	1	90.36–93.37
		BC2F2	200	98	61	61	32	95.18–98.79

Table A1

List of 700 markers used in parental polymorphism survey.

S.No.	Marker	S.No.	Marker	S.No.	Marker	S.No.	Marker	S.No.	Marker
1	Xbarc10	48	Xbarc20	95	Xbarc95	142	Xcfd13	189	Xcfd88
2	Xbarc101	49	Xbarc200	96	Xbarc98	143	Xcfd143	190	Xgdm101
3	Xbarc108	50	Xbarc206	97	Xcfa2019	144	Xcfd15	191	Xgdm109
4	Xbarc109	51	Xbarc21	98	Xcfa2026	145	Xcfd156	192	Xgdm113
5	Xbarc117	52	Xbarc212	99	Xcfa2028	146	Xcfd16	193	Xgdm116
6	Xbarc119	53	Xbarc229	100	Xcfa2037	147	Xcfd168	194	Xgdm136
7	Xbarc121	54	Xbarc23	101	Xcfa2040	148	Xcfd170	195	Xgdm14
8	Xbarc123	55	Xbarc232	102	Xcfa2043	149	Xcfd190	196	Xgdm146
9	Xbarc124	56	Xbarc24	103	Xcfa2056	150	Xcfd193	197	Xgdm28
10	Xbarc127	57	Xbarc240	104	Xcfa2070	151	Xcfd2	198	Xgdm33
11	Xbarc128	58	Xbarc25	105	Xcfa2076	152	Xcfd2.1	199	Xgdm36
12	Xbarc13	59	Xbarc267	106	Xcfa2091	153	Xcfd2.2	200	Xgdm63
13	Xbarc134	60	Xbarc28	107	Xcfa2104	154	Xcfd20	201	Xgpw2246
14	Xbarc137	61	Xbarc3	108	Xcfa2106	155	Xcfd219	202	Xgpw3010
15	Xbarc138	62	Xbarc32	109	Xcfa2110	156	Xcfd22	203	Xgpw3069
16	Xbarc140	63	Xbarc37	110	Xcfa2114	157	Xcfd24	204	Xgpw3261
17	Xbarc141	64	Xbarc4	111	Xcfa2121	158	Xcfd242	205	Xgpw5193
18	Xbarc142	65	Xbarc40	112	Xcfa2123	159	Xcfd25	206	Xgpw7052
19	Xbarc145	66	Xbarc417	113	Xcfa2129	160	Xcfd251	207	Xgpw7070
20	Xbarc146	67	Xbarc45	114	Xcfa2134	161	Xcfd257	208	Xgpw7072
21	Xbarc147	68	Xbarc48	115	Xcfa2141	162	Xcfd267	209	Xgwm10
22	Xbarc148	69	Xbarc49	116	Xcfa2147	163	Xcfd28	210	Xgwm107
23	Xbarc151	70	Xbarc5	117	Xcfa2149	164	Xcfd283	211	Xgwm108
24	Xbarc154	71	Xbarc55	118	Xcfa2155	165	Xcfd30	212	Xgwm11
25	Xbarc158	72	Xbarc56	119	Xcfa2163	166	Xcfd31	213	Xgwm112
26	Xbarc159	73	Xbarc59	120	Xcfa2164	167	Xcfd36	214	Xgwm113
27	Xbarc163	74	Xbarc60	121	Xcfa2170	168	Xcfd39	215	Xgwm114
28	Xbarc164	75	Xbarc67	122	Xcfa2174	169	Xcfd4	216	Xgwm120
29	Xbarc165	76	Xbarc68	123	Xcfa2179	170	Xcfd48	217	Xgwm122
30	Xbarc167	77	Xbarc69	124	Xcfa2183	171	Xcfd5	218	Xgwm124
31	Xbarc17	78	Xbarc7	125	Xcfa2185	172	Xcfd50	219	Xgwm126
32	Xbarc170	79	Xbarc72	126	Xcfa2187	173	Xcfd54	220	Xgwm129
33	Xbarc173	80	Xbarc73	127	Xcfa2190	174	Xcfd59	221	Xgwm130
34	Xbarc174	81	Xbarc75	128	Xcfa2191	175	Xcfd6	222	Xgwm131
35	Xbarc176	82	Xbarc76	129	Xcfa2193	176	Xcfd60	223	Xgwm132
36	Xbarc178	83	Xbarc77	130	Xcfa2219	177	Xcfd62	224	Xgwm133
37	Xbarc18	84	Xbarc78	131	Xcfa2226	178	Xcfd65	225	Xgwm135
38	Xbarc180	85	Xbarc8	132	Xcfa2234	179	Xcfd7	226	Xgwm136
39	Xbarc181	86	Xbarc80	133	Xcfa2240	180	Xcfd70	227	Xgwm140
40	Xbarc182	87	Xbarc81	134	Xcfa2250	181	Xcfd71	228	Xgwm146
41	Xbarc183	88	Xbarc83	135	Xcfa2256	182	Xcfd73	229	Xgwm148
42	Xbarc186	89	Xbarc84	136	Xcfa2257	183	Xcfd74	230	Xgwm149
43	Xbarc187	90	Xbarc85	137	Xcfa2262	184	Xcfd79	231	Xgwm153
44	Xbarc188	91	Xbarc87	138	Xcfa2278	185	Xcfd80	232	Xgwm154
45	Xbarc195	92	Xbarc89	139	Xcfa2293	186	Xcfd81	233	Xgwm155
46	Xbarc197	93	Xbarc92	140	Xcfd1	187	Xcfd82	234	Xgwm156
47	Xbarc198	94	Xbarc94	141	Xcfd11	188	Xcfd86	235	Xgwm159
236	Xgwm16	284	Xgwm312	332	Xgwm471	380	Xgwm636	428	Xwmc166
237	Xgwm160	285	Xgwm314	333	Xgwm473	381	Xgwm637	429	Xwmc168
238	Xgwm162	286	Xgwm319	334	Xgwm480	382	Xgwm639	430	Xwmc169
239	Xgwm164	287	Xgwm32	335	Xgwm493	383	Xgwm644	431	Xwmc17
240	Xgwm165	288	Xgwm328	336	Xgwm494	384	Xgwm66	432	Xwmc173
241	Xgwm169	289	Xgwm33	337	Xgwm495	385	Xgwm664	433	Xwmc175
242	Xgwm179	290	Xgwm332	338	Xgwm497	386	Xgwm666	434	Xwmc177
243	Xgwm18	291	Xgwm333	339	Xgwm498	387	Xgwm666.1	435	Xwmc179
244	Xgwm181	292	Xgwm334	340	Xgwm499	388	Xgwm666.2	436	Xwmc181
245	Xgwm182	293	Xgwm335	341	Xgwm5	389	Xgwm67	437	Xwmc182
246	Xgwm186	294	Xgwm339	342	Xgwm501	390	Xgwm674	438	Xwmc183
247	Xgwm191	295	Xgwm340	343	Xgwm508	391	Xgwm68	439	Xwmc201
248	Xgwm192	296	Xgwm344	344	Xgwm512	392	Xgwm70	440	Xwmc206
249	Xgwm193	297	Xgwm350	345	Xgwm513	393	Xgwm72	441	Xwmc213
250	Xgwm2	298	Xgwm356	346	Xgwm515	394	Xgwm77	442	Xwmc215
251	Xgwm205	299	Xgwm357	347	Xgwm518	395	Xgwm88	443	Xwmc216
252	Xgwm210	300	Xgwm359	348	Xgwm526	396	Xgwm88.1	444	Xwmc218
253	Xgwm213	301	Xgwm361	349	Xgwm537	397	Xgwm88.2	445	Xwmc219
254	Xgwm219	302	Xgwm368	350	Xgwm538	398	Xgwm95	446	Xwmc230
255	Xgwm233	303	Xgwm369	351	Xgwm540	399	Xgwm99	447	Xwmc231
256	Xgwm234	304	Xgwm371	352	Xgwm544	400	Xwmc1	448	Xwmc232
257	Xgwm247	305	Xgwm372	353	Xgwm547	401	Xwmc10	449	Xwmc235
258	Xgwm249	306	Xgwm374	354	Xgwm55	402	Xwmc104	450	Xwmc238
259	Xgwm251	307	Xgwm375	355	Xgwm550	403	Xwmc105	451	Xwmc24
260	Xgwm257	308	Xgwm376	356	Xgwm554	404	Xwmc109	452	Xwmc243
261	Xgwm259	309	Xgwm382	357	Xgwm558	405	Xwmc11	453	Xwmc245
262	Xgwm260	310	Xgwm388	358	Xgwm565	406	Xwmc110	454	Xwmc247
263	Xgwm264	311	Xgwm389	359	Xgwm566	407	Xwmc113	455	Xwmc25
264	Xgwm265	312	Xgwm391	360	Xgwm569	408	Xwmc116	456	Xwmc254
265	Xgwm268	313	Xgwm397	361	Xgwm570	409	Xwmc118	457	Xwmc256
266	Xgwm271	314	Xgwm4	362	Xgwm573	410	Xwmc120	458	Xwmc257
267	Xgwm273	315	Xgwm400	363	Xgwm577	411	Xwmc125	459	Xwmc258
268	Xgwm274	316	Xgwm403	364	Xgwm582	412	Xwmc128	460	Xwmc261
269	Xgwm275	317	Xgwm408	365	Xgwm595	413	Xwmc134	461	Xwmc262
270	Xgwm276	318	Xgwm410	366	Xgwm6	414	Xwmc139	462	Xwmc264
271	Xgwm282	319	Xgwm413	367	Xgwm60	415	Xwmc145	463	Xwmc265
272	Xgwm284	320	Xgwm415	368	Xgwm601	416	Xwmc149	464	Xwmc269
273	Xgwm285	321	Xgwm425	369	Xgwm604	417	Xwmc15	465	Xwmc27
274	Xgwm291	322	Xgwm427	370	Xgwm608	418	Xwmc150	466	Xwmc272
275	Xgwm293	323	Xgwm429	371	Xgwm610	419	Xwmc152	467	Xwmc273
276	Xgwm294	324	Xgwm43	372	Xgwm611	420	Xwmc153	468	Xwmc274
277	Xgwm296	325	Xgwm44	373	Xgwm613	421	Xwmc154	469	Xwmc276
278	Xgwm297	326	Xgwm443	374	Xgwm614	422	Xwmc156	470	Xwmc278
279	Xgwm299	327	Xgwm445	375	Xgwm617	423	Xwmc158	471	Xwmc28
280	Xgwm30	328	Xgwm448	376	Xgwm626	424	Xwmc16	472	Xwmc283
281	Xgwm302	329	Xgwm459	377	Xgwm63	425	Xwmc160	473	Xwmc289
282	Xgwm304	330	Xgwm46	378	Xgwm630	426	Xwmc161	474	Xwmc291
283	Xgwm311	331	Xgwm47	379	Xgwm635	427	Xwmc163	475	Xwmc296
476	Xwmc307	524	Xwmc453	572	Xwmc580	620	Xwmc679	668	Xwmc776
477	Xwmc31	525	Xwmc455	573	Xwmc581	621	Xwmc680	669	Xwmc777
478	Xwmc310	526	Xwmc468	574	Xwmc59	622	Xwmc682	670	Xwmc78
479	Xwmc311	527	Xwmc469	575	Xwmc592	623	Xwmc684	671	Xwmc783
480	Xwmc312	528	Xwmc47	576	Xwmc593	624	Xwmc687	672	Xwmc786
481	Xwmc313	529	Xwmc471	577	Xwmc594	625	Xwmc692	673	Xwmc787
482	Xwmc317	530	Xwmc473	578	Xwmc596	626	Xwmc693	674	Xwmc79
483	Xwmc323	531	Xwmc474	579	Xwmc597	627	Xwmc694	675	Xwmc790
484	Xwmc326	532	Xwmc475	580	Xwmc598	628	Xwmc695	676	Xwmc792
485	Xwmc329	533	Xwmc476	581	Xwmc602	629	Xwmc696	677	Xwmc794
486	Xwmc332	534	Xwmc477	582	Xwmc603	630	Xwmc698	678	Xwmc795
487	Xwmc335	535	Xwmc479	583	Xwmc606	631	Xwmc70	679	Xwmc798
488	Xwmc336	536	Xwmc48	584	Xwmc607	632	Xwmc702	680	Xwmc805
489	Xwmc344	537	Xwmc486	585	Xwmc611	633	Xwmc705	681	Xwmc807
490	Xwmc349	538	Xwmc487	586	Xwmc612	634	Xwmc707	682	Xwmc808
491	Xwmc35	539	Xwmc488	587	Xwmc613	635	Xwmc710	683	Xwmc809
492	Xwmc356	540	Xwmc489	588	Xwmc615	636	Xwmc713	684	Xwmc810
493	Xwmc361	541	Xwmc49	589	Xwmc616	637	Xwmc716	685	Xwmc813
494	Xwmc364	542	Xwmc491	590	Xwmc617	638	Xwmc718	686	Xwmc815
495	Xwmc366	543	Xwmc492	591	Xwmc619	639	Xwmc719	687	Xwmc817
496	Xwmc376	544	Xwmc494	592	Xwmc623	640	Xwmc722	688	Xwmc818
497	Xwmc382	545	Xwmc497	593	Xwmc625	641	Xwmc723	689	Xwmc819
498	Xwmc386	546	Xwmc498	594	Xwmc626	642	Xwmc726	690	Xwmc826
499	Xwmc388	547	Xwmc500	595	Xwmc627	643	Xwmc727	691	Xwmc827
500	Xwmc396	548	Xwmc505	596	Xwmc63	644	Xwmc728	692	Xwmc83
501	Xwmc397	549	Xwmc508	597	Xwmc630	645	Xwmc73	693	Xwmc830
502	Xwmc398	550	Xwmc51	598	Xwmc631	646	Xwmc734	694	Xwmc85
503	Xwmc405	551	Xwmc511	599	Xwmc632	647	Xwmc737	695	Xwmc89
504	Xwmc406	552	Xwmc513	600	Xwmc633	648	Xwmc740	696	Xwmc9
505	Xwmc407	553	Xwmc516	601	Xwmc640	649	Xwmc744	697	Xwmc93
506	Xwmc413	554	Xwmc517	602	Xwmc644	650	Xwmc745	698	Xwmc95
507	Xwmc415	555	Xwmc52	603	Xwmc646	651	Xwmc748	699	Xwmc96
508	Xwmc416	556	Xwmc522	604	Xwmc65	652	Xwmc75	700	Xwmc99
509	Xwmc417	557	Xwmc524	605	Xwmc650	653	Xwmc751
510	Xwmc418	558	Xwmc525	606	Xwmc651	654	Xwmc752
511	Xwmc419	559	Xwmc526	607	Xwmc652	655	Xwmc753
512	Xwmc420	560	Xwmc527	608	Xwmc653	656	Xwmc754
513	Xwmc422	561	Xwmc532	609	Xwmc654	657	Xwmc756
514	Xwmc426	562	Xwmc533	610	Xwmc657	658	Xwmc757
515	Xwmc428	563	Xwmc537	611	Xwmc658	659	Xwmc758
516	Xwmc43	564	Xwmc539	612	Xwmc661	660	Xwmc759
517	Xwmc430	565	Xwmc540	613	Xwmc662	661	Xwmc76
518	Xwmc434	566	Xwmc544	614	Xwmc664	662	Xwmc760
519	Xwmc435	567	Xwmc546	615	Xwmc667	663	Xwmc762
520	Xwmc44	568	Xwmc553	616	Xwmc672	664	Xwmc764
521	Xwmc441	569	Xwmc557	617	Xwmc673	665	Xwmc766
522	Xwmc445	570	Xwmc559	618	Xwmc674	666	Xwmc770
523	Xwmc446	571	Xwmc577	619	Xwmc675	667	Xwmc773

Table A2

List of polymorphic markers used in background selection.

S.No.	Markers	S.No.	Markers	S.No.	Markers	S.No.	Markers
1	Xbarc10	22	Xcfa2170	43	Xgwm155	64	Xgwm573
2	Xbarc128	23	Xcfa2187	44	Xgwm165	65	Xgwm6
3	Xbarc148	24	Xcfa2193	45	Xgwm186	66	Xgwm60
4	XBarc163	25	Xcfa2262	46	Xgwm191	67	Xgwm613
5	Xbarc197	26	Xcfd13	47	Xgwm192	68	Xgwm63
6	Xbarc212	27	Xcfd193	48	Xgwm2	69	Xgwm635
7	Xbarc229	28	Xcfd20	49	Xgwm234	70	Xgwm66
8	Xbarc23	29	Xcfd242	50	Xgwm249	71	Xwmc11
9	Xbarc232	30	Xcfd39	51	Xgwm251	72	Xwmc247
10	Xbarc417	31	Xcfd48	52	Xgwm294	73	Xwmc291
11	Xbarc69	32	Xcfd6	53	Xgwm304	74	Xwmc311
12	Xbarc73	33	Xcfd71	54	Xgwm328	75	Xwmc317
13	Xbarc83	34	Xcfd88	55	Xgwm332	76	Xwmc417
14	Xbarc98	35	Xgdm63	56	Xgwm334	77	Xwmc420
15	Xcfa2040	36	Xgwm11	57	Xgwm350	78	Xwmc44
16	Xcfa2076	37	Xgwm126	58	Xgwm382	79	Xwmc473
17	Xcfa2114	38	Xgwm131	59	Xgwm403	80	Xwmc500
18	Xcfa2121	39	Xgwm148	60	Xgwm46	81	Xwmc748
19	Xcfa2141	40	Xgwm149	61	Xgwm493	82	Xwmc76
20	Xcfa2155	41	Xgwm153	62	Xgwm495	83	Xwmc807
21	Xcfa2163	42	Xgwm154	63	Xgwm513

Figure 1

Representative gel picture of foreground selection for LrTrk in BC2F2 generation. Here, M: 100 bp ladder; P1: HD2967; P2: Trinakria; 1–22: BC2F2 plants; : Plants homozygous for LrTrk.

Thirty-two BC2F3 NILs and their RP HD2967 and DP Trinakria were also screened for leaf and stripe rust resistance at the seedling and the adult plant stages, respectively. Out of 32 NILs, 30 NILs were found to be resistant to leaf rust with I.T. ‘;1’ (Figure 2, Table 2 and Table 3), while 2 NILs gave a susceptible reaction with I.T. ‘3’. Of the 32 NILs tested for stripe rust resistance at the adult plant stage, 14 NILs were resistant. These 14 NILs were also resistant to leaf rust (Table 2). Thus, of the 32 NILs screened for rust resistance, 16 NILs were found to be resistant to leaf rust only, while 14 NILs showed resistance to both leaf and stripe rusts (Table 2). The NILs with only the leaf rust resistance gene LrTrk are henceforth referred to as HD2967 + LrTrk, while those with leaf and stripe rust resistance are referred to as HD2967 + LrTrk/YrTrk (YrTrk for stripe rust resistance gene(s) in Trinakria) in this paper. When tested against the leaf rust pathotype 77-5, HD2967 showed susceptibility to leaf rust at the seedling stage with an I.T. of ‘3-’ (Figure 2). When screened against the stripe rust pathotype 110S119 at the adult plant stage (rust response 60S), HD2967 was susceptible to stripe rust (Figure 3). Trinakria, the durum wheat genotype used as a donor for leaf and stripe rust resistance, displayed a high degree of leaf rust resistance with an I.T. ‘;’ (Figure 2; Table 3) and a resistance response (10R) against the stripe rust pathotype 110S119 at the adult plant stage (Figure 3; Table 3). The response of NILs to the leaf rust pathotype 77-5 and the stripe rust pathotype 110S119 can be seen in Figure 2 and Figure 3, respectively. All of the 6 NILs showed I.T. ‘;1′ to the leaf rust pathotype 77-5 when tested at the seedling stage, whereas only 2 NILs (HD2967 + LrTrk/YrTrk-137-21-82, HD2967 + LrTrk/YrTrk-137-21-19) showed a resistance response (10R) toward the stripe rust pathotype 110S119 at the adult plant stage (Figure 3).

Figure 2

NILs (HD2967 + LrTrk) along with their parents, HD2967, and Trinakria showing seedling response to leaf rust pathotype 77-5.

Table 2

Number of plants identified with leaf rust and stripe rust resistance in the BC2F3 generation and genome recovery of selected plants.

No. of plants screened for leaf and stripe rust	32
No. of plants resistant to leaf rust only	16
No. of plants resistant to both leaf and stripe rust	14
No. of plants selected for replicated trials	6
(RPG) recovery (%) of selected plants in replicated trial	97.59–98.79

Table 3

Phenotyping of NILs for leaf and stripe rust resistance at the seedling and the adult plant stages, respectively.

S. No.	Near Isogenic Lines of HD2967	ITs for Leaf Rust Race 77-5	Response to Stripe Rust Race 110S119
1	HD2967 + LrTrk/YrTrk-137-21-82	;1	10R
2	HD2967 + LrTrk/YrTrk-137-21-19	;1	10R
3	HD2967 + LrTrk-137-21-28	;1	40S
4	HD2967 + LrTrk-137-21-16	;1	30S
5	HD2967 + LrTrk-137-21-161	;1	40S
6	HD2967 + LrTrk-137-21-163	;1	40S
7	HD2967	3	60S
8	Trinakria	;	10R

Figure 3

HD2967 + LrTrk/YrTrk NILs along with their parents HD2967 and Trinakria showing adult plant response to stripe rust race 110S119.

Based on the yield, seed selection, and rust score of BC2F3 families, 6 NILs were selected for a detailed evaluation in replicated yield trials. Two of the selected NILs were resistant to leaf and stripe rusts (Table 3), while the remaining four showed resistance to leaf rust only. The RPG recovery of these 6 NILs ranged from 97.59% to 98.79%. Graphical representation of the 6 NILs showed recovery of the recurrent parent genome in all chromosomes except in chromosomes 2A, 3B, 5A and 6A, where some residual donor segments were found to be present in the heterozygous state (Figure 4). For the background analysis of the 6 NILs in the BC2F4 generation, D genome-specific SSR markers were also used. It was observed that all of the D genome-specific markers were monomorphic between HD2967 and HD2967 + LrTrk/YrTrk NILs, and no amplification was observed in Trinakria (Figure 5). Marker analysis with 2NS/2AS specific markers showed that all of these six NILs carried Ae. ventricosa translocation, having rust resistance genes Lr37/Sr38/Yr17 (Figure 6).

Figure 4

Graphical representation of HD2967 NILs carrying leaf rust resistance gene LrTrk and leaf and stripe rust resistance gene LrTrk/YrTrk, showing the extent of recurrent parent genome recovery.

Figure 5

Representative gel picture showing recovery of the D genome in all of the NILs derived from HD2967; (a) Xcfd67, (b) Xcfd84, (c) Xcfd165: D genome specific markers; M: 100 bp ladder, P1: HD2967, P2: Trinakria, 1–6: HD2967 NILs carrying LrTrk.

Figure 6

Amplification with 2NS specific primer pair, VENTRIUP, and LN2. Here, M: 100 bp ladder, 1: Thatcher+Lr37 (+ve control); 2: Agra Local; 3: Kharchia Local; 4: HD2967; 5: Trinkria; 6–11: HD2967 + LrTrk NILs.

2.2. Evaluation of HD2967 NILs for Yield-Related Traits

Six NILs were selected for a detailed evaluation of agro-morphological traits in replicated trials based on their yield in the BC2F3 generation, seed selection, and rust evaluation. These 6 NILs consisted of 4 NILs with only leaf rust resistance and 2 NILs with leaf and stripe rust resistance. The mean performance of six near isogenic lines for yield and yield-related traits is presented in Table 4. While all of the NILs were found to have similar heights as that of RP HD2967, the NIL HD2967 + LrTrk/YrTrk-137-21-82 was observed to be significantly taller. The NILs HD2967 + LrTrk/YrTrk-137-21-82 and HD2967 + LrTrk-137-21-163 showed significant superiority for spike length (S.L.) compared to HD2967. Out of these two, NIL HD2967 + LrTrk/YrTrk-137-21-82 showed a significantly higher number of spikelets/spike (NSpl) than HD2967. The NIL HD2967 + LrTrk-137-21-16 showed a significantly lower spike length (S.L.) and a significantly lower number of spikelets/spike (NSpl). Though there was a difference in spike length (S.L.) and in the number of spikelets/spike (NSpl) in different NILs, all of the NILs showed at par performance for the trait number of seeds/spike (NS). Two NILs, HD2967 + LrTrk-137-21-28 and HD2967 + LrTrk-137-21-161, showed a significantly higher thousand kernel weight (TKW), but their yields were at par with RP HD2967. Overall, all of the NILs of HD2967 produced yield at par with HD2967, and the differences in yield were non-significant.

Table 4

Morphological characterization of NILs of HD2967 carrying leaf rust resistance gene LrTrk.

NILs	PH	SL	NSpl	NS	TKW (gm)	YLD (kg)
HD2967 + LrTrk/YrTrk-137-21-82	111.40 *	13.72 *	25.80 *	75.60	37.25	3.94
HD2967 + LrTrk/YrTrk-137-21-19	104.40	12.62	23.40	73.20	37.75	3.69
HD2967 + LrTrk-137-21-28	100.20	11.04	22.20	71.40	42.00 *	4.02
HD2967 + LrTrk-137-21-16	103.20	10.52 *	21.80 *	68.20	37.00	3.42
HD2967 + LrTrk-137-21-161	99.80	11.68	22.60	71.80	42.00 *	4.11
HD2967 + LrTrk -137-21-163	101.40	13.18 *	24.20	75.20	37.00	3.71
HD2967	101.20	11.78	23.40	72.00	36.50	3.63
Mean	103.08	12.07	23.34	72.48	38.5	3.78
SD	4.46	1.34	1.54	5.59	2.52	0.28
CD	3.58	1.18	1.31	7.37	3.8	0.59

PH: Plant Height; SL: Spike length; NSpl: No. of spikelets per spike; NS: No. of seeds per spike; TKW: Thousand Kernel Weight; YLD: Plot yield in kg; * Significantly different from recurrent parent HD2967.

3. Discussion

The durum wheat genotype Trinakria showed a high degree of resistance against leaf and stripe rusts. A leaf rust resistant gene, tentatively named LrTrk, was mapped on chromosome 5BS in Trinakria [30]. The variety HD2967 is a popular bread wheat, and incorporation of leaf and stripe rust resistance from Trinakria will enhance the usefulness of the variety, which over the years has become highly susceptible to stripe rust, with a moderate susceptibility to leaf rust. Since the leaf rust resistance gene LrTrk in Trinakria was mapped, and the SSR marker Xgwm234 was linked to the resistant gene, a marker-assisted backcrossing program was initiated to transfer the leaf rust resistance gene LrTrk into HD2967. Though information about a linkage between LrTrk and the stripe rust resistance gene(s) in Trinakria was not available, we presumed that some of the lines developed by selecting marker-assisted LrTrk would also be resistant to stripe rust, enabling us to choose lines carrying both leaf and stripe rust resistance in the genetic background of HD2967.

Trinakria is a durum wheat genotype and tetraploid wheat (2n = 4x = 28, genome AABB), while cultivar HD2967 is a hexaploid bread wheat (2n = 6x = 42, genome AABBDD). HD2967 was used as a female parent, and Trinakria was used as the pollen parent. All F1 plants are expected to be aneuploid (pentaploid) with 2n = 2x = 35 chromosomes and to show high pollen sterility. However, F1 plants can be easily emasculated and be crossed as a female parent with normal fertile pollens provided by the recurrent parent HD2967 in backcrossing. The spikes of five F1 plants were pollinated with HD2967 pollens to produce sufficient seeds for the BC1F1 generation. The BC1F1 seeds were a mixture of well-filled and shriveled seeds. This was on expected lines as F1 plants, being pentaploid, produce gametes with aneuploid chromosome numbers. The seven D genome chromosomes in F1 plants contributed by HD2967 segregate randomly during gamete formation. Theoretically, the chromosome number in gametes produced by F1 plants are expected to vary from 14 to 21. BC1F1 plants are expected to carry chromosome numbers ranging from 35 to 42. The BC1F1 seeds carrying unbalanced chromosome numbers are expected to have poor endosperm development, which was reflected in the BC1F1 seed, a mixture of seeds with poorly filled and well-filled endosperm. Only seeds with well-developed endosperm were sown. In the BC1FI generation, though 60 plants were identified as carrying the leaf rust resistance gene LrTrk, only 10 plants resembling HD2967 phenotypically were selected for background selection. A plant with a maximum RPG recovery of 83.13% was chosen for further backcrossing. Phenotypic selection combined with marker-assisted background selection in the BC1F1, BC2F1 and BC2F2 generations resulted in a rapid recovery of the background genome of HD2967 from 83.13% in BC1F1 to 93.37% and 98.79% in the BC2F1 and the BC2F2 generations, respectively. However, the RPG recovery of 97.59–98.79% applies only to A and B genomes of NILs; the D genome in NILs is entirely derived from HD2967 and it is expected to remain unaltered. Molecular markers have been effectively used to select rust resistant genes in wheat [20,21,22,23]. The effectiveness of molecular markers is also reflected in our study wherein out of 32 NILs identified as carrying LrTrk with the linked marker Xgwm234, only two NILs were susceptible to leaf rust. At the same time, the remaining 30 lines were resistant. Crossing over between a molecular marker and a rust resistant gene is expected as Xgwm234 is not a gene-specific marker. Screening of 32 NILs for stripe rust resistance in BC2F3 at the adult plant stage identified 14 NILs that carried stripe rust resistance. Thus, combining marker-assisted selection for leaf rust resistance and phenotypic selection for stripe rust resistance enabled the accelerated development of the NILs of the wheat variety HD2967 carrying resistance to both leaf and stripe rusts. Marker-assisted background selection accelerated the recovery of RPG of HD2967 with NILs in BC2F3 showing more than a 97% recovery of RPG. The marker-assisted background analysis was restricted to wheat’s A and B genome only because the donor parent Trinakria lacked the D genome. Thus, the entire D genome in NILs is expected from HD2967, which was also demonstrated in a polymorphism study among HD2967, Trinakria, and NILs. All of the D genome-specific markers used in the study were monomorphic between HD2967 and the NILs, and they failed to amplify in the donor parent Trinakria (Figure 5). The use of a tetraploid donor thus enabled the complete recovery of the D genome in the NILs of HD2967.

The wheat variety HD2967 was shown to carry Ae. ventricosa translocation 2NS/2AS, which harbors the linked APR genes Lr37, Yr17 and Sr38 [31]. Six NILs that were finally selected for yield evaluation were screened for 2NS specific markers. The results showed that all of the six NILs carried 2NS/2AS translocation. Thus, out of six NILs, four had 2NS/2AS translocation in addition to the LrTrk gene for leaf rust resistance, while the remaining two NILs carried LrTrk/YrTrk and 2NS/2AS translocation. While Lr37 is an adult plant resistant gene, LrTrk is a seedling resistance gene. Additionally, Lr37 is susceptible to several pathotypes of P. triticina [32]. Thus, LrTrk and Lr37 will provide enhanced resistance against P. triticina in the NILs. Among the six NILs, two were resistant to both leaf and stripe rusts (Table 3). These two lines carried YrTrk along with Yr17; although Yr17 is ineffective against P. striiformis pathotypes [33], making HD2967 susceptible to stripe rust. The NILs of HD2967 developed in this study will provide improved versions of HD2967 with leaf and stripe rust resistance and they will yield at par with HD2967.

4. Materials and Method

4.1. Plant Materials and Backcross Breeding Scheme

The bread wheat variety HD2967 was used as a recurrent parent in the backcross breeding program. The durum wheat genotype Trinakria was used as a donor for leaf and stripe rust resistance. Earlier, a leaf rust resistant gene named LrTrk was identified and mapped on chromosome 5BS in Trinakria [30]. Marker-assisted backcross breeding was used to transfer leaf rust resistance from Trinakria into HD2967 using a linked SSR marker, while conventional pathotype based screening was performed to select plants for stripe rust resistance. The variety HD2967 was crossed as a female parent with Trinakria to produce the F1 generation. The F1 generation was raised, and the hybridity of F1 plants was confirmed using the SSR marker Xgwm234 (F: 5′ GAGTCCTGATGTGAAGCTGTTG 3′; R: 5′ CTCATTGGGGTGTGTACGTG 3′) linked to the leaf rust resistance gene LrTrk. True F1 plants were backcrossed with the recurrent parent (RP) HD2967 to produce the BC1F1 generation. Foreground selection was carried out for the leaf rust resistance gene LrTrk with the linked SSR marker Xgwm234 in BC1F1. Plants carrying LrTrk were subsequently subjected to phenotypic selection for their resemblance to RP HD2967 before background selection using SSR markers showing polymorphism between HD2967 and Trinakria. Ten plants phenotypically resembling HD2967 were used for background analysis. A parental polymorphism survey between HD2967 and Trinakria was carried out with 700 SSR markers, well distributed across A and B genomes of wheat. The plant showing a maximum recovery of the recurrent parent genome (RPG) in the BC1F1 generation was again backcrossed to HD2967 to produce the BC2F1 generation. In the BC2F1 generation, foreground and background selections were also performed, as was done in the BC1F1 generation. The plant carrying LrTrk and a maximum RPG recovery was selfed to produce the BC2F2 generation. In the BC2F2 generation, plants having the leaf rust resistance gene LrTrk in the homozygous state were identified and analyzed for their background recovery. A plant with a maximum RPG recovery in the BC2F2 generation was self-pollinated by covering the spikes with butter paper bags to produce the BC2F3 families. The selection among the BC2F3 families was made based on the yield and the RPG%. The selected BC2F4 lines were evaluated in replicated yield trials.

4.2. Marker Analysis

DNA was extracted from one month old seedlings using the CTAB method [34]. The DNA samples were quantified, and their quality was confirmed using a NanoDropTM spectrophotometer. The DNA samples were diluted to a concentration of 25 ng/μL as working stock and then stored at −20 °C. A PCR reaction was carried out with SSRs in a reaction volume of 10 μL, comprising 4 μL of 2× GoTaq PCR Master Mix (Promega, #M7122), 1 μL of each primer (5 pmol/ul), 2 μL of nuclease-free water, and 2 μL of 25 ng/μL gDNA (50 ng) in 96-well PCR plates with a thermal seal in an Eppendorf thermal cycler. A thermal profile of 4 min at 94 °C (initial denaturation), followed by 35 cycles of 30 s at 94 °C (denaturation), 30 s at 50–60 °C (varying according to primer annealing temperature), and 30 s at 72 °C (primer extension), with a final extension at 72 °C for 10 min were used in a PCR machine for amplification of the SSR markers. The amplified products were resolved on 3.5% agarose gel and then visualized on a U.V. trans-illuminator Gel Documentation System (G: Box, Syngene). The RPG recovery was calculated as the number of homozygous loci corresponding to the recurrent parent + half the number of heterozygous loci/total number of polymorphic SSR markers used ×100. As parental polymorphism was not conducted for markers belonging to the D genome, a confirmation PCR was performed in the BC2F4 generation to identify the recovery of the D genome. Markers specific to the D genome were selected and then used for amplification in HD2967, Trinakria, and the six NILs carrying the LrTrk gene. The RPG recovery of 14 chromosomes belonging to the A and the B genomes of wheat was visualized using Graphical GenoTypes (GGT) Version 2.0 software [35].

The selected NILs were also screened for the presence of Ae. ventricosa translocation 2NS/2AS carrying linked rust resistance genes Lr37, Yr17 and Sr38 present in RP HD2967 using 2NS specific primer pair, VENTRIUP + LN2 [33]. The PCR reaction was performed according to the profile used by [36]. A Thatcher+Lr37 (RL6081) was used as a positive control, whereas Agra Local and Kharchia Local were used as a negative control to confirm the presence of the 2NS/2AS translocation.

4.3. Screening of NILs for Rust Resistance

The NILs in the BC2F3 generation were screened for both leaf and stripe rust resistance. Screening for leaf rust resistance was carried out with the P. triticina pathotype 77-5 at the seedling stage in a glasshouse. Screening for stripe rust resistance was performed in the field with the P. striiformis pathotype 110S119 at the adult plant stage. In India, pathotypes 77-5 and 110S119 are some of the most virulent and prevalent pathotypes of leaf and stripe rusts, respectively. Initial inoculums were obtained from the ICAR-Indian Institute of Wheat and Barley Research (IIWBR), Regional Station, Flowerdale, Shimla, and they multiplied on the susceptible common wheat cultivar Agra Local at IARI, New Delhi.

For screening of leaf rust resistance, the NILs, RP HD2967, and susceptible check Agra Local were sown in aluminum trays (4 × 10 × 3 inches) in the glasshouse. Ten-day-old seedlings were inoculated with the leaf rust pathotype 77-5 by spraying the inoculum with a hand sprayer. The inoculation mixture was prepared by adding urediospores in water with a drop of Tween 20. After inoculation, the trays were kept in humid glass chambers for 48 h and subsequently shifted to glass house benches under ambient light and temperature conditions. A rust response (infection type) was recorded 12 days after inoculation, as described by Stakmann et al. (1962) [37].

For stripe rust screening, parents HD2967 and Trinakria and NILs carrying leaf rust resistance gene LrTrk were sown in yellow rust nursery in 1m rows each. Infector rows were planted after every 20 rows. To ensure uniform disease spread, one row of infector between two 1m row beds and two rows of infectors surrounding the test material were also planted. The spores of the stripe rust pathotype 110S119 were sprayed as a suspension in water fortified with Tween 20 at the booting stage. The inoculum mixture was sprayed thrice at the booting stage with two–three days interval. The plant response to stripe rust was scored based on the Modified Cobb’s scale [38] and disease severity (0–100%).

4.4. Evaluation of HD2967 + LrTrk NILs for Agro-Morphological Traits

Following the recommended package of practices at IARI, New Delhi, NILs, HD2967 + LrTrk, HD2967 + LrTrk/YrTrk, and the recurrent parent HD2967 were evaluated for agro-morphological traits in a randomized complete block design with two replications. The data on plant height (P.H.), spike length (S.L.), thousand kernel weight (TKW), the number of spikelets per spike (NSplSp), and the number of seeds per spike (NSSp) were recorded on 5 randomly selected plants from the inside rows of each plot. Each plot of 6 m2 size was harvested by machine and their plot yield (in kg) from each replication was recorded. The data on morphological traits was analyzed using OPSTAT statistical software (CCS HAU, Hisar) [39].