Literature DB >> 35546067

β-Patchoulene represses hypoxia-induced proliferation and epithelial-mesenchymal transition of liver cancer cells.

Huahua Tu1, Wei Wang1, Yanqing Feng1, Linfei Zhang1, Huadong Zhou1, Caitao Cheng1, Lei Ji1, Qinghe Cai1, Yong Feng1.   

Abstract

Hepatocellular carcinoma (HCC) is a malignant tumor originating from liver epithelial cells with a high clinical mortality rate. β-Patchoulene (β-PAE) is a compound extracted from patchouli, which has analgesic, anti-inflammatory and antioxidant effects. This research aims to probe the impacts of β-PAE on hypoxia-induced HCC cell proliferation and epithelial-mesenchymal transition (EMT). Firstly, hypoxic injury models were constructed in HCC Huh-7 and MHCC97 cells, and the hypoxic injury cell models were then treated with different concentrations of β-PAE. The cell viability, proliferation, migration, invasion and apoptosis were checked by the cell counting kit-8 (CCK-8) assay, colony formation assay, Transwell assay, flow cytometry and terminal deoxyribonucleotide transferase (TdT)-mediated dUTP nick end labeling (TUNEL) assay. The expression of Survivin protein, EMT markers and the NF-κB/HIF-1α pathway was gauged by Western blot (WB) or cellular immunofluorescence or reverse transcription-polymerase chain reaction (RT-PCR). The in-vivo experiment was conducted to confirm the anti-tumor role of β-PAE. As a result, β-PAE abated hypoxia-induced HCC cell growth, proliferation, migration, invasion and EMT and facilitated apoptosis in vitro and in vivo dose-dependently. Further mechanism studies displayed that β-PAE inactivated the NF-κB/HIF-1α pathway, and HIF-1α activation significantly reversed the β-PAE-mediated tumor inhibition. β-PAE repressed the proliferation and EMT of hypoxia-induced HCC cells by choking the NF-κB/HIF-1α pathway, suggesting that β-PAE was a potential drug for HCC treatment.

Entities:  

Keywords:  HIF-1α; NF-κB; epithelial-mesenchymal transition; hepatocellular carcinoma; hypoxia-induced; Β-patchoulene

Mesh:

Substances:

Year:  2022        PMID: 35546067      PMCID: PMC9275994          DOI: 10.1080/21655979.2022.2065945

Source DB:  PubMed          Journal:  Bioengineered        ISSN: 2165-5979            Impact factor:   6.832


Highlights

β-PAE abated hypoxia-induced HCC cell growth, proliferation, migration, invasion and EMT and facilitated apoptosis β-PAE reduced HCC cell growth in vivo β-PAE also inactivated the NF-κB/HIF-1α pathway HIF-1α activation reversed the β-PAE-mediated anti-tumor effects.

Introduction

Liver cancer is a malignancy originating from the epithelial or mesenchymal tissues of the liver, which is characterized by high lethality, a susceptibility to recurrence and metastasis, and a tendency to show chemoresistance [1]. Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer, for which hepatitis B and C infection is a risk factor [2]. Liver resection and liver transplantation are the main clinical treatment methods for HCC, but the patients’ prognosis remains poor due to the high metastasis of advanced HCC [3]. It is now recognized that hypoxia is an important factor contributing to tumor migration and invasion and is one of the main hallmarks of tumors [4,5]. Moreover, tumor hypoxia and activation of hypoxia-inducible factors are critical mechanisms contributing to the pathogenesis of HCC[6]. Hence, it is imperative to probe the relevant mechanisms of hypoxia-induced HCC metastasis and invasion. β-Patchoulene (β-PAE) is a tricyclic sesquiterpene compound isolated from the traditional Chinese medicine Patchouli, with analgesic, antioxidant, anti-inflammatory and cytotoxic activities[7]. It is reported that β-PAE contributes to various inflammatory diseases. For example, β-PAE reduces dextran sulfate sodium-induced colitis and secondary liver injury in mice with ulcerative colitis by hindering the TLR 4/MyD 88/NF-κB and ROCK 1/MLC2 pathways, reducing colonic pathology and inhibiting apoptosis through inhibition of colonic leakage and flora imbalance in mice with ulcerative colitis [8]. Other studies have stated that β-PAE chokes the phosphorylation of c-Jun N-terminal kinase (JNK) and the inhibitor of nuclear factor kappa-B (IκB), declines the expression of inflammatory factor tumor necrosis factor-α (TNF-α), increases the activity of cyclooxygenases cyctoxase-1 (COX-1) and cyctoxase-2 (COX-2), up-regulates vascular endothelial growth factor and pro-angiogenic proteins, and dose-dependently reduces indomethacin-induced gastric ulcer in rats [9]. The anti-inflammatory effect of β-PAE has been established in previous studies, but its role in tumors has been rarely discussed. The nuclear factor-κB (NF-κB) transcription factor family is a vital factor in innate and adaptive immune responses and a classical pro-inflammatory and carcinogenic pathway [10]. In an animal experiment, β-Patchoulene protected against lipopolysaccharide (LPS)-induced acute lung injury by dampening inflammatory responses and oxidative stress through inactivation of NF-κB and activation of Nrf2 [11]. The NF-κB pathway activation is associated with the occurrence and evolvement of various tumors, including HCC [11]. Several studies have manifested that NF-κB targets and up-regulates 17β-hydroxysteroid dehydrogenase 4 (HSD17B4), down-regulates estradiol E2, up-regulates interleukin-6 (IL-6) and cyclin D1, and induces the proliferation of HCC HepG2 cells [12]. Besides, PHD-finger domain protein 5a (PHF5A) knockout hampers HCC cell migration and invasion by suppressing the activation of the NF-κB pathway. Blocking the NF-κB pathway attenuates PHF5A-mediated pro-migrative and invasive effects [13]. These findings suggest that NF-κB is a new therapeutic target for HCC. Nonetheless, the function of β-PAE in regulating NF-κB in HCC remains elusive. Hypoxia-inducible factor-1α (HIF-1α) is a helix-loop-helix-PAS domain transcription factor and a key transcriptional regulator that mediates the adaptive response of cells to the hypoxic microenvironment [14]. Vast studies have reported that the HIF-1α pathway activation is related to angiogenesis, drug resistance, metastasis and poor prognosis of various tumors [15]. Wen Y et al. discovered that Bcl2 associated transcription factor 1 (Bclaf 1) enhances HIF-1α gene transcription in hypoxia-induced HCC cells, up-regulates HIF-1α’s downstream molecules vascular endothelial growth factor A (VEGFA), transforming growth factor beta (TGF-β) and erythropoietin (EPO), boosts tumor angiogenesis, and induces malignant progression of HCC [16]. Other studies have testified that SUMO specific peptidase 1 (SENP 1) enhances the demethylation of HIF-1α to facilitate the transcriptional activity of HIF-1α. Meanwhile, SENP 1 and HIF-1α form a positive feedback loop to further enhance the hypoxia-induced tumor stem cell growth and expedite the occurrence and development of HCC [17]. The role of HIF-1α in hypoxia-induced HCC has been well-established by multiple studies. However, the mechanism and effect of β-PAE’s regulating NF-κB/HIF-1α in hypoxia-induced HCC remain unclear. Here, we aimed to investigate the anti-tumor role of β-PAE on HCC cell proliferation and the underlying mechanism. It was found that β-PAE restrained hypoxia-induced HCC cell viability, proliferation, invasion and EMT, and stimulated apoptosis. β-PAE depressed the NF-κB/HIF-1α pathway, while activation of HIF-1α impaired the β-PAE-mediated tumor-suppressive effect. According to the above findings, we hypothesized that β-PAE could restrain hypoxia-induced HCC cell proliferation and EMT by down-regulating the NF-κB/HIF-1α pathway.

Materials and methods

Cell culture

Human HCC cell lines Huh-7 and MHCC97 were obtained from China Center for Type Culture Collection (CCTCC, Wuhan, China). The two cell lines were cultured in the Dulbecco’s Modified Eagle’s medium (DMEM) (Thermo Fisher Scientific, Inc.) comprising 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin mixture at 37°C with 5% CO2. We altered the medium every 2–3 days. After treatment with 0.25% trypsin Ethylene Diamine Tetraacetie Acid (EDTA) (Thermo Fisher Hyclone, Utah, USA), the cells were sub-cultured three times a week. Cells in the logarithmic growth phase were adopted for the following test [18]. β-Patchoulene (Molecular Formula:C15H24) was isolated from the essential oil of Pogostemon cablin as previously described [19].

Animal experiments

Twenty Balb./c nude mice (male, 6–8 weeks) were ordered from the Experimental animal center of Hubei Medical College. The mice were bred in the animal center of Wuhan Medical University under specific pathogen-free (SPF) environments. This experimental process was granted by the Animal Ethics Committee of Hubei Medical College (Approval number: syrmmy2022-011) and followed the Guide for the Care and Use of Laboratory Animals [20]. MHCC97 cells were made into single-cell suspensions with 0.9% normal saline, and the cell concentration was 5 × 106 cells/mL. The mice were anesthetized with sodium phenobarbital (i.p., 50 mg/kg). After that, 0.1 mL cell suspension was subcutaneously injected into the right underarm of each mouse with a 1 mL syringe. Two weeks later, hepatic artery ligation was performed under the surgical microscope to construct an in vivo hypoxia model [21]. In the sham operation group, only laparotomy was implemented, in which the liver was exposed and the vascular structure was dissected without interruption of hepatic blood flow. The tumors’ long and short diameters were surveyed with a vernier caliper every 7 days, and the tumor volume was calculated according to the formula V = ab [2] ×0.5. After 5 weeks, the mice were sacrificed with sodium phenobarbital (50 mg/kg body weight). Tumor tissues were taken and weighed, and subsequent pathological experiments were conducted.

The establishment of hypoxic-induced cell model

Huh-7 and MHCC97 cells in the logarithmic growth stage were grown in an airtight glass chamber. As described previously, a mixture of gases containing 1% O2, 5% CO2 and 94% N2 was injected into the closed glass chamber at 37°C respectively to establish a classic cell hypoxia injury model [22,23]. Additionally, the hypoxic cell model was reoxygenated at 37°C with 5% CO2 for 24 hours. In the control group (N), the cells were incubated at 37°C with 5% CO2 and 95% atmosphere for 24 hours. In contrast, the cells in the hypoxia group (H) were kept at 37°C with 1% O2, 5% CO2 and 94% N2 for 24 hours.

Immunohistochemistry (IHC)

After paraffin embedding and sectioning (4 μM), the tumor tissues of the hypoxic model mice were dewaxed with xylene and then hydrated with gradient alcohol. The endogenous peroxidase was inactivated by 3% H2O2 for 10 minutes, and microwave repair was performed with 0.01 mol/L sodium citrate buffer (pH = 6.0, 15 minutes). After blocking with 5% bovine serum albumin (BSA) for 20 minutes, the primary antibodies (1:100) of E-cadherin (ab40772) and Vimentin (ab92547) (all purchased from Abcam, MA, USA) were added and incubated at 4°C overnight. The following day, the Goat Anti-Rabbit IgG (1: 5000, ab6721; Abcam) was added and maintained at room temperature (RT) for 20 minutes. After washing with phosphate-buffered saline (PBS), Sections were colored with diaminobenzidine (DAB). At last, the sections were redyed with hematoxylin, dehydrated, transparentized, mounted and examined under a microscope [24].

TdT-mediated DUTP Nick end labeling (TUNEL) staining for detection of tumor tissue apoptosis

The tumor tissues were taken and secured in 40 g/L paraformaldehyde infusion as instructed by the TUNEL Apoptosis Kit (Beyotime Biotechnology, Shanghai, China). Then, the sections were routinely dewaxed, hydrated, and cleaned with PBS three times (5 min each). Afterward, the sections were cultured with 20 μg/mL proteinase K at RT for 10 minutes and rinsed with PBS three times (5 minutes each time). Subsequently, they were blocked with 10 g/L BSA at 37°C for 15 minutes and balanced with equilibrium buffer for 10 minutes. Next, they were incubated with a terminal deoxyribonucleotide transferase (TdT Enzyme) reaction solution for 1 hour at 37°C and horse-radish peroxidase (HRP) solution for 20 minutes at RT and rewashed with PBS three times (5 minutes each). After that, they were developed with HRP substrate DAB, flushed with water, mounted with resin, dried at RT, and counted under an inverted fluorescent microscope (MSHOT/MC30 imaging system, China) [25]. Five fields of view were randomly selected and the ratio of apoptosis-positive cells was counted. The average value was taken for statistics.

TUNEL for cell apoptosis detection

After Huh-7 and MHCC97 cells were manipulated as described above, the medium was discarded, and the cells were operated with the TUNEL assay kit (Beyotime Biotechnology, Shanghai, China). Then, the cells were cleaned with pre-cooled PBS, immobilized with immunostaining fixation solution for 30 to 60 minutes, and rewashed with PBS. Afterward, the immunostaining detergent was added and incubated in the ice bath for 2 minutes. Next, 50 μL TUNEL solution was added to the sample and incubated at 37°C for 60 minutes in the dark. After that, the sections were rinsed with PBS three times, mounted with the antifade mounting medium, and reviewed under a fluorescence microscope (MSHOT/MC30 imaging system, China) with excitation light of 450–500 nm and emission light of 515–565 nm (green fluorescence) [26]. Five fields were randomly chosen for each sample to calculate the apoptotic rate. Apoptotic rate = apoptotic cells/total cells ×100%.

Cellular immunofluorescence

Huh-7 and MHCC97 cells in the logarithmic growth stage were seeded in pretreated 24-well plates with small glass slides and cultured for 48 hours. Then, they were fastened with −20°C pre-cooled ice methanol for 10 minutes and blocked with 1% BSA blocking solution and maintained at 4°C for 1 hour. NF-κB (ab16502) and HIF-1α (ab51608) primary antibodies (both diluted at 1:200) were added dropwise and maintained overnight at 4°C, respectively. Then, the fluorescence-labeled Goat Anti-Rabbit IgG (dilution ratio of 1:500) was supplemented. The above antibodies were all provided by Abcam (Shanghai, China). After 1 hour of incubation at RT in the dark, the cells were dyed with the DAPI staining solution for 5 minutes at RT in the dark, washed and dried. After the antifade mounting medium was added, the specimens were observed with a fluorescence microscope (MSHOT/MC30 Imaging System, China) and photographed [27].

Cell counting kit-8 (CCK-8) assay

Huh-7 and MHCC97 cells in the logarithmic growth phase were seeded into 96-well plates (5 ×103 cells/well). After incubation for 4 hours, β-PAE at different concentrations (0, 0.3125, 0.625, 1.25, 2.5, 5, 10 μM) was added, and 4 parallel wells were set for each concentration. After further culture for 48 hours, 10 μL CCK-8 solution (Beyotime Biotechnology, Shanghai, China) was added to each well and operated according to the CCK-8 kit instructions. Forty-eight hours later, the absorbance value at 450 nm was observed with a spectrophotometer (Bio-Rad, CA, USA). The inhibitory rate and half-maximum inhibitory concentration (IC50) were calculated by mean values [28].

Colony formation experiment

Huh-7 and MHCC97 cells were inoculated into 6-well plates (1 ×103 cells per plate) and cultured. After incubation for 4 hours, β-PAE at different concentrations (0, 0.3125, 0.625, 1.25, 2.5, 5, 10 μM) was added to treat the cells for 48 hours. After 2 weeks, the medium was removed, and the cells were rinsed twice with PBS and immobilized with 4% paraformaldehyde for 10 minutes. Then, 1 mL crystal violet was added to each well, and the colony formation number was recorded after staining [29].

Transwell assay

For the cell invasion assay, Huh-7 and MHCC97 cells seeded into 24-well plates at 2 ×105 cells per well. Next, they were placed in the upper chamber of a Transwell (8 μM pore size, 8 mm diameter, Costar, USA). The polycarbonate filter membranes at the bottom of the Transwell chamber were covered with 50 µL Matrigel (BD company, US), air-dried and maintained overnight in a laminar flow cabinet. The cells were then inoculated into the upper compartment (1 ×105 cells per well). DMEM containing 10% FBS was added to the lower compartment (600 µL per well). Followed by incubation at 37°C with 5% CO2 for 24 hours, the cells that failed to migrate were gently wiped off, and the membranes were immobilized with methanol for 15 minutes and stained with 0.5% crystal violet [30]. The invaded cell number was counted under an inverted microscope (200×). Five fields were randomly chosen under a microscope (MSHOT/MC30 Imaging System, China) to count the number of cells penetrating the membranes.

Flow cytometry (FCM)

The apoptosis was determined with the Annexin V-FITC/PI Apoptosis Assay Kit (Yeasen Biotech Co., Ltd.) following the manufacturer’s guidelines. Huh-7 and MHCC97 cells were trypsinized and centrifuged. Then, they were cleaned twice with cold PBS and resuspended with binding buffer to reach a final concentration of 1 ×106 cells/mL. Afterward, the cells were double-stained with AnnexinV and propidium iodide (PI) staining solution and incubated at RT in the dark for 15 minutes [31]. Finally, we analyzed the stained cells using FCM (BD Biosciences, San Jose, CA, USA) and calculated the apoptotic rate. The experiment was carried out in triplicate.

Western blot (WB)

Huh-7 and MHCC97 cells were collected, cleaned with cold PBS, and lysed by radio-immunoprecipitation assay (RIPA) lysate (Beyotime Biotechnology, Shanghai, China) on ice. The protein content was quantified by the Bradford method. The equal protein was taken from each group for 10% sodium dodecylsulfate-Polyacrylamide gel electrophoresis (SDS-PAGE), and the protein on the gel was transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, MA, USA). After the membranes were blocked at 4°C for 1 hour, the primary antibodies (dilution: 1:1000; Abcam, Shanghai, China) of Survivin (ab76424), matrix metallopeptidase 2 (MMP2) (ab86607), matrix metallopeptidase 9 (MMP9) (ab76003), E-cadherin (ab40772), N-cadherin (ab76011), Vimentin (ab92547), NF-κB (ab16502), p-NF-κB (ab183559), HIF-1α (ab51608), and β-actin (ab115777) were added and incubated overnight at 4°C. Next, the membranes were maintained with the Goat Anti-Rabbit IgG (1:5000, ab6721; Abcam). According to the instructions of the Enhanced Chemiluminescence (ECL) kit (Amersham Pharmacia Biotech, Little Chalfont, UK), the protein blots on the membranes were imaged [28].

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was separated from Huh-7 and MHCC97 cells with the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The reverse transcription of total RNA into cDNA was made using the PrimeScript-RT Kit (Madison, WI, USA). The SYBR GreenPCR reagent (MedChemExpress, NJ, USA) and ABI7500 FAST Real-time PCR (Applied Biosystems, SanFrancisco, CA, USA) were employed to perform RT-PCR [20,32]. The expression levels of VEGFA, TGF-β, epidermal growth factor (EGF) and TIMP metallopeptidase inhibitor 1 (TIMP1) were assessed by 2−ΔΔC (GAPDH was used as a standardized internal reference). The primer sequences are shown in Table 1.
Table 1.

Specific primer sequences

The targetForward (5 ‘-3’)Reverse (5 ‘-3’)
VEGFAGTCTGTCTGTCTGTCCGTCAGTCGAGGAAGAGAGAGACGG
TGF-βCGAGGTCTGGGGAAAAGTCTTTGAGACTTTTCCGTTGCCG
EGFAGTGGTGGTCATCTTCCCTGAGGATTTGCTGGGGATGGAA
TIMP1GTATCCGCAGACACTCTCCACCTTCTGCAATTCCGACCTC
GAPDHTCGGGTCAACGGATTTGGTCGTAAGCCCTCCAGGTGGGGGAAGA
Specific primer sequences

Statistical analysis

The SPSS22.0 statistical software (SPSS Inc., Chicago, IL, USA) was adopted for data analysis. Measurements were expressed as mean ± variance (x ±s). One-way ANOVA and LSD test were utilized to analyze data differences between multiple groups. The t test was applied to compare the difference in means between the two groups. The difference of enumeration data was compared by χ2 test. P <0.05 indicated the statistical significance [34].

Results

Aiming at exploring the effects of β-PAE in HCC treatment, we first performed in-vitro experiments for confirming the role of β-PAE in mediating the proliferation, invasion, and EMT under normal or hypoxia environment. In-vivo experiment was also carried out. We detected NF-κB and HIF-1α expression and intervened HIF-1α for verifying the mechanism of β-PAE.

β-PAE suppressed HCC cell proliferation

HCC cells (Huh-7 and MHCC97) were dealt with different concentrations (0, 0.3125, 0.625, 1.25, 2.5, 5, 10 and 20 μM) of β-PAE for 48 hours. The CCK-8 assay outcomes revealed that the viability of Huh-7 and MHCC97 cells decreased significantly with the increase of β-PAE concentration (Figure 1A). Cell proliferation was examined by the colony formation assay, which illustrated that higher concentration of β-PAE caused poorer cell colony-forming ability (vs. the veh group) (Figure 1B). These results manifested that β-PAE weakened HCC cell proliferation.
Figure 1.

β-PAE suppressed the proliferation of HCC cells Huh-7 and MHCC97 cells were processed with different concentrations (0, 0.3125, 0.625, 1.25, 2.5, 5, 10, 20 μM) of β-PAE for 48 hours. A. The viability of Huh-7 and MHCC97 cells treated with different concentrations of β-PAE (0–20 μM) was assayed with CCK-8. B. The proliferation of Huh-7 and MHCC97 cells processed with different concentrations of β-PAE (0–10 μM) was examined by the colony formation assay. NS P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (vs. veh group). n = 3.

β-PAE suppressed the proliferation of HCC cells Huh-7 and MHCC97 cells were processed with different concentrations (0, 0.3125, 0.625, 1.25, 2.5, 5, 10, 20 μM) of β-PAE for 48 hours. A. The viability of Huh-7 and MHCC97 cells treated with different concentrations of β-PAE (0–20 μM) was assayed with CCK-8. B. The proliferation of Huh-7 and MHCC97 cells processed with different concentrations of β-PAE (0–10 μM) was examined by the colony formation assay. NS P > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (vs. veh group). n = 3.

β-PAE suppressed hypoxia-induced HCC cell proliferation

To check the impact of β-PAE on hypoxia-induced HCC cell proliferation, we set up a hypoxic injury model in HCC cells. After β-PAE (2.5 μM) treatment, CCK-8 assay and colony formation experiment results showed that the proliferation of HCC cells was inhibited β-PAE (Figure 2A-B). The apoptotic rate of Huh-7 and MHCC97 cells in each group was determined by FCM and TUNEL assay. Notably, cell apoptosis was signally boosted after β-PAE treatment (Figure 2C-D). The Survivin expression was monitored by WB, which testified that Survivin was up-regulated in the H group and down-regulated in the β-PAE group versus the N group (Figure 2E). Hence, hypoxia induced enhanced proliferation and reduced apoptosis of HCC cells, and the effects were reversed by β-PAE.
Figure 2.

β-PAE suppressed hypoxia-induced HCC cell proliferation A hypoxic injury model was set up in HCC cells, and hypoxia-induced Huh-7 and MHCC97 cells were treated with 2.5 μM β-PAE for 48 hours. A.CCK-8 was adopted to check the viability of Huh-7 and MHCC97. B. Proliferation of Huh-7 and MHCC97 cells was assessed using the colony formation assay. C. The apoptotic rate of Huh-7 and MHCC97 cells was tested by flow cytometry. D.TUNEL was developed for the detection of apoptosis in Huh-7 and MHCC97 cells. E. Expression of the apoptosis-inhibitory protein Survivin in Huh-7 and MHCC97 cells was probed by WB. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. N group).#P < 0.05, ##P < 0.01, ###P < 0.001 (vs. H group). n = 3.

β-PAE suppressed hypoxia-induced HCC cell proliferation A hypoxic injury model was set up in HCC cells, and hypoxia-induced Huh-7 and MHCC97 cells were treated with 2.5 μM β-PAE for 48 hours. A.CCK-8 was adopted to check the viability of Huh-7 and MHCC97. B. Proliferation of Huh-7 and MHCC97 cells was assessed using the colony formation assay. C. The apoptotic rate of Huh-7 and MHCC97 cells was tested by flow cytometry. D.TUNEL was developed for the detection of apoptosis in Huh-7 and MHCC97 cells. E. Expression of the apoptosis-inhibitory protein Survivin in Huh-7 and MHCC97 cells was probed by WB. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. N group).#P < 0.05, ##P < 0.01, ###P < 0.001 (vs. H group). n = 3.

β-PAE impeded hypoxia-induced HCC cell invasion and EMT

To look into the influence of β-PAE on hypoxia-induced HCC cell invasion and EMT, we processed hypoxia-induced HCC cells (Huh-7 and MHCC97) with β-PAE (2.5 μM) for 48 hours and then examined cell invasion and the expression EMT markers. Transwell assay results manifested that the cell invasion of the H group was facilitated, while that of the β-PAE group was repressed the invasive ability of HCC cells (Figure 3A). The levels of EMT markers MMP2, MMP9, E-cadherin, N-cadherin and Vimentin were tested by WB. As a result, MMP2, MMP9, N-cadherin and Vimentin were up-regulated, while E-cadherin was down-regulated in the hypoxia environment. Followed by β-PAE administration, MMP2, MMP9, N-cadherin and Vimentin were down-regulated, while E-cadherin was up-regulated (Figure 3B). These findings implied that β-PAE hampered the invasion and EMT of hypoxia-induced HCC cells.
Figure 3.

β-PAE suppressed hypoxia-induced migration, invasion and EMT of HCC cells Hypoxia-induced Huh-7 and MHCC97 cells were treated with 2.5 μM β-PAE for 48 hours. A. Invasive ability of Huh-7 and MHCC97 cells was tested by the Transwell assay. B. WB was employed to monitor the expression of EMT markers (MMP2, MMP9, E-cadherin, N-cadherin and Vimentin) in Huh-7 and MHCC97 cells. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. N group).#P < 0.05, ##P < 0.01 (vs. H group), n = 3.

β-PAE suppressed hypoxia-induced migration, invasion and EMT of HCC cells Hypoxia-induced Huh-7 and MHCC97 cells were treated with 2.5 μM β-PAE for 48 hours. A. Invasive ability of Huh-7 and MHCC97 cells was tested by the Transwell assay. B. WB was employed to monitor the expression of EMT markers (MMP2, MMP9, E-cadherin, N-cadherin and Vimentin) in Huh-7 and MHCC97 cells. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. N group).#P < 0.05, ##P < 0.01 (vs. H group), n = 3.

β-PAE declined NF-κB and HIF-1α expression

To further investigate the mechanism of β-PAE on HCC cells, we examined the expression of the NF-κB/HIF-1α pathway. WB outcomes revealed that compared with the N group, the NF-κB phosphorylation and HIF-1α expression were facilitated in the H group, while they were impeded in the β-PAE group (Figure 4A-B). The expression of NF-κB and HIF-1α was verified by the cell immunofluorescence assay. As a result, the NF-κB phosphorylation and HIF-1α expression were strengthened in the H group and hampered in the β-PAE group (Figure 4C-D). Additionally, the expression of HIF-1α’s downstream molecules, including vascular endothelial growth factor (VEGFA), TGF-β, EGF, and TIMP1 was tested by RT-PCR. It turned out that VEGFA, TGF-β and EGF were up-regulated, and TIMP1 was down-regulated in the H group versus the N group. On the contrary, the results were opposite in the β-PAE group (Figure 4E-H). These findings indicated that β-PAE inactivated NF-κB/HIF-1α in HCC cells.
Figure 4.

β-PAE hampered NF-κB and HIF-1α Hypoxia-induced Huh-7 and MHCC97 cells were manipulated with 2.5 μM β-PAE for 48 hours. A-B. The NF-κB/HIF-1α pathway expression in Huh-7 and MHCC97 cells was gauged using WB. C-D. Expression levels of NF-κB and HIF-1α were analyzed by cellular immunofluorescence. E-H. Expression of VEGFA, TGF-β, EGF and TIMP1, downstream molecules of HIF-1α, was evaluated in Huh-7 and MHCC97 cells with WB. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. N group).##P < 0.01, ###P < 0.001 (vs. H group), n = 3.

β-PAE hampered NF-κB and HIF-1α Hypoxia-induced Huh-7 and MHCC97 cells were manipulated with 2.5 μM β-PAE for 48 hours. A-B. The NF-κB/HIF-1α pathway expression in Huh-7 and MHCC97 cells was gauged using WB. C-D. Expression levels of NF-κB and HIF-1α were analyzed by cellular immunofluorescence. E-H. Expression of VEGFA, TGF-β, EGF and TIMP1, downstream molecules of HIF-1α, was evaluated in Huh-7 and MHCC97 cells with WB. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. N group).##P < 0.01, ###P < 0.001 (vs. H group), n = 3.

Activating HIF-1α attenuated β-PAE-mediated tumor-suppressive effect

To verify the impact of HIF-1α on the anti-cancer effect of β-PAE, hypoxia-induced HCC cells were dealt with the HIF-1α agonist Dimethyloxaloglycine (DMOG) (Article No. HY-15893, Concentration: 200 μM, Company: MedChemExpress, NJ, USA). Compared with the β-PAE group, cell viability and proliferation in the β-PAE+DMOG group were heightened (Figure 5a-b). Transwell assay results manifested that cell invasion was accelerated cell invasion with DMOG treatment (Figure 5c). The expression of Survivin, MMP2, MMP9, E-cadherin, N-cadherin and Vimentin was gauged by WB. As a result, compared with the β-PAE group, the expression of Survivin, MMP2, MMP9, N-cadherin and Vimentin was heightened, while that of E-cadherin was impeded in the β-PAE+DMOG group (Figure 5d). WB results concluded that the NF-κB phosphorylation and HIF-1α expression were markedly raised in the DMOG + β-PAE group versus the β-PAE group (Figure 5e). Thus, activating HIF-1α effectively reversed β-PAE-mediated tumor inhibition.
Figure 5.

Activating HIF-1α wakened the β-PAE-mediated anti-tumor effectHypoxia-induced Huh-7 and MHCC97 cells were treated with 2.5 μM β-PAE for 48 h, followed by the addition of the HIF-1α agonist DMOG (200 μM). A. The viability of Huh-7 and MHCC97 cells was assayed using CCK-8. B. The colony formation assay was implemented to verify the proliferative capacity of Huh-7 and MHCC97 cells. C. Transwell assay was adopted to check the invasion of Huh-7 and MHCC97 cells. D. WB was performed to assay the expression of Survivin, MMP2, MMP9, E-cadherin, N-cadherin and Vimentin in Huh-7 and MHCC97 cells. E. The expression of the NF-κB/HIF-1α pathway in Huh-7 and MHCC97 cells was estimated by WB. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. veh group). ##P < 0.01, ###P < 0.001 (vs. β-PAE group), n = 3.

Activating HIF-1α wakened the β-PAE-mediated anti-tumor effectHypoxia-induced Huh-7 and MHCC97 cells were treated with 2.5 μM β-PAE for 48 h, followed by the addition of the HIF-1α agonist DMOG (200 μM). A. The viability of Huh-7 and MHCC97 cells was assayed using CCK-8. B. The colony formation assay was implemented to verify the proliferative capacity of Huh-7 and MHCC97 cells. C. Transwell assay was adopted to check the invasion of Huh-7 and MHCC97 cells. D. WB was performed to assay the expression of Survivin, MMP2, MMP9, E-cadherin, N-cadherin and Vimentin in Huh-7 and MHCC97 cells. E. The expression of the NF-κB/HIF-1α pathway in Huh-7 and MHCC97 cells was estimated by WB. *P < 0.05, **P < 0.01, ***P < 0.001 (vs. veh group). ##P < 0.01, ###P < 0.001 (vs. β-PAE group), n = 3.

β-PAE hampered HCC cell growth and EMT in vivo

To further evaluate the impact of β-PAE on the growth, apoptosis and EMT of HCC cells in vivo, we established an in-vivo nude mice model. [20]. Mice were treated with β-PAE at different concentrations (5 μmoL/kg, 10 μmoL/kg, 20 μmoL/kg). The mice’s tumor volume was calculated after measurement with a vernier caliper. It was discovered that compared with the veh group, the tumor volume of mice gradually decreased with the increase of β-PAE concentration (Figure 6A). The image of the tumor tissue is shown in Figure 6B. Tumor tissues from mice were weighed, which disclosed that higher concentrations of β-PAE resulted in smaller tumor weights (versus the veh group) (Figure 6C). TUNEL outcomes validated that cell apoptosis was intensified as the concentration of β-PAE increased (vs. the veh group) (Figure 6D). IHC test results displayed that higher concentration of β-PAE was associated with lower expression of Vimentin and higher expression of E-cadherin (versus the vehicle group) (Figure 6E). The protein expression of the NF-κB and HIF-1α pathways were examined by WB. It turned out that higher concentrations of β-PAE were related to lower levels of NF-κB phosphorylation and HIF-1α expression compared to the vehicle group (Figure 6 F). RT-PCR results exhibited that the expression of VEGFA, TGF-β and EGF was decreased, and the TIMP1 profile was uplifted with the increase of β-PAE concentration versus the veh group (Figure 6 G). These results demonstrated that β-PAE inactivated the NF-κB and HIF-1α pathways dose-dependently in vivo, thereby abating tumor growth and EMT and inducing apoptosis.
Figure 6.

β-PAE hampered the growth and EMT of HCC cells MHCC97 cells were injected into the right axilla of nude mice, and an in-vivo hypoxia model was established by ligating the hepatic artery. Mice were then treated with different concentrations (5 μmoL/kg, 10 μmoL/kg, 20 μmoL/kg) of β-PAE. A. Tumor volumes of nude mice were counted weekly for 35 days. B. Tumor growth map in nude mice. C. After 35 days, nude mice were executed, and subcutaneous tumor nodules were removed and weighed. D. HCC tissue apoptosis was examined by TUNEL. E. The expression of E-cadherin and Vimentin in liver cancer tissues was assayed by immunohistochemistry. F. The expression of the NF-κB/HIF-1α pathway in HCC tissues was measured by WB. G. Expression of HIF-1α’s downstream molecules VEGFA, TGF-β, EGF and TIMP1 in HCC tissues was assessed by RT-PCR. NS>0.05, *P < 0.05, **P < 0.01, ***P < 0.001 (vs. veh group), n = 5.

β-PAE hampered the growth and EMT of HCC cells MHCC97 cells were injected into the right axilla of nude mice, and an in-vivo hypoxia model was established by ligating the hepatic artery. Mice were then treated with different concentrations (5 μmoL/kg, 10 μmoL/kg, 20 μmoL/kg) of β-PAE. A. Tumor volumes of nude mice were counted weekly for 35 days. B. Tumor growth map in nude mice. C. After 35 days, nude mice were executed, and subcutaneous tumor nodules were removed and weighed. D. HCC tissue apoptosis was examined by TUNEL. E. The expression of E-cadherin and Vimentin in liver cancer tissues was assayed by immunohistochemistry. F. The expression of the NF-κB/HIF-1α pathway in HCC tissues was measured by WB. G. Expression of HIF-1α’s downstream molecules VEGFA, TGF-β, EGF and TIMP1 in HCC tissues was assessed by RT-PCR. NS>0.05, *P < 0.05, **P < 0.01, ***P < 0.001 (vs. veh group), n = 5.

Discussion

HCC is one of the solid tumors with a high degree of malignancy clinically. Many reports have demonstrated that oxidative stress and hypoxia are considered to be crucial mechanisms for the occurrence and development of HCC [33,34]. In this study, we discovered that hypoxia-mediated HCC cell proliferation, migration, invasion and EMT, and inhibited cell apoptosis. β-PAE attenuated the hypoxia-induced carcinogenic effect by inactivating the NF-κB/HIF-1α pathway. Previous studies have demonstrated that β-PAE extracted from patchouli has good anti-inflammatory, anti-oxidative stress and apoptotic cascade effects and is widely used in treating inflammatory diseases[35]. Pogostemon cablin essential oils (PPA extract) can induce the FAS-FASL-caspase-8 system to activate exogenous apoptotic pathways and activate endogenous apoptotic pathways produced by a large number of reactive oxygen species (ROS). PPa extract induces HCC cell cycle arrest, significantly impedes HCC cell growth and proliferation and facilitates apoptosis in vivo and in vitro[36]. Additionally, β-PAE has also been shown to protect the liver and reduce hepatic steatosis. Xu N et al. showed that β-PAE activates the AMPK pathway, alleviates weight gain, liver injury and lipid deposition and accumulation in liver tissues caused by liver fibrosis, and strengthens lipid metabolism, thereby alleviating nonalcoholic fatty liver disease[37]. The protective effect of patchouli extract on the liver and its anti-tumor effect in liver cancer has been confirmed by previous studies. Here, we also found that β-PAE dose-dependently repressed hypoxia-induced HCC cells’ proliferation, migration, invasion and EMT and induced apoptosis. The anti-inflammatory and anti-tumor effects of β-PAE may be realized through the regulation of the NF-κB pathway. NF-κB, as a classical carcinogenic pathway, is abnormally activated in liver carcinogenesis [38,39]. It has been found that hypoxia up-regulates plasma membrane tissue protein Caveolin-1 (Cav1) in hepatoma cells. Cav1 plays a positive role in regulating calcium-binding protein S100 calcium-binding protein P (S100P) by activating the NF-κB pathway, thus enhancing the invasion and lung metastasis of HCC[40]. Additionally, Zhang Z et al. reported that β-PAE hampers the expression of pro-inflammatory factors such as inducible nitric oxide synthase (iNOS) and COX-2 by repressing the transport of NF-κB from the cytoplasm to the nucleus and stabilizing the transcription level of NF-κB, thereby reducing vascular permeability and tissue cell infiltration[41]. In animal studies, Mulberry fruit polysaccharides (MFP) treatment markedly declined the expression of inflammatory markers IL-1β, TNF-α and NF-κB in liver cancer tissues of diethylnitrosamine/phenobarbital (DEN/PB)-administered rats. MFP can be chemopreventive against DEN/PB-induced HCC by controlling inflammation and inducing apoptosis [42]. We have gained a preliminary understanding of the function of NF-κB in hypoxia-induced HCC cells and the mechanism by which β-PAE regulated NF-κB, which was also verified in the results of this experiment. The regulation of β-PAE on NF-κB significantly dampened the proliferation, migration, invasion and EMT of hypoxia-induced HCC cells. We have known that hypoxia is an important factor leading to the malignant progression of HCC, and HIF-1α is a key transcription factor related to the hypoxia response of cancer cells[43]. HIF-1α is overexpressed in HCC and is related to glucose metabolism, lipid metabolism, angiogenesis, proliferation, migration, invasion and EMT of cancer cells[44]. Some studies have confirmed that HIF-1α is positively correlated with the expression of the oncogene Ras-like-without-CAAX-1 (RIT1) in HCC tissues, and HIF-1α up-regulates RIT1 and promotes the growth, proliferation, migration and invasion of hypoxia-induced HCC cells[45]. Other reports have claimed that the HIF-1α expression is also linked with the EMT of HCC cells, and the increased activity of HIF-1α is accompanied by a more significant EMT. Activation of the Wnt/β-catenin pathway up-regulates HIF-1α, which significantly enhances hypoxia-induced HCC cell proliferation and EMT[46]. Our findings testified that β-PAE impeded the proliferation, migration, invasion and EMT of hypoxia-induced HCC cells and facilitated cell apoptosis by inactivating the NF-κB/HIF-1α pathway.

Conclusion

Overall, we found that β-PAE exerted a significant tumor-suppressive effect in hypoxia-induced HCC cells dose-dependently. Meanwhile, β-PAE inactivated NF-κB/HIF-1α pathway, and the activation of HIF-1α reversed β-PAE-mediated tumor inhibition. Our study provides a new drug mechanism and treatment idea for HCC patients. However, more animal studies should be performed to confirm the anti-tumor effects of β-PAE cells. Genetic intervention on NF-κB/HIF-1α pathway is also needed for the verification of β-PAE’s mechanism. Click here for additional data file.
  46 in total

Review 1.  NF-κB and the link between inflammation and cancer.

Authors:  Joseph A DiDonato; Frank Mercurio; Michael Karin
Journal:  Immunol Rev       Date:  2012-03       Impact factor: 12.988

Review 2.  Advances in Hypoxia-Mediated Mechanisms in Hepatocellular Carcinoma.

Authors:  Xin Xin Xiong; Xin Yao Qiu; Dian Xing Hu; Xiao Qian Chen
Journal:  Mol Pharmacol       Date:  2017-02-27       Impact factor: 4.436

3.  NF-κB increased expression of 17β-hydroxysteroid dehydrogenase 4 promotes HepG2 proliferation via inactivating estradiol.

Authors:  Xin Lu; Panpan Ma; Yun Shi; Min Yao; Lianguo Hou; Pingping Zhang; Lingling Jiang
Journal:  Mol Cell Endocrinol       Date:  2014-11-28       Impact factor: 4.102

4.  Long non-coding RNA TTN antisense RNA 1 facilitates hepatocellular carcinoma progression via regulating miR-139-5p/SPOCK1 axis.

Authors:  Xinghao Zhu; Shiqing Jiang; Zongyao Wu; Tonghua Liu; Wei Zhang; Lili Wu; Lijun Xu; Mingliang Shao
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

5.  SENP1 promotes hypoxia-induced cancer stemness by HIF-1α deSUMOylation and SENP1/HIF-1α positive feedback loop.

Authors:  Chun-Ping Cui; Carmen Chak-Lui Wong; Alan Ka-Lun Kai; Daniel Wai-Hung Ho; Eunice Yuen-Ting Lau; Yu-Man Tsui; Lo-Kong Chan; Tan-To Cheung; Kenneth Siu-Ho Chok; Albert C Y Chan; Regina Cheuk-Lam Lo; Joyce Man-Fong Lee; Terence Kin-Wah Lee; Irene Oi Lin Ng
Journal:  Gut       Date:  2017-03-03       Impact factor: 23.059

Review 6.  Hypoxia inducible factors in hepatocellular carcinoma.

Authors:  Chu Chen; Tao Lou
Journal:  Oncotarget       Date:  2017-07-11

7.  Pogostemon cablin Triggered ROS-Induced DNA Damage to Arrest Cell Cycle Progression and Induce Apoptosis on Human Hepatocellular Carcinoma In Vitro and In Vivo.

Authors:  Xiao-Fan Huang; Gwo-Tarng Sheu; Kai-Fu Chang; Ya-Chih Huang; Pei-Hsiu Hung; Nu-Man Tsai
Journal:  Molecules       Date:  2020-11-30       Impact factor: 4.411

8.  Long non-coding RNA SNHG22 facilitates hepatocellular carcinoma tumorigenesis and angiogenesis via DNA methylation of microRNA miR-16-5p.

Authors:  Yinxin Zhang; Changliang Lu; Haiwei Cui
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

9.  LncRNA DARS-AS1 aggravates the growth and metastasis of hepatocellular carcinoma via regulating the miR-3200-5p-Cytoskeleton associated protein 2 (CKAP2) axis.

Authors:  Yanqing Feng; Gang Wei; Linfei Zhang; Huadong Zhou; Wei Wang; Peng Guo; Caitao Cheng; Lei Ji; Qinghe Cai; Yong Feng; Huahua Tu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

Review 10.  HIF-1α pathway: role, regulation and intervention for cancer therapy.

Authors:  Georgina N Masoud; Wei Li
Journal:  Acta Pharm Sin B       Date:  2015-06-06       Impact factor: 11.413

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.