| Literature DB >> 35547586 |
Jiaxing Li1, Ningning Fu1, Lili Ren1, Youqing Luo1.
Abstract
A special mutual relationship exists between the pine wood nematode (PWN) Bursaphelenchus xylophilus and its vector beetles of genus Monochamus, which enables PWN to spread, at the same time provides longhorned beetles with more weak hosts. PWN are attracted to the pupal chambers and then carried inside the trachea of beetle adults, which is a necessary part to complete the B. xylophilus infection cycle. The growth and immune responses of the vector beetle will affect this carrying process, however, they were rarely studied in Monochamus saltuarius. Real-time quantitative polymerase chain reaction (RT-qPCR), one of the most common methods for quantitative gene expression analysis, was performed to explore the key genes and pathways involved in the growth, development and immune responses of M. saltuarius at different developmental stages associated with infection of PWN and PWN treatment conditions. To enhance the accuracy of RT-qPCR data, the expression of target genes needs to be normalized with reference genes, which are stably expressed under varied experimental conditions. In our study, the stability of 14 candidate reference genes in M. saltuarius samples at different developmental stages associated with infection of PWN or PWN treatment conditions was evaluated using delta Ct, geNorm, NormFinder, BestKeeper and RefFinder algorithms. Moreover, KLF gene was used to validate the stability of the selected reference genes. Under experimental conditions of this study, RPL7 and TER were suitable reference genes at different developmental stages associated with infection of PWN. RPL7 and RPS5 were considered the most stable reference genes in the pupae treated with PWN. RPS5 and SNX6 could be used as reference genes in the adults treated with PWN. RPL7, EF1-γ, and RPS5 could be used as stable reference genes in all the samples. This work is the first to evaluate reference genes in M. saltuarius, laying a foundation for further gene expression experimental procedures and understanding the phoretic relationship between M. saltuarius and B. xylophilus.Entities:
Keywords: Bursaphelenchus xylophilus; Monochamus saltuarius; RT-qPCR; developmental stages; reference genes
Year: 2022 PMID: 35547586 PMCID: PMC9082747 DOI: 10.3389/fphys.2022.882792
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Primer sequences and amplification characteristics of candidate reference genes.
| Accession Number | Symbol | Gene Name | Primer sequence (5′to3′) | Size (bp) | E (%) |
|
|---|---|---|---|---|---|---|
| Gene_ MSAL09320 |
| sorting nexin-6 | F: CGTTATGAGGAGGAACCCAAATA | 119 | 97 | 0.998 |
| R: CTCATGGTTCCTTCACCTTCTC | ||||||
| Gene_ MSAL04397 |
| probable phospholipid-transporting ATPase | F: GAACTCGGCAGGATCTCTTATT | 99 | 90 | 0.994 |
| R: ATAGCTGACCGTACCCAAATG | ||||||
| Gene_ MSAL02314 |
| Palmitoyltransferase ZDHHC15 isoform X2 | F: CGAGGTGTTGGTACAGACAAA | 144 | 109 | 0.998 |
| R: GCGTGAGTGTACAGGGTATTC | ||||||
| Gene_ MSAL10600 |
| transcription factor A, mitochondrial-like | F: CAATGGCAGACTGGGAAGAA | 115 | 97.1 | 0.991 |
| R: CTGCCTGGTTTCAACTGTCTA | ||||||
| Gene_ MSAL00760 |
| 60S ribosomal protein L18 | F: AACGGTATTGATGCAAGGTAGA | 103 | 104.2 | 0.998 |
| R: GGAACGTACTAGTGGCTTAGTG | ||||||
| Gene_ MSAL00096 |
| 60S ribosomal protein L7 | F: GGCAACGCATTCCCATAAC | 109 | 105.4 | 0.998 |
| R: CTTGGACCGACTGTGAAGAT | ||||||
| Gene_ MSAL00148 |
| 40S ribosomal protein S5 | F: CGTAGGGTAAACCAGGCTATC | 122 | 94.7 | 0.999 |
| R: GAGGAACCCTTAGCAGCATTA | ||||||
| Gene_ MSAL03702 |
| transitional endoplasmic reticulum ATPase TER94 | F: GTCGTTGCTCTTTCACAAGC | 203 | 100.2 | 0.998 |
| R: CAAGGCTGGATGGACACTAC | ||||||
| Gene_ MSAL09667 |
| transmembrane and ubiquitin-like domain-containing protein 1 | F: CGTAGTCTGCCTTCTGACAATAA | 97 | 90.9 | 0.999 |
| R: ACATCTCCTCCAACCTACCA | ||||||
| Gene_ MSAL09352 |
| eukaryotic translation initiation factor 4B | F: CGACGATAGGGATGATCGTAAAG | 124 | 94.3 | 0.998 |
| R: CCTTTCCCTTGGTTCTGACATA | ||||||
| Gene_ MSAL06575 |
| elongation factor 1-gamma | F: ACAGCAACGCTATCGCTTAT | 103 | 90.7 | 0.999 |
| R: TCACCTTCGGCAAATCCTATC | ||||||
| Gene_ MSAL03188 |
| cytochrome c oxidase subunit 7C, mitochondrial-like | F: GTGGTGTACCTGGAGCGAAT | 114 | 91.8 | 1.000 |
| R: GTCTCAAGATGAGGAAAGGTGC | ||||||
| Gene_ MSAL09430 |
| tubulin alpha-1 chain | F: CCCTTACCCACGTATTCACTTC | 98 | 91.7 | 1.000 |
| R: TGGTAATTTCAGCCACGGATAG | ||||||
| Gene_ MSAL06278 |
| triosephosphate isomerase | F: ATCGGTGAGACCTTAGAGGAA | 102 | 94 | 0.999 |
| R: CACGTTCGACCAGTCTTTGA | ||||||
| Gene_ MSAL01719 |
| Krüppel-like factor luna | F: GCAGAGACTTTGACTCCTCCC | 144 | 95.4 | 0.998 |
| R: GGCTCGCACTCTGACTATTGT |
FIGURE 1Cycle threshold (Ct) values of 14 candidate reference genes across total samples in M. saltuarius. Boxes indicate the 25th and 75th percentiles, and lines in the boxes represent the median value.
Expression stability ranking of the 14 candidate reference genes based on five algorithms.
| Conditions | Genes | Delta Ct | geNorm | NormFinder | BestKeeper | RefFinder | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Avg. Ct | Rank | M | Rank | SV | Rank | SD + CV | Rank | GM | Rank | ||
| TER | 0.71 | 1 | 0.55 | 6 | 0.27 | 1 | 0.54 | 6 | 2.45 | 1 | |
| RPL7 | 0.76 | 4 | 0.38 | 1 | 0.36 | 6 | 0.44 | 3 | 2.91 | 2 | |
| RPS5 | 0.89 | 9 | 0.38 | 2 | 0.43 | 9 | 0.40 | 1 | 3.08 | 3 | |
| Zdhhc15 | 0.73 | 2 | 0.48 | 4 | 0.31 | 3 | 0.52 | 5 | 3.31 | 4 | |
| EF1-γ | 0.74 | 3 | 0.52 | 5 | 0.29 | 2 | 0.48 | 4 | 3.31 | 5 | |
| RPL18 | 0.77 | 6 | 0.41 | 3 | 0.34 | 5 | 0.43 | 2 | 3.66 | 6 | |
| Developmental | Tmub1 | 0.77 | 5 | 0.56 | 7 | 0.33 | 4 | 0.58 | 7 | 5.60 | 7 |
| Stages | SNX6 | 0.80 | 7 | 0.59 | 8 | 0.40 | 7 | 0.63 | 8 | 7.48 | 8 |
| ATPase | 0.86 | 8 | 0.61 | 9 | 0.43 | 10 | 0.83 | 10 | 8.71 | 9 | |
| TFAM | 0.92 | 10 | 0.67 | 10 | 0.43 | 8 | 0.82 | 9 | 9.49 | 10 | |
| α-TUB | 1.00 | 12 | 0.71 | 11 | 0.57 | 13 | 0.86 | 12 | 11.72 | 11 | |
| EIF | 0.95 | 11 | 0.76 | 12 | 0.54 | 12 | 0.98 | 13 | 11.72 | 12 | |
| TPI | 1.01 | 13 | 0.80 | 13 | 0.49 | 11 | 0.86 | 11 | 12.49 | 13 | |
| COX7 | 1.36 | 14 | 0.88 | 14 | 0.78 | 14 | 1.23 | 14 | 14.00 | 14 | |
| RPL7 | 0.57 | 1 | 0.13 | 1 | 0.11 | 1 | 0.18 | 1 | 1.00 | 1 | |
| RPS5 | 0.60 | 2 | 0.13 | 2 | 0.16 | 3 | 0.21 | 2 | 1.68 | 2 | |
| RPL18 | 0.66 | 5 | 0.28 | 3 | 0.15 | 2 | 0.24 | 3 | 3.87 | 3 | |
| EF1-γ | 0.65 | 4 | 0.50 | 7 | 0.18 | 6 | 0.37 | 5 | 4.53 | 4 | |
| TFAM | 0.65 | 3 | 0.48 | 6 | 0.21 | 7 | 0.45 | 6 | 4.56 | 5 | |
| Tmub1 | 0.75 | 7 | 0.36 | 4 | 0.17 | 4 | 0.35 | 4 | 5.29 | 6 | |
| Pupae treated | TER | 0.70 | 6 | 0.43 | 5 | 0.18 | 5 | 0.46 | 7 | 5.96 | 7 |
| with PWN | TPI | 0.79 | 8 | 0.60 | 10 | 0.27 | 10 | 0.54 | 10 | 8.94 | 8 |
| ATPase | 0.79 | 9 | 0.53 | 8 | 0.28 | 11 | 0.49 | 9 | 8.97 | 9 | |
| SNX6 | 0.80 | 10 | 0.56 | 9 | 0.26 | 9 | 0.61 | 12 | 10.44 | 10 | |
| EIF | 0.80 | 11 | 0.63 | 11 | 0.21 | 8 | 0.60 | 11 | 10.46 | 11 | |
| Zdhhc15 | 1.00 | 13 | 0.72 | 13 | 0.34 | 13 | 0.47 | 8 | 11.51 | 12 | |
| α-TUB | 0.96 | 12 | 0.67 | 12 | 0.30 | 12 | 0.82 | 14 | 12.47 | 13 | |
| COX7 | 1.11 | 14 | 0.77 | 14 | 0.35 | 14 | 0.73 | 13 | 13.74 | 14 | |
| RPS5 | 0.41 | 2 | 0.12 | 2 | 0.10 | 2 | 0.19 | 1 | 1.41 | 1 | |
| SNX6 | 0.40 | 1 | 0.17 | 3 | 0.05 | 1 | 0.21 | 2 | 1.57 | 2 | |
| RPL7 | 0.43 | 3 | 0.12 | 1 | 0.12 | 3 | 0.23 | 3 | 2.28 | 3 | |
| EF1-γ | 0.44 | 4 | 0.22 | 4 | 0.12 | 4 | 0.31 | 5 | 4.23 | 4 | |
| Zdhhc15 | 0.48 | 5 | 0.27 | 5 | 0.20 | 8 | 0.29 | 4 | 4.73 | 5 | |
| TFAM | 0.50 | 6 | 0.30 | 6 | 0.13 | 5 | 0.40 | 9 | 6.64 | 6 | |
| Adults treated | Tmub1 | 0.52 | 7 | 0.34 | 7 | 0.18 | 6 | 0.42 | 10 | 7.65 | 7 |
| with PWN | TER | 0.56 | 8 | 0.37 | 8 | 0.23 | 12 | 0.47 | 11 | 8.66 | 8 |
| COX7 | 0.59 | 11 | 0.45 | 11 | 0.23 | 10 | 0.34 | 6 | 9.45 | 9 | |
| ATPase | 0.58 | 9 | 0.40 | 9 | 0.19 | 7 | 0.55 | 12 | 9.67 | 10 | |
| TPI | 0.60 | 12 | 0.47 | 12 | 0.23 | 11 | 0.38 | 7 | 10.49 | 11 | |
| EIF | 0.59 | 10 | 0.42 | 10 | 0.22 | 9 | 0.63 | 13 | 10.68 | 12 | |
| RPL18 | 0.64 | 13 | 0.49 | 13 | 0.25 | 13 | 0.39 | 8 | 11.51 | 13 | |
| α-TUB | 0.79 | 14 | 0.54 | 14 | 0.30 | 14 | 0.73 | 14 | 14.00 | 14 | |
| RPL7 | 0.73 | 1 | 0.32 | 1 | 0.26 | 2 | 0.43 | 3 | 1.57 | 1 | |
| EF1-γ | 0.74 | 2 | 0.48 | 4 | 0.23 | 1 | 0.46 | 4 | 2.38 | 2 | |
| RPS5 | 0.83 | 6 | 0.32 | 1 | 0.39 | 7 | 0.39 | 1 | 2.55 | 3 | |
| RPL18 | 0.81 | 5 | 0.44 | 3 | 0.33 | 5 | 0.39 | 2 | 3.50 | 4 | |
| TER | 0.76 | 3 | 0.56 | 6 | 0.30 | 3 | 0.57 | 7 | 4.41 | 5 | |
| Tmub1 | 0.77 | 4 | 0.53 | 5 | 0.31 | 4 | 0.56 | 6 | 4.68 | 6 | |
| Total | Zdhhc15 | 0.85 | 8 | 0.61 | 8 | 0.38 | 6 | 0.50 | 5 | 6.62 | 7 |
| samples | SNX6 | 0.83 | 7 | 0.59 | 7 | 0.39 | 8 | 0.64 | 8 | 7.48 | 8 |
| ATPase | 0.85 | 9 | 0.63 | 9 | 0.41 | 9 | 0.77 | 10 | 9.24 | 9 | |
| TFAM | 0.91 | 10 | 0.67 | 10 | 0.43 | 10 | 0.72 | 9 | 9.74 | 10 | |
| EIF | 0.94 | 11 | 0.72 | 11 | 0.46 | 11 | 0.84 | 12 | 11.24 | 11 | |
| TPI | 1.08 | 12 | 0.81 | 13 | 0.60 | 12 | 0.80 | 11 | 11.98 | 12 | |
| α-TUB | 1.09 | 13 | 0.76 | 12 | 0.63 | 13 | 0.95 | 13 | 12.74 | 13 | |
| COX7 | 1.46 | 14 | 0.90 | 14 | 0.95 | 14 | 1.31 | 14 | 14.00 | 14 | |
Note: Avg. Ct, average cycle threshold; M, expression stability value; SV, stability value; SD + CV, standard deviation and coefficient of variation; GM, geometric mean.
FIGURE 2Average expression stability and ranking of candidate reference genes calculated by geNorm. Candidate reference genes with lower M values were more stable. The least stable genes are listed on the left, and the most stable genes are listed on the right. (A) Total samples. (B) Developmental stages associated with infection of PWN. (C) Pupae treated with PWN. (D) Adults treated with PWN.
FIGURE 3Pairwise variation (V) of 14 reference genes in different conditions calculated by geNorm. The threshold value for assessing the optimal number of reference genes for RT-qPCR normalization is 0.15.
FIGURE 4Stability rankings of 14 candidate reference genes by BestKeeper. Blue bars represent standard deviation (SD) of average Ct values, and yellow bars represent coefficients of variation (CV). (A) Total samples. (B) Developmental stages associated with infection of PWN. (C) Pupae treated with PWN. (D) Adults treated with PWN.
FIGURE 5Relative expression levels of KLF normalized by candidate reference genes. Different letters indicate the significant differences in KLF expression levels (ANOVA, HSD, p < 0.05). Sqrt (Relative expression) represents the square root of the relative expression value. (A) Pupae treated with PWN on day 5. (B) Pupae treated with PWN on day 10. (C) Female adults treated with PWN. (D) Male adults treated with PWN. (E) Developmental stages associated with infection of PWN in M. saltuarius.