| Literature DB >> 35547591 |
HaoHang Fang1,2, ZhenXiao Zhuang1, LuoDong Huang3, Jin Niu1, Wei Zhao1.
Abstract
Haematococcus pluvialis can be used as a green additive in aquafeeds due to it contains rich astaxanthin and polyunsaturated fatty acid. In the present study, a newly strain of H. pluvialis GXU-A23 with high concentration of astaxanthin was firstly isolated by a newly culture strategy in our laboratory. In addition, H. pluvialis GXU-A23 was applied in the Litopenaeus vannamei feed for determining whether it has positive effects on the growth performance, antioxidant and anti-inflammatory status, metabolic capacity and mid-intestine morphology of juvenile L. vannamei. Shrimp with 0.63 g approximately initial body weight were fed diets supplemented with/without 50 g/kg H. pluvialis GXU-A23. After 8 weeks feeding intervention, significantly higher growth performance of L. vannamei was obtained in the H. pluvialis GXU-A23 treatment group compared to the control group (p < 0.05). At the same time, L. vannamei fed with H. pluvialis GXU-A23 acquired significantly better antioxidant and anti-inflammatory status than the control group (p < 0.05). In addition, higher RNA expression level of hepatopancreas digestive enzyme, hepatopancreas lipid and glucose metabolic enzymes as well as better mid-intestine morphology were found in the H. pluvialis GXU-A23 treatment group than the control group (p < 0.05). These results indicated that 50 g/kg H. pluvialis GXU-A23 was suitable for the L. vannamei feed, which could improve the growth performance, antioxidant and anti-inflammatory status, metabolic capacity and mid-intestine morphology of juvenile L. vannamei.Entities:
Keywords: Haematococcus pluvialis GXU-A23; Litopenaeus vannamei; growth performance; hepatopancreas health; intestine morphology; metabolism
Year: 2022 PMID: 35547591 PMCID: PMC9081789 DOI: 10.3389/fphys.2022.882091
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Ingredients and proximate compositions of two experimental diets (g/kg).
| Ingredients | D1 | D2 |
|---|---|---|
| Fish meal | 250 | 250 |
| Soybean meal | 270 | 270 |
| Peanut meal | 120 | 120 |
| Wheat flour | 234 | 184 |
| Beer yeast | 30 | 30 |
| Shrimp bran powder | 30 | 30 |
| Fish oil | 10 | 10 |
| Soybean lecithin | 10 | 10 |
| Soybean oil | 10 | 10 |
| Choline chloride (50%) | 5 | 5 |
| Vitamin C phosphate | 1 | 1 |
| Vitamin and mineral premix | 20 | 20 |
| Monocalcium phosphate | 10 | 10 |
|
| 0 | 50 |
| Sum | 1000 | 1000 |
| Nutrient levels | ||
| Moisture | 7.45 | 7.63 |
| Crude lipid | 7.12 | 7.01 |
| Crude protein | 40.52 | 40.74 |
| Ash | 9.46 | 9.59 |
| Astaxanthin | – | 0.16 |
Composition of vitamin and mineral mixture (kg−1 of mixture): vitamin A, 250,000 IU; riboflavin, 750 mg; pyridoxine HCL, 500 mg; cyanocobalamin, 1 mg; thiamin, 500 mg; menadione, 250 mg; folic acid, 125 mg; biotin, 10 mg; a-tocopherol, 3750 mg; myo-inositol, 2500 mg; calcium pantothenate, 1250 mg; nicotinic acid, 2000 mg; vitamin D3, 45,000 IU; vitamin C, 7000 mg, Zn, 4000 mg; K, 22.500 mg; I, 200 mg; NaCl, 2.6 g; Cu, 500 mg; Co., 50 mg; FeSO4, 200 mg; Mg, 3000 mg; Se, 10 mg.
Haematococcus pluvialis GXU-A23: 33 g/kg astaxanthin (Dry matter).
Measured values (Dry matter).
Sequences of primers used for real-time quantitative PCR.
| Gene | Primer Sequence (5′-3′) | References |
|---|---|---|
|
| TGGCTGTGAACAAGATGGAC |
|
|
| AGATGGGGATGATTGGGACC | |
|
| CCGTGCAGATTACGTGAAGG |
|
|
| GTCGCCACGAGAAGTCAATG | |
|
| GGCACCAGGAGAACACTAC |
|
|
| CGACTTTGCCGAACATAAC | |
|
| TACTGCAAGTTCCATTACAAGACG |
|
|
| GTAATTCTTTGGATTGCGGTCA | |
|
| CTACATTCTGCCCTTGACTCTGG |
|
|
| GGCTGGCAAGTCGTTCTCG | |
|
| GTGATGGTGCCTGTGGTAAA |
|
|
| GCCTCAATCTGTCATAGTCCTC | |
|
| GGCTCTCTTCATCGACG |
|
|
| CGTGAGTGAAGAAGTCGG | |
|
| TCCAAGATCATCCAACACGA |
|
|
| GACCCTGAGCGGGAATATC | |
|
| AGTCGCAGCAACAGGAAGTT |
|
|
| CGCTCTTCTGGCACATGATA | |
|
| GCGTGATAACTGGGTGTCCT |
|
|
| ACGTGTGGGTTATGGTGGAT |
Growth performance and feed utilization of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days.
| D1 | D2 | |
|---|---|---|
| IBW | 0.64 ± 0.01 | 0.63 ± 0.01 |
| FBW | 5.98 ± 0.03 | 6.25 ± 0.01 |
| WGR | 828.31 ± 15.07 | 925.12 ± 14.84 |
| SGR | 3.98 ± 0.03 | 4.16 ± 0.03 |
| FCR | 1.24 ± 0.03 | 1.17 ± 0.01 |
| SR | 96.25 ± 1.25 | 96.88 ± 0.63 |
IBW (g per shrimp): initial body weight.
FBW (g per shrimp): final body weight.
Weight gain rate (WGR, %) = 100 * (final body weight—initial body weight)/initial body weight.
Specific growth rate (SGR, % day−1): 100× (Ln final shrimp weight - Ln initial shrimp weight)/the experimental duration in days.
Feed conversion ratio (FCR) = dry diet fed/wet weight gain.
Survival rate (SR) (%) = 100 * (final number of shrimp)/(initial number of shrimp).
Values are mean ± SE (n = 4). Means in the same row with different superscripts are significantly different (p < 0.05).
Hepatopancreas and hemolymph antioxidant status parameters of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days.
| D1 | D2 | |
|---|---|---|
| Hepatopancreas | ||
| T-SOD (U/mgprot) | 10.4 ± 0.88a | 5.61 ± 1.00b |
| T-AOC (U/mgprot) | 0.27 ± 0.01 | 0.18 ± 0.03 |
| GSH-PX (U/mg prot) | 624.12 ± 49.36a | 233.92 ± 56.78b |
| MDA (nmol/mgprot) | 1.26 ± 0.03 | 1.1 ± 0.08 |
| Hemolymph | ||
| T-SOD (U/mL) | 273.75 ± 6.08a | 239.53 ± 9.52b |
| T-AOC (U/mL) | 3.7 ± 0.12 | 3.66 ± 0.23 |
| GSH-PX (U/mL) | 419.35 ± 54.11 | 380.65 ± 19.36 |
| MDA (mmol/ml) | 8.27 ± 1.04a | 3.84 ± 0.21b |
Values are mean ± SE (n = 4).
Means in the same row with different superscripts are significantly different (p < 0.05).
FIGURE 1Hepatopancreas mRNA levels of antioxidative genes of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days. Values are mean ± SE (n = 4). The small letters indicated significant differences at p < 0.05.
FIGURE 2Hepatopancreas mRNA levels of anti-inflammatory genes of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days. Values are mean ± SE (n = 4). The small letters indicated significant differences at p < 0.05.
FIGURE 3Hepatopancreas mRNA levels of digestive enzyme genes of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days. Values are mean ± SE (n = 4). The small letters indicated significant differences at p < 0.05.
FIGURE 4Hepatopancreas mRNA levels of metabolic enzymes genes of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days. Values are mean ± SE (n = 4). The small letters indicated significant differences at p < 0.05.
FIGURE 5Light microscopy of mid-intestine morphology of L. vannamei fed diet supplemented with/without H. pluvialis GXU-A23 for 56 days. The scale bars of picture (A,B) were 100 μm, while the scale bars of picture (C,D) were 25 μm respectively. Picture (E,F) represents the intestinal mucosal layer thickness and intestinal villi height of L. vannamei respectively. Values are mean ± SE (n = 4). The small letters indicated significant differences at p < 0.05.