Tumours are complex ecosystems composed of different types of cells that communicate and influence each other. While the critical role of stromal cells in affecting tumour growth is well established, the impact of mutant cancer cells on healthy surrounding tissues remains poorly defined. Here, using mouse intestinal organoids, we uncover a paracrine mechanism by which intestinal cancer cells reactivate foetal and regenerative YAP-associated transcriptional programmes in neighbouring wildtype epithelial cells, rendering them adapted to thrive in the tumour context. We identify the glycoprotein thrombospondin-1 (THBS1) as the essential factor that mediates non-cell-autonomous morphological and transcriptional responses. Importantly, Thbs1 is associated with bad prognosis in several human cancers. This study reveals the THBS1-YAP axis as the mechanistic link mediating paracrine interactions between epithelial cells in intestinal tumours.
Tumours are complex ecosystems composed of different types of cells that communicate and influence each other. While the critical role of stromal cells in affecting tumour growth is well established, the impact of mutant cancer cells on healthy surrounding tissues remains poorly defined. Here, using mouse intestinal organoids, we uncover a paracrine mechanism by which intestinal cancer cells reactivate foetal and regenerative YAP-associated transcriptional programmes in neighbouring wildtype epithelial cells, rendering them adapted to thrive in the tumour context. We identify the glycoprotein thrombospondin-1 (THBS1) as the essential factor that mediates non-cell-autonomous morphological and transcriptional responses. Importantly, Thbs1 is associated with bad prognosis in several human cancers. This study reveals the THBS1-YAP axis as the mechanistic link mediating paracrine interactions between epithelial cells in intestinal tumours.
It is now well established that tumour formation and progression are vastly influenced by the crosstalk between cancer cells and their environment, involving complex remodelling of the extracellular matrix and interaction with stromal cells, such as cancer-associated fibroblasts, myofibroblasts, pericytes, vascular and lymphatic endothelial cells, as well as different types of inflammatory immune cells (Marusyk et al., 2014; Cleary et al., 2014; Hanahan and Coussens, 2012). Remodelling of the tumour microenvironment has been shown to support tumour growth through neo-angiogenesis as well as via direct effects on cancer cells exposed to pro-inflammatory and pro-survival cytokines (Balkwill et al., 2012). However, paracrine interactions have mostly been studied among different cell types and little is known about communication between cancer and adjacent normal epithelial cells that could contribute to tumour formation and progression. Defining the mechanisms allowing paracrine interactions between tumour and normal epithelial cells requires an understanding of how different cells persist and expand within a tumour and is crucial to dissect intratumoral heterogeneity. It is noteworthy that these questions have lately received a special attention, and several studies addressing the coexistence and complex relationship between mutant and wildtype (WT) epithelial cells in the context of intestinal tumours have been published over the past year (Yum et al., 2021; Flanagan et al., 2021; van Neerven et al., 2021; Krotenberg Garcia et al., 2021).We have recently reported that intestinal stem cells can be found within intestinal tumours and contribute to tumour growth (Mourao et al., 2019), suggesting the existence of bidirectional communications between tumour and normal epithelial cells. A recent study has also provided evidence that a parenchymal response of normal epithelial cells favours tumour growth and dissemination (Ombrato et al., 2019). The advent of 3D organotypic cultures able to faithfully recapitulate the morphology and physiology of intestinal cells in a mesenchyme-free environment has now allowed us to address the unresolved question of epithelial-specific interactions in the context of intestinal tumoroids.Intestinal organoids are well-characterised stem-cell-derived structures (Sato and Clevers, 2013). Importantly, organoids generated from normal mouse intestinal crypts consistently present a stereotypical ‘budding’ morphology, with proliferative crypts (or buds) and a terminally differentiated villus domain. On the other hand, cells derived from Apc mutant intestinal tumours generally grow as hyperproliferative and non-polarised hollow spheres or cysts (Drost et al., 2015; Sato et al., 2011; Jardé et al., 2013; Schwank et al., 2013; Germann et al., 2014; Onuma et al., 2013).To study epithelial communications in a stroma-free environment, we analysed the influence of mutant organoids derived from primary mouse tumours (hereafter defined as ‘tumoroids’) on WT small intestinal organoids. We discovered that the co-culture of tumoroids and budding organoids quickly induced a hyperproliferative cystic morphology (referred to as ‘cysts’ hereafter) in a fraction of WT organoids. This interaction did not require cell contact as the effect was recapitulated by the conditioned medium (cM) from tumoroids. We found that the secreted glycoprotein thrombospondin-1 (THBS1) was responsible for mediating these paracrine communications through Yap pathway activation. Under the influence of tumour-derived THBS1, WT cells activate the YAP signalling pathway and induce foetal and regenerative transcriptional programmes, which cause their hyperproliferation and failure to properly differentiate. Importantly, we show that the THBS1/YAP1 signalling axis we discovered in organoids is conserved in both mouse and human colon cancer and propose that this early mechanism of non-cell-autonomous epithelial communication is critical for the establishment of a primary tumour. Of medical relevance, we also found that THBS1 expression is necessary for tumoroids’ growth. These studies offer novel insights into the molecular mechanisms responsible for tumour establishment and provide an attractive therapeutic avenue in targeting THBS1 to reduce tumour complexity and heterogeneity.
Results
Tumour cells induce a cancer-like behaviour in WT intestinal epithelial cells
To mimic intratumoral heterogeneity in stroma-free conditions, we co-cultured tumoroids derived from primary intestinal tumours of Apc1638N/+ mutant mice (Fodde et al., 1994), labelled by membrane tdTomato (Muzumdar et al., 2007) with WT GFP-marked small intestinal organoids, derived from LifeAct-GFP mice (Riedl et al., 2008; Figure 1—figure supplement 1A). Within 24–48 hr of co-culture with tumoroids, WT organoids (up to 20%), normally displaying the stereotypical budding morphology (Sato et al., 2009; Figure 1A), adopted an unpolarised hollow cystic shape presenting a diameter larger than 100 µm (indicated by arrows in Figure 1B), closely resembling the morphology of Apc mutant tumoroids (Schwank et al., 2013; Figure 1C). To assess if this morphological change was due to mid-range paracrine or juxtacrine signals, we cultured WT organoids in cM from either wildtype (WT-cM) or tumour (T-cM) organoids. Consistent with our observations from co-cultures, WT organoids exposed to T-cM (Figure 1E), but not to WT-cM (Figure 1D), grew as cysts, suggesting that tumoroids secrete factors able to morphologically alter WT epithelial cells. Tumoroids derived from different primary tumours reproducibly induced the cystic ‘transformation’, albeit to variable extents (Figure 1—figure supplement 1B). Of interest, the cM from Apc-/- organoids (derived from VillinCreERT2; Apcflox/flox mice), where Apc knockout was induced by Cre recombination and did not rely on spontaneous Apc LOH, reproduced the effect of T-cM and induced a cystic morphology in WT organoids, confirming a direct effect caused by aberrant Wnt signalling (Figure 1—figure supplement 1C). The morphological change was all the more remarkable as it occurred within 6–12 hr of exposure to T-cM (Figure 1—figure supplement 1D and E) and was reversed after 2–4 days, if no fresh medium was added, suggesting exhaustion of the responsible factor(s) and ruling out the possibility of acquired genetic mutations in normal organoids. Since a cystic organoid morphology has been linked to Wnt pathway activation, we analysed the expression of the quantitative Wnt reporter 7TG (Brugmann et al., 2007). As shown in Figure 1F, cystic organoids grown in T-cM did not present canonical Wnt pathway activation (Figure 1F, right panel), unlike organoids stimulated with the small-molecule CHIR99021, an inhibitor of the enzyme GSK-3, widely used to simulate Wnt activation (Ring et al., 2003; Figure 1F, middle panel). Confirming these observations, we could not observe any significant difference in the number of Lgr5+ cells in the presence of T-cM compared to both WT-cM and normal ENR (Figure 1—figure supplement 1F), whereas exposure to the GSK3 inhibitor CHIR99021 (ENRC) resulted, as expected, in a significant increase in GFP+ cells. Despite absence of Wnt activation and similar numbers of Lgr5-expressing cells (Figure 1F, Figure 1—figure supplement 1F), we found that T-cM-exposed cystic organoids presented a higher proportion of cycling cells (compare cystic ‘C’ and budding ‘B’ in Figure 1G and Figure 1—figure supplement 1G). Moreover, while proliferative cells were restricted to the crypts in control organoids exposed to WT-cM (Figure 1H), cystic organoids in T-cM displayed undifferentiated proliferative cells scattered throughout the newly formed cysts (Figure 1I). The increase in proliferative cells is linked to defective enterocyte differentiation, as shown by loss of Keratin 20 expression (Figure 1I).
Figure 1—figure supplement 1.
Related to Figure 1.
(A) Experimental design of co-culture experiments with green organoids and red tumoroids at 3:1 ratio (wildtype [WT] organoids:tumoroids). ENR: medium containing EGF, Noggin, and R-spondin1. (B) Quantification of the percentage of WT cystic organoids in the presence of conditioned medium (cM) derived from the indicated cultures. (C) Quantification of the percentage of WT cystic organoids in the presence of cM derived from WT organoids, tumoroids, or three different Apc-/- organoids generated from hyperplastic small intestine of VillinCreERT2;Apcflox/flox mice. (D, E) Time-lapse analysis of the growth of WT organoids in the presence of WT-cM (D) or T-cM (E) (in hours:minutes). (F) Quantification of the percentage of Lgr5-GFP+ cells in WT organoids treated with ENR, ENR+CHIR99021 (ENRC), WT-cM or T-cM (n = 4 for each condition). (G) Quantification of the percentage of Ki67+ proliferative cells per organoid for budding organoids grown in WT-cM (B – WT-cM, n = 16), budding organoids grown in T-cM (B – TcM, n = 15) or cystic organoids grown in T-cM (C – T-cM, n = 9). Scale bar = 100 µm. Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Figure 1.
Tumoroids secrete soluble factors that induce a tumour-like cystic morphology in wildtype (WT) organoids.
(A) WT budding organoids marked by LifeAct-GFP (in green) after 24 hr in culture in organoid medium (ENR). (B) WT organoids marked by LifeAct-GFP after 24 hr in co-culture with tdTomato-expressing tumoroids in ENR. Arrows indicate WT (green) cystic organoids. (C) APC mutant cystic tumoroids marked by tdTomato after 24 hr in culture. (D, E) WT budding organoids cultured for 24 hr in conditioned medium from WT organoids (WT-cM in D) or tumoroids (T-cM in E). Arrows indicate WT cystic organoids in (E). (F) Representative images of WT organoids expressing the Wnt reporter 7TG exposed to WT-cM, 10 µM CHIR99021 (CHIR 10 µM) or T-cM for 24 hr. Pseudo-colour shows log10 intensities of the reporter fluorescence. (G) Quantification of the percentage of EdU+ cells per organoid for budding organoids grown in WT-cM (B – WT-cM, n = 14), budding organoids grown in T-cM (B – T-cM, n = 13), or cystic organoids grown in T-cM (C – T-cM, n = 9). (H, I) Immunofluorescence for proliferative cells (EdU in red) and differentiated cells (anti-Keratin 20 in green) in WT organoids grown in WT-cM (H) or T-cM (I) for 24 hr. The corresponding bright-field (BF) images are shown in the right panels. DAPI stains DNA in blue. Scale bar = 100 µm. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
(A) Experimental design of co-culture experiments with green organoids and red tumoroids at 3:1 ratio (wildtype [WT] organoids:tumoroids). ENR: medium containing EGF, Noggin, and R-spondin1. (B) Quantification of the percentage of WT cystic organoids in the presence of conditioned medium (cM) derived from the indicated cultures. (C) Quantification of the percentage of WT cystic organoids in the presence of cM derived from WT organoids, tumoroids, or three different Apc-/- organoids generated from hyperplastic small intestine of VillinCreERT2;Apcflox/flox mice. (D, E) Time-lapse analysis of the growth of WT organoids in the presence of WT-cM (D) or T-cM (E) (in hours:minutes). (F) Quantification of the percentage of Lgr5-GFP+ cells in WT organoids treated with ENR, ENR+CHIR99021 (ENRC), WT-cM or T-cM (n = 4 for each condition). (G) Quantification of the percentage of Ki67+ proliferative cells per organoid for budding organoids grown in WT-cM (B – WT-cM, n = 16), budding organoids grown in T-cM (B – TcM, n = 15) or cystic organoids grown in T-cM (C – T-cM, n = 9). Scale bar = 100 µm. Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Tumoroids secrete soluble factors that induce a tumour-like cystic morphology in wildtype (WT) organoids.
(A) WT budding organoids marked by LifeAct-GFP (in green) after 24 hr in culture in organoid medium (ENR). (B) WT organoids marked by LifeAct-GFP after 24 hr in co-culture with tdTomato-expressing tumoroids in ENR. Arrows indicate WT (green) cystic organoids. (C) APC mutant cystic tumoroids marked by tdTomato after 24 hr in culture. (D, E) WT budding organoids cultured for 24 hr in conditioned medium from WT organoids (WT-cM in D) or tumoroids (T-cM in E). Arrows indicate WT cystic organoids in (E). (F) Representative images of WT organoids expressing the Wnt reporter 7TG exposed to WT-cM, 10 µM CHIR99021 (CHIR 10 µM) or T-cM for 24 hr. Pseudo-colour shows log10 intensities of the reporter fluorescence. (G) Quantification of the percentage of EdU+ cells per organoid for budding organoids grown in WT-cM (B – WT-cM, n = 14), budding organoids grown in T-cM (B – T-cM, n = 13), or cystic organoids grown in T-cM (C – T-cM, n = 9). (H, I) Immunofluorescence for proliferative cells (EdU in red) and differentiated cells (anti-Keratin 20 in green) in WT organoids grown in WT-cM (H) or T-cM (I) for 24 hr. The corresponding bright-field (BF) images are shown in the right panels. DAPI stains DNA in blue. Scale bar = 100 µm. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Related to Figure 1.
(A) Experimental design of co-culture experiments with green organoids and red tumoroids at 3:1 ratio (wildtype [WT] organoids:tumoroids). ENR: medium containing EGF, Noggin, and R-spondin1. (B) Quantification of the percentage of WT cystic organoids in the presence of conditioned medium (cM) derived from the indicated cultures. (C) Quantification of the percentage of WT cystic organoids in the presence of cM derived from WT organoids, tumoroids, or three different Apc-/- organoids generated from hyperplastic small intestine of VillinCreERT2;Apcflox/flox mice. (D, E) Time-lapse analysis of the growth of WT organoids in the presence of WT-cM (D) or T-cM (E) (in hours:minutes). (F) Quantification of the percentage of Lgr5-GFP+ cells in WT organoids treated with ENR, ENR+CHIR99021 (ENRC), WT-cM or T-cM (n = 4 for each condition). (G) Quantification of the percentage of Ki67+ proliferative cells per organoid for budding organoids grown in WT-cM (B – WT-cM, n = 16), budding organoids grown in T-cM (B – TcM, n = 15) or cystic organoids grown in T-cM (C – T-cM, n = 9). Scale bar = 100 µm. Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
THBS1 mediates the organoid morphological and behavioural change
Cancer cells are known to secrete numerous factors to remodel the tumour microenvironment. Having established that the morphological change was mediated by proteins present in the T-cM, since the effect was abolished upon proteinase K treatment (Figure 2—figure supplement 1A), we performed a quantitative proteomics analysis by Stable Isotope Labelled Amino acids in Culture (SILAC) mass spectrometry to define the composition of the T-cM relative to WT-cM. Gene Ontology (GO) analysis of the proteins over-represented in T-cM showed enrichment in cell adhesion, wound healing, and generally ECM-related GO terms (Figure 2—figure supplement 1B). We selected secreted factors that were enriched in T-cM compared to WT-cM (Figure 2—figure supplement 1C) and explored their possible involvement in the morphological ‘transformation’ using neutralising antibodies. Among the tested candidates, we found that neutralisation of the secreted glycoprotein THBS1 alone was sufficient to entirely abolish the morphological change of WT organoids after 24 hr (Figure 2A, Figure 2—figure supplement 1D). Neutralisation of Thbs1 with three blocking antibodies, targeting different epitopes of the protein to exclude any potential non-specific binding, was sufficient to completely block the cystic morphology (Figure 2B, Figure 2—figure supplement 1E). These experiments demonstrated that THBS1 was necessary for the observed cystic phenotype.
Figure 2—figure supplement 1.
Related to Figure 2.
(A) Proteinase K treatment of tumour conditioned medium (T-cM) abolished the cystic transformation. (B) Gene Ontology (GO) analysis of significantly enriched or unique proteins in T-cM compared to wildtype conditioned medium (WT-cM). (C) Volcano plot showing differential enrichment of proteins in T-cM compared to WT-cM by Stable Isotope Labelled Amino acids in Culture (SILAC)-based mass spectrometry. The selected candidates are indicated for one of the replicates in blue. The three different colours (black, blue, and green dots) correspond to three replicates (n = 3). (D) Representative bright-field images of WT organoids grown in T-cM upon neutralisation with blocking antibodies against the indicated proteins. (E) Representative bright-field images of WT organoids grown in normal medium (left panel) or T-cM upon neutralisation with control IgG1 or three different blocking antibodies against THBS1 (clones A4.1, A6.1, and C6.7). (F) Western blot anti-FLAG (targeting overexpressed THBS1-FLAG) and β-actin (loading control) in pure Matrigel, WT organoids infected with a control lentivirus (CTRL) or with lenti-Thbs1 (THBS1-Flag), HEK293T cells infected with lenti-Thbs1 (THBS1-Flag) or control lentivirus (CTRL). Scale bar = 100 µm in (A), 500 µm in (D, E) (100 µm in insets in E). Cystic organoids are indicated by red arrowheads in (A), (D), and (E).
Figure 2.
Thrombospondin-1 (THBS1) is necessary and sufficient for the morphological ‘transformation’ of wildtype (WT) organoids.
(A) Quantification of the percentage of WT cystic organoids in T-cM upon neutralisation with blocking antibodies against ceruloplasmin (CP), connective tissue growth factor (CTGF), hepatoma-derived growth factor (HDGF), galectin-3 (LGALS3), galectin-3 binding protein (LGALS3BP), thrombospondin-1 (THBS1), and transthyretin (TTR) (5 µg/ml). (B) Quantification of the percentage of WT cystic organoids in T-cM upon neutralisation with three different blocking antibodies against THBS1 (clones A4.1, A6.1, and C6.7 at 5 µg/ml). (C) Quantification of the percentage of EdU+ cells (2 hr pulse) per organoid for WT budding (B – IgG1, n = 9) or cystic organoids (C – IgG1, n = 4) exposed to T-cM in the presence of IgG1 or antibodies anti-THBS1 (B – anti-THBS1, n = 9). (D–F) Whole-mount immunostaining for proliferation (EdU in red) and apoptosis (anti-cleaved caspase-3, CASP3 in green) of WT organoids exposed to T-cM with anti-IgG1 control (D, E) or anti-THBS1 (F) antibodies. DAPI stains DNA in blue. The corresponding bright-field (BF) images are shown on the right panels. (G, H) Representative pictures of self-transformed WT organoids overexpressing Thbs1 (Lenti-Thbs1 in H) and control organoids infected with an empty vector (Lenti-Control in G). Black arrows indicate cystic organoids. (I) Quantification of the percentage of cystic organoids in Thbs1-expressing cultures (Lenti-Thbs1) versus control cultures (Lenti-Control) grown for 24 hr in ENR medium (n = 5). Scale bars = 100 µm in (D–F) and in the insets of (G, H) and 500 µm in (G, H) low magnification. Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
(A) Proteinase K treatment of tumour conditioned medium (T-cM) abolished the cystic transformation. (B) Gene Ontology (GO) analysis of significantly enriched or unique proteins in T-cM compared to wildtype conditioned medium (WT-cM). (C) Volcano plot showing differential enrichment of proteins in T-cM compared to WT-cM by Stable Isotope Labelled Amino acids in Culture (SILAC)-based mass spectrometry. The selected candidates are indicated for one of the replicates in blue. The three different colours (black, blue, and green dots) correspond to three replicates (n = 3). (D) Representative bright-field images of WT organoids grown in T-cM upon neutralisation with blocking antibodies against the indicated proteins. (E) Representative bright-field images of WT organoids grown in normal medium (left panel) or T-cM upon neutralisation with control IgG1 or three different blocking antibodies against THBS1 (clones A4.1, A6.1, and C6.7). (F) Western blot anti-FLAG (targeting overexpressed THBS1-FLAG) and β-actin (loading control) in pure Matrigel, WT organoids infected with a control lentivirus (CTRL) or with lenti-Thbs1 (THBS1-Flag), HEK293T cells infected with lenti-Thbs1 (THBS1-Flag) or control lentivirus (CTRL). Scale bar = 100 µm in (A), 500 µm in (D, E) (100 µm in insets in E). Cystic organoids are indicated by red arrowheads in (A), (D), and (E).
Thrombospondin-1 (THBS1) is necessary and sufficient for the morphological ‘transformation’ of wildtype (WT) organoids.
(A) Quantification of the percentage of WT cystic organoids in T-cM upon neutralisation with blocking antibodies against ceruloplasmin (CP), connective tissue growth factor (CTGF), hepatoma-derived growth factor (HDGF), galectin-3 (LGALS3), galectin-3 binding protein (LGALS3BP), thrombospondin-1 (THBS1), and transthyretin (TTR) (5 µg/ml). (B) Quantification of the percentage of WT cystic organoids in T-cM upon neutralisation with three different blocking antibodies against THBS1 (clones A4.1, A6.1, and C6.7 at 5 µg/ml). (C) Quantification of the percentage of EdU+ cells (2 hr pulse) per organoid for WT budding (B – IgG1, n = 9) or cystic organoids (C – IgG1, n = 4) exposed to T-cM in the presence of IgG1 or antibodies anti-THBS1 (B – anti-THBS1, n = 9). (D–F) Whole-mount immunostaining for proliferation (EdU in red) and apoptosis (anti-cleaved caspase-3, CASP3 in green) of WT organoids exposed to T-cM with anti-IgG1 control (D, E) or anti-THBS1 (F) antibodies. DAPI stains DNA in blue. The corresponding bright-field (BF) images are shown on the right panels. (G, H) Representative pictures of self-transformed WT organoids overexpressing Thbs1 (Lenti-Thbs1 in H) and control organoids infected with an empty vector (Lenti-Control in G). Black arrows indicate cystic organoids. (I) Quantification of the percentage of cystic organoids in Thbs1-expressing cultures (Lenti-Thbs1) versus control cultures (Lenti-Control) grown for 24 hr in ENR medium (n = 5). Scale bars = 100 µm in (D–F) and in the insets of (G, H) and 500 µm in (G, H) low magnification. Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Related to Figure 2.
(A) Proteinase K treatment of tumour conditioned medium (T-cM) abolished the cystic transformation. (B) Gene Ontology (GO) analysis of significantly enriched or unique proteins in T-cM compared to wildtype conditioned medium (WT-cM). (C) Volcano plot showing differential enrichment of proteins in T-cM compared to WT-cM by Stable Isotope Labelled Amino acids in Culture (SILAC)-based mass spectrometry. The selected candidates are indicated for one of the replicates in blue. The three different colours (black, blue, and green dots) correspond to three replicates (n = 3). (D) Representative bright-field images of WT organoids grown in T-cM upon neutralisation with blocking antibodies against the indicated proteins. (E) Representative bright-field images of WT organoids grown in normal medium (left panel) or T-cM upon neutralisation with control IgG1 or three different blocking antibodies against THBS1 (clones A4.1, A6.1, and C6.7). (F) Western blot anti-FLAG (targeting overexpressed THBS1-FLAG) and β-actin (loading control) in pure Matrigel, WT organoids infected with a control lentivirus (CTRL) or with lenti-Thbs1 (THBS1-Flag), HEK293T cells infected with lenti-Thbs1 (THBS1-Flag) or control lentivirus (CTRL). Scale bar = 100 µm in (A), 500 µm in (D, E) (100 µm in insets in E). Cystic organoids are indicated by red arrowheads in (A), (D), and (E).In order to test if THBS1 neutralisation was also able to rescue the ectopic proliferation, we counted the number of proliferative cells per organoid. Consistent with our previous observations, cystic organoids presented ectopically proliferating cells when cultured with IgG1 control antibodies (Figure 2C and E). However, addition of anti-THBS1 antibodies abolished ectopic proliferation and restricted EdU+ cells exclusively to the crypts (Figure 2C and F). Treatment with anti-THBS1 antibodies did not present toxicity to normal organoids, as no increase in apoptotic cells was observed (Figure 2D–F). Moreover, THBS1 was sufficient to induce the morphological change, since its ectopic expression in WT organoids (Figure 2—figure supplement 1F) also led to cyst development (Figure 2G–I), to the same extent as T-cM (Figure 2I). Of note, culture of WT organoids in the presence of recombinant THBS1 did not elicit any effect, possibly due to the lack of essential post-translational modifications.
THBS1 is necessary for the growth of tumoroids but not of normal organoids
We observed that Thbs1 is exclusively expressed by tumour but not WT intestinal cells (Figure 2—figure supplement 1C, Figure 5—figure supplement 1D); surprisingly, we found that THBS1 is also essential for tumoroids’ growth. Indeed, neutralisation of THBS1 for 48 hr specifically reduced tumoroid survival and considerably arrested their growth (Figure 3A–D and G–J, Figure 3—figure supplement 1A). Importantly, the same tumoroid growth inhibition was observed upon Thbs1 genetic deletion (Figure 3E and F) using CRISPR-Cas9 knockout (Figure 3—figure supplement 1B–E). Quantification of the proportion of dividing cells showed that neutralisation of THBS1 significantly reduced tumoroids’ proliferative capacity (Figure 3M, N and P), without affecting the growth of normal organoids (Figure 3K, L and O), suggesting a promising therapeutic avenue.
Figure 5—figure supplement 1.
Related to Figure 5.
(A, B) Representative sections of single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) targeting Thbs1 (pThbs1, red dots) in the small intestine of wildtype (WT) mice (ApcWT in A) or VillinCreERT2;Apcflox/flox mice (Apc-/- in B). (C) Quantification of the number of Thbs1 dots per field in ApcWT or Apc-/- small intestine. (D) Representative sections of smRNA FISH targeting Thbs1 (pThbs1, red dots) and the Wnt target Axin2 (pAxin2, green dots) in mouse intestinal tumours (Apc1638N). (E) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Lgr5 only (green), or co-expressing both (yellow) annotated by three independent and double-blinded investigators, corresponding to Figure 5A and B. (F, G) Representative sections of mouse intestinal tumours analysed by smRNA FISH for Thbs1 (pThbs1, green dots) and immunostained with an antibody against the epithelial marker Keratin 20 (K20 in red in F) or with anti-THBS1 antibody (in red in G). (H, I) Representative sections of Apc mutant intestinal tumours analysed by smRNA FISH for the YAP target genes Ctgf (pCtgf, green dots in H) or Cyr61 (pCyr61, green dots in I) and Thbs1 (pThbs1, red dots). (J) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Sca1 only (green), or co-expressing both (yellow) annotated by three independent and double-blinded investigators, corresponding to Figure 5C and D. (K) Representative sections of Apc mutant intestinal tumours immunostained for YAP1 (in red) and KI67 (in green). White arrows in insets show nuclear YAP1HIGH/Ki67+ cells (n = 6 sections from three tumours). (L) Representative sections of chemically induced colon tumours analysed by smRNA FISH for expression of Thbs1 (pThbs1, red dots) and the YAP target gene Sca1 (pSca1, green dots); regions presenting co-localisation of Thbs1 and Sca1 are outlined in yellow. (M) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Sca1 only (green), or both (yellow). The observed mutual exclusion of red and green regions is statistically significant compared to the calculated probability of random co-expression (blue column) (n = 30 sections from five tumours). E-cadherin antibody in white demarcates epithelial cells in (A, B, D, H, L). DAPI labels nuclei in blue. Scale bar = 50 µm (10 µm in the insets). Statistical analysis was performed with two-tailed unpaired Welch’s t-tests in (C) (p=0.0506) and Wilcoxon test in (M).
Figure 3.
Thrombospondin-1 (THBS1) is essential for the growth of tumoroids.
(A–D) Representative bright-field images of wildtype (WT) organoids (A, B) or tumoroids (C, D) incubated with IgG1 isotype control antibodies (A, C) or anti-THBS1 A6.1-neutralising antibody (B, D) (10 µg/ml). (E, F) Representative images of tumoroids infected with a lentivirus CRISPR-GFP without sgRNA (control in E) or with an sgRNA targeting Thbs1 (Thbs1-KO in F) 48 hr after replacement of single-cell seeding medium (ENRC) by tumoroid medium (EN). (G, H) Quantification of the number of tumoroids upon antibody neutralisation relative to their size: small tumoroids between 30 and 150 µm in (G); large tumoroids of more than 150 µm diameter in (H). (I) Quantification of the percentage of cystic tumoroids upon treatment by IgG1 isotype control antibodies or three different neutralising antibodies targeting THBS1 (as indicated) for 48 hr. (J) Paired quantification of the number of living tumoroids derived from four independent tumours (from four mice) upon treatment with three neutralising antibodies targeting THBS1 for 48 hr. Antibody concentration: 10 µg/ml. (K–N) Immunofluorescence staining for proliferative cells (EdU in red) and apoptosis (anti-cleaved caspase-3, CASP3 in green) in WT organoids (K, L) or tumoroids (M, N) exposed to IgG1 isotype control antibodies (K, M) or to anti-THBS1 A6.1-neutralising antibody (L, N). (O, P) Quantification of EdU+ cells per organoid (O) or tumoroid (P) in the presence of IgG1 control or anti-THBS1 (A6.1) antibodies. Scale bars = 100 µm. Graphs indicate average values ± SD. Statistical analysis was performed with paired Student’s t-test in (G–J) and two-tailed unpaired Welch’s t-tests in (O) and (P).
(A) Representative images of tumoroids cultures grown for 48 hr in EN medium in the presence of control IgG1 or anti-THBS1-neutralising antibodies A6.1, A4.1, C6.7, as indicated. (B) Analysis of CRISPR edits from Sanger sequencing of DNA at the expected cut site for Cas9 in wildtype (WT) or THBS1 KO mouse embryonic fibroblasts infected with no sgRNA or sgRNA targeting Thbs1, respectively. Red boxes indicate the sgRNA sequences with the PAM sequence underlined in red; red vertical dashed lines indicate the expected cut site. (C, D) Representative images of tumoroids infected with lenti-CRISPR expressing no sgRNA (CTRL in C) or sgThbs1 (KO in D) probed for Thbs1 expression using single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) with a probe recognising Thbs1 (pThbs1 in white). Red fluorescence indicates infected cells and DAPI stains the nuclei. (E) Quantification of the percentage of infected cells (red) expressing Thbs1 per organoid (n = 3). Scale bar = 500 µm in (A) and 100 µm in (C, D) and insets in (A). Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Figure 3—figure supplement 1.
Related to Figure 3.
(A) Representative images of tumoroids cultures grown for 48 hr in EN medium in the presence of control IgG1 or anti-THBS1-neutralising antibodies A6.1, A4.1, C6.7, as indicated. (B) Analysis of CRISPR edits from Sanger sequencing of DNA at the expected cut site for Cas9 in wildtype (WT) or THBS1 KO mouse embryonic fibroblasts infected with no sgRNA or sgRNA targeting Thbs1, respectively. Red boxes indicate the sgRNA sequences with the PAM sequence underlined in red; red vertical dashed lines indicate the expected cut site. (C, D) Representative images of tumoroids infected with lenti-CRISPR expressing no sgRNA (CTRL in C) or sgThbs1 (KO in D) probed for Thbs1 expression using single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) with a probe recognising Thbs1 (pThbs1 in white). Red fluorescence indicates infected cells and DAPI stains the nuclei. (E) Quantification of the percentage of infected cells (red) expressing Thbs1 per organoid (n = 3). Scale bar = 500 µm in (A) and 100 µm in (C, D) and insets in (A). Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Thrombospondin-1 (THBS1) is essential for the growth of tumoroids.
(A–D) Representative bright-field images of wildtype (WT) organoids (A, B) or tumoroids (C, D) incubated with IgG1 isotype control antibodies (A, C) or anti-THBS1 A6.1-neutralising antibody (B, D) (10 µg/ml). (E, F) Representative images of tumoroids infected with a lentivirus CRISPR-GFP without sgRNA (control in E) or with an sgRNA targeting Thbs1 (Thbs1-KO in F) 48 hr after replacement of single-cell seeding medium (ENRC) by tumoroid medium (EN). (G, H) Quantification of the number of tumoroids upon antibody neutralisation relative to their size: small tumoroids between 30 and 150 µm in (G); large tumoroids of more than 150 µm diameter in (H). (I) Quantification of the percentage of cystic tumoroids upon treatment by IgG1 isotype control antibodies or three different neutralising antibodies targeting THBS1 (as indicated) for 48 hr. (J) Paired quantification of the number of living tumoroids derived from four independent tumours (from four mice) upon treatment with three neutralising antibodies targeting THBS1 for 48 hr. Antibody concentration: 10 µg/ml. (K–N) Immunofluorescence staining for proliferative cells (EdU in red) and apoptosis (anti-cleaved caspase-3, CASP3 in green) in WT organoids (K, L) or tumoroids (M, N) exposed to IgG1 isotype control antibodies (K, M) or to anti-THBS1 A6.1-neutralising antibody (L, N). (O, P) Quantification of EdU+ cells per organoid (O) or tumoroid (P) in the presence of IgG1 control or anti-THBS1 (A6.1) antibodies. Scale bars = 100 µm. Graphs indicate average values ± SD. Statistical analysis was performed with paired Student’s t-test in (G–J) and two-tailed unpaired Welch’s t-tests in (O) and (P).
Related to Figure 3.
(A) Representative images of tumoroids cultures grown for 48 hr in EN medium in the presence of control IgG1 or anti-THBS1-neutralising antibodies A6.1, A4.1, C6.7, as indicated. (B) Analysis of CRISPR edits from Sanger sequencing of DNA at the expected cut site for Cas9 in wildtype (WT) or THBS1 KO mouse embryonic fibroblasts infected with no sgRNA or sgRNA targeting Thbs1, respectively. Red boxes indicate the sgRNA sequences with the PAM sequence underlined in red; red vertical dashed lines indicate the expected cut site. (C, D) Representative images of tumoroids infected with lenti-CRISPR expressing no sgRNA (CTRL in C) or sgThbs1 (KO in D) probed for Thbs1 expression using single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) with a probe recognising Thbs1 (pThbs1 in white). Red fluorescence indicates infected cells and DAPI stains the nuclei. (E) Quantification of the percentage of infected cells (red) expressing Thbs1 per organoid (n = 3). Scale bar = 500 µm in (A) and 100 µm in (C, D) and insets in (A). Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
WT organoids activate a regenerative/foetal transcriptional programme upon the influence of tumoroids’ conditioned medium
In order to decipher the molecular responses of WT epithelial cells to T-cM, we obtained the gene expression profiles of WT organoids exposed to either T-cM or WT-cM, along with the transcriptional signature of the tumoroids from which the corresponding T-cM was derived. Interestingly, we found that T-cM induced transcriptional responses enriched for genes upregulated in cancer, including colorectal adenoma (Figure 4—figure supplement 1A, red), suggesting that, alongside the typical tumour-like cystic morphology, WT cells also acquire signatures characteristics of tumour cells when exposed to T-cM. Furthermore, this analysis revealed that organoids grown in the presence of T-cM showed enrichment of genes of the Yes-associated protein (YAP)/Hippo pathway (Figure 4—figure supplement 1A, green). Given the intricate relationship between Wnt signalling and YAP in the intestine, suggesting that tumour formation requires additional signals other than Wnt, that induce YAP nuclear translocation (Cai et al., 2015; Azzolin et al., 2014; Gregorieff et al., 2015; Taniguchi et al., 2015; Taniguchi et al., 2017; Guillermin et al., 2021), we assessed the involvement of the YAP pathway in T-cM-mediated phenotypes. First, we compared our RNA-sequencing results to a YAP activation signature from intestinal organoids (Gregorieff et al., 2015) using Gene Set Enrichment Analysis (GSEA) and found a strong correlation with both WT organoids (Figure 4A) and tumoroids (Figure 4D). Consistent with recent studies describing YAP activation as an integral part of the regenerative and foetal programmes of the normal intestinal epithelium (Yui et al., 2018), we found a robust association with the reported physiological ‘foetal human colitis’ intestinal signature (Yui et al., 2018; Figure 4B and E), suggesting a link between the morphological change we characterised and reactivation of regenerative/foetal programmes occurring during tumorigenesis. These findings indicate that WT organoids in the presence of tumour-secreted factors, including THBS1, switch their transcriptional programme from a Wnt-dependent homeostatic to a Wnt-independent, YAP-dependent regenerative/foetal-like response, repressing differentiation genes (Figures 1I, 4C and F) without significantly affecting Wnt signalling (Figure 1F, Figure 4—figure supplement 1B).
Figure 4—figure supplement 1.
Related to Figure 4.
(A) Pathway analysis of selected KEGG and GSEA-MSigDB terms enriched in the signatures of organoids grown in tumour conditioned medium (T-cM) (left panel) or tumoroids (right panel). (B) Gene Set Enrichment Analysis (GSEA) comparing differentially expressed genes in wildtype (WT) organoids exposed to T-cM or in tumoroids with the WNT signature (Nusse Lab). Green NES: positive correlation; grey NES: non-significant correlation. (C, D) Representative bright-field images of WT organoids grown in T-cM in the presence of DMSO (C) or the YAP inhibitor verteporfin (D). (E) Map of the lenti-sgRNA-tdTomato lentiviral vector used for knockout experiments and schematic diagram of the RosaCREERT2;Cas9-GFP mouse line used to derive WT organoids. (F) Analysis of CRISPR edits from Sanger sequencing of DNA at the expected cut site for Cas9 in mouse embryonic fibroblasts infected with no sgRNA (WT) or sgRNAs targeting Yap1 (KO in F, left) and Tead4 (KO in F, right). Red boxes indicate the sgRNA sequences with the PAM sequence underlined in red; red vertical dashed lines indicate the expected cut site. (G, H) Representative immunofluorescence against YAP1 (in red) of colonoids exposed to WT-cM (G) or T-cM (H) for 24 hr. DAPI stains DNA in blue. (I, J) Quantification of the percentage of YAPHIGH cells/organoid based on the ratio of nuclear vs. cytoplasmic YAP1 (I) or of EdU+ cells/organoid (J) in WT colonoids grown in WT-cM or T-cM. Scale bar = 100 µm. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Figure 4.
Tumour conditioned medium (T-cM) induces YAP pathway activation and a foetal-like state in wildtype (WT) organoids.
Gene Set Enrichment Analyses (GSEA) showing the correlation between differentially expressed genes in WT organoids cultured in T-cM (A–C) or tumoroids (D–F) and the indicated transcriptional signatures. NES: Normalised Enrichment Score; green NES: positive correlation; red NES: inverse correlation. (G) Representative image of WT organoids expressing Cas9-GFP (in green) transduced with an sgRNA targeting Yap1 (sgYap1 in red). Higher magnification of a budding Yap1KO organoid (in yellow in G′) and a cystic Yap1WT organoid expressing only Cas9-GFP but no sgRNA (in green in G′′). (H) Percentage of cystic organoids induced by exposure to T-cM in WT, Yap1KO or Tead4KO organoids, as indicated. (I–N) Max projections of immunostaining for YAP1 (in red) of WT organoids exposed to WT-cM (I), or T-cM (J–L) for 24 hr presenting cystic (J) or budding (K, L) morphologies. Organoids in (L) are treated by neutralising antibodies targeting THBS1 (A6.1), which rescues the budding morphology. Organoids in (M) overexpress THBS1 (LentiThbs1) and tumoroids are shown in (N). DAPI stains DNA in blue. White arrowheads pinpoint YAPHIGH cells in Z-section insets. (O) Quantification of the percentage of nuclear YAP (nYAPHIGH) cells/organoid based on the ratio of nuclear vs. cytoplasmic YAP1 in cystic and budding WT organoids grown in WT-cM or T-cM for 24 hr, in WT organoids overexpressing Thbs1 (lenti-Thbs1) or tumoroids, as indicated. (P) Quantification of the percentage of nYAPHIGH cells/organoid in WT organoids cultured with T-cM and control IgG1 or anti-THBS1 (A6.1) antibodies for 24 hr. Scale bars correspond to 100 µm in (G, I–N). Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests. For the lenti-Thbs1 sample, a Welch’s corrected t-test was applied to compare the percentage of nYAPHIGH cells/organoid between Thbs1-expressing organoids and WT organoids infected with an empty lentivirus.
(A) Pathway analysis of selected KEGG and GSEA-MSigDB terms enriched in the signatures of organoids grown in tumour conditioned medium (T-cM) (left panel) or tumoroids (right panel). (B) Gene Set Enrichment Analysis (GSEA) comparing differentially expressed genes in wildtype (WT) organoids exposed to T-cM or in tumoroids with the WNT signature (Nusse Lab). Green NES: positive correlation; grey NES: non-significant correlation. (C, D) Representative bright-field images of WT organoids grown in T-cM in the presence of DMSO (C) or the YAP inhibitor verteporfin (D). (E) Map of the lenti-sgRNA-tdTomato lentiviral vector used for knockout experiments and schematic diagram of the RosaCREERT2;Cas9-GFP mouse line used to derive WT organoids. (F) Analysis of CRISPR edits from Sanger sequencing of DNA at the expected cut site for Cas9 in mouse embryonic fibroblasts infected with no sgRNA (WT) or sgRNAs targeting Yap1 (KO in F, left) and Tead4 (KO in F, right). Red boxes indicate the sgRNA sequences with the PAM sequence underlined in red; red vertical dashed lines indicate the expected cut site. (G, H) Representative immunofluorescence against YAP1 (in red) of colonoids exposed to WT-cM (G) or T-cM (H) for 24 hr. DAPI stains DNA in blue. (I, J) Quantification of the percentage of YAPHIGH cells/organoid based on the ratio of nuclear vs. cytoplasmic YAP1 (I) or of EdU+ cells/organoid (J) in WT colonoids grown in WT-cM or T-cM. Scale bar = 100 µm. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.
Tumour conditioned medium (T-cM) induces YAP pathway activation and a foetal-like state in wildtype (WT) organoids.
Gene Set Enrichment Analyses (GSEA) showing the correlation between differentially expressed genes in WT organoids cultured in T-cM (A–C) or tumoroids (D–F) and the indicated transcriptional signatures. NES: Normalised Enrichment Score; green NES: positive correlation; red NES: inverse correlation. (G) Representative image of WT organoids expressing Cas9-GFP (in green) transduced with an sgRNA targeting Yap1 (sgYap1 in red). Higher magnification of a budding Yap1KO organoid (in yellow in G′) and a cystic Yap1WT organoid expressing only Cas9-GFP but no sgRNA (in green in G′′). (H) Percentage of cystic organoids induced by exposure to T-cM in WT, Yap1KO or Tead4KO organoids, as indicated. (I–N) Max projections of immunostaining for YAP1 (in red) of WT organoids exposed to WT-cM (I), or T-cM (J–L) for 24 hr presenting cystic (J) or budding (K, L) morphologies. Organoids in (L) are treated by neutralising antibodies targeting THBS1 (A6.1), which rescues the budding morphology. Organoids in (M) overexpress THBS1 (LentiThbs1) and tumoroids are shown in (N). DAPI stains DNA in blue. White arrowheads pinpoint YAPHIGH cells in Z-section insets. (O) Quantification of the percentage of nuclear YAP (nYAPHIGH) cells/organoid based on the ratio of nuclear vs. cytoplasmic YAP1 in cystic and budding WT organoids grown in WT-cM or T-cM for 24 hr, in WT organoids overexpressing Thbs1 (lenti-Thbs1) or tumoroids, as indicated. (P) Quantification of the percentage of nYAPHIGH cells/organoid in WT organoids cultured with T-cM and control IgG1 or anti-THBS1 (A6.1) antibodies for 24 hr. Scale bars correspond to 100 µm in (G, I–N). Graphs indicate average values ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests. For the lenti-Thbs1 sample, a Welch’s corrected t-test was applied to compare the percentage of nYAPHIGH cells/organoid between Thbs1-expressing organoids and WT organoids infected with an empty lentivirus.
Related to Figure 4.
(A) Pathway analysis of selected KEGG and GSEA-MSigDB terms enriched in the signatures of organoids grown in tumour conditioned medium (T-cM) (left panel) or tumoroids (right panel). (B) Gene Set Enrichment Analysis (GSEA) comparing differentially expressed genes in wildtype (WT) organoids exposed to T-cM or in tumoroids with the WNT signature (Nusse Lab). Green NES: positive correlation; grey NES: non-significant correlation. (C, D) Representative bright-field images of WT organoids grown in T-cM in the presence of DMSO (C) or the YAP inhibitor verteporfin (D). (E) Map of the lenti-sgRNA-tdTomato lentiviral vector used for knockout experiments and schematic diagram of the RosaCREERT2;Cas9-GFP mouse line used to derive WT organoids. (F) Analysis of CRISPR edits from Sanger sequencing of DNA at the expected cut site for Cas9 in mouse embryonic fibroblasts infected with no sgRNA (WT) or sgRNAs targeting Yap1 (KO in F, left) and Tead4 (KO in F, right). Red boxes indicate the sgRNA sequences with the PAM sequence underlined in red; red vertical dashed lines indicate the expected cut site. (G, H) Representative immunofluorescence against YAP1 (in red) of colonoids exposed to WT-cM (G) or T-cM (H) for 24 hr. DAPI stains DNA in blue. (I, J) Quantification of the percentage of YAPHIGH cells/organoid based on the ratio of nuclear vs. cytoplasmic YAP1 (I) or of EdU+ cells/organoid (J) in WT colonoids grown in WT-cM or T-cM. Scale bar = 100 µm. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests.To assess the functional significance of YAP pathway activation, we pharmacologically blocked it using verteporfin, an inhibitor of the YAP-TEAD interaction (Liu-Chittenden et al., 2012), and observed a complete loss of cystic organoids with no discernible effects on their growth (Figure 4—figure supplement 1C and D). We further corroborated these results through the genetic deletion by CRISPR/Cas9 of Yap1 and one of its cellular effectors, the transcription factor Tead4 (Guillermin et al., 2021), found upregulated upon exposure to T-cM (Figure 4—figure supplement 1E and F). Yap1 or Tead4 knockout in WT organoids (Figure 4G) caused a considerable decrease in the proportion of cystic organoids induced by T-cM, suggesting that the YAP/Hippo pathway mediates the morphological change (Figure 4H). We further found that WT organoids, upon T-cM exposure, displayed a higher number of cells with nuclear YAP1, a readout of YAP pathway activation and a typical characteristic of tumoroids (Figure 4I–K and O). Notably, T-cM induces nuclear YAP accumulation in both cystic and budding organoids (Figure 4J, K and O), suggesting that YAP activation is necessary but not sufficient to induce the switch to the cystic phenotype.Importantly, neutralisation of THBS1 with three blocking antibodies was sufficient to rescue both the cystic phenotype and YAP nuclear accumulation since the proportion of cells presenting nuclear YAP dropped to control levels (Figure 4L and P). Corroborating the key role of THBS1 in YAP activation, we also found that lentiviral overexpression of THBS1 (Lenti-Thbs1) was sufficient to trigger both cystic shapes and YAP nuclear translocation (Figure 4M and O). Furthermore, we assayed the effect of T-cM onto organoids derived from mouse colon (colonoids) and confirmed that T-cM also induced YAP activation and promoted proliferation in colonoids (Figure 4—figure supplement 1G–J), like in small intestinal organoids, consolidating the relevance of our findings to colon cancer.
Thbs1-expressing and YAP-activated tumour cells are mutually exclusive in mouse tumours
To further substantiate the in vivo relevance of our results, we induced acute Apc loss in VillinCreERT2;Apcflox/flox mice for a short time (4 days) and found that Thbs1 was ectopically expressed by Apc mutant intestinal epithelial cells, indicating that Thbs1 expression is induced by Wnt activation (Figure 5—figure supplement 1A–C). To demonstrate that YAP nuclear accumulation is induced in WT epithelial cells neighbouring mutant tumour cells, we induced mosaic Apc loss in both VillinCreERT2;Apcflox/+ and VillinCreERT2;Apcflox/flox mice, allowing us to study non-recombined WT epithelial cells adjacent to or within Apc mutant tumours. These experiments showed that in both Apc heterozygotes (Figure 5F) and homozygotes (Figure 5G) mice, the majority of the cells presenting nuclear YAP do not coincide with Apc mutant cells (displaying high levels of cytoplasmic and nuclear β-catenin, indicative of Wnt activation), but they are always in close proximity to mutant cells.
Figure 5.
Thbs1 is expressed by Lgr5+ cancer stem cells in vivo and induces YAP activation in neighbouring epithelial cells.
(A, C) Representative section of Apc mutant intestinal tumours analysed by single-molecule fluorescence in situ hybridisation (smFISH) for Thbs1 (pThbs1, red dots) and Lgr5 (pLgr5, green dots in A) or the YAP target Sca1 (pSca1, green dots in C). Examples of segmented and processed region of interest (ROI) that were automatically counted as co-localisation (Thbs1+/Lgr5+ in A or Thbs1+/Sca1+ cells in C outlined in yellow and indicated by yellow arrows) or single-probe expression (outlined in red or green and indicated by arrows of the corresponding colour) are shown. E-cadherin demarcates epithelial cells in white and DAPI labels nuclei in blue in (A) and (C). (B, D) Quantification of the frequency of tumour regions expressing exclusively one probe or co-expressing two probes (yellow): Thbs1 only in red or Lgr5 only in green (B); Thbs1 only in red or Sca1 only in green (D). The observed frequencies of co-localisation (yellow in B) or mutual exclusion (yellow in D) are statistically significant compared to the calculated probability of random co-expression (blue columns) (n = 22 sections from two tumours in B and n = 51 sections from five tumours in D). (E) Correlation of the number of RNA molecules (dots/mm²) detected by single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) for the YAP target CTGF and Thbs1 in mouse intestinal tumours. Red dots indicate large tumours (≥ 8 mm), orange dots small tumours (<8 mm). Dashed lines indicate 95% confidence intervals. (F, G) Representative sections of tumours derived from VillinCreERT2;Apcflox/+ (Apc+/- in F) or VillinCreERT2;Apcflox/flox (Apc-/- in G) immunostained for YAP1 (in red) and β-catenin (in green). Wildtype (WT) glands displaying membrane-bound β-catenin, adjacent to mutant areas presenting diffuse cytoplasmic/nuclear β-catenin expression are demarcated by dashed lines. White arrows indicate examples of cells showing high levels of nuclear YAP. Scale bars = 50 µm and 10 µm in insets. Statistical analysis was performed with Wilcoxon test in (B–D) and linear regression test with 95% confidence in (E).
(A, B) Representative sections of single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) targeting Thbs1 (pThbs1, red dots) in the small intestine of wildtype (WT) mice (ApcWT in A) or VillinCreERT2;Apcflox/flox mice (Apc-/- in B). (C) Quantification of the number of Thbs1 dots per field in ApcWT or Apc-/- small intestine. (D) Representative sections of smRNA FISH targeting Thbs1 (pThbs1, red dots) and the Wnt target Axin2 (pAxin2, green dots) in mouse intestinal tumours (Apc1638N). (E) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Lgr5 only (green), or co-expressing both (yellow) annotated by three independent and double-blinded investigators, corresponding to Figure 5A and B. (F, G) Representative sections of mouse intestinal tumours analysed by smRNA FISH for Thbs1 (pThbs1, green dots) and immunostained with an antibody against the epithelial marker Keratin 20 (K20 in red in F) or with anti-THBS1 antibody (in red in G). (H, I) Representative sections of Apc mutant intestinal tumours analysed by smRNA FISH for the YAP target genes Ctgf (pCtgf, green dots in H) or Cyr61 (pCyr61, green dots in I) and Thbs1 (pThbs1, red dots). (J) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Sca1 only (green), or co-expressing both (yellow) annotated by three independent and double-blinded investigators, corresponding to Figure 5C and D. (K) Representative sections of Apc mutant intestinal tumours immunostained for YAP1 (in red) and KI67 (in green). White arrows in insets show nuclear YAP1HIGH/Ki67+ cells (n = 6 sections from three tumours). (L) Representative sections of chemically induced colon tumours analysed by smRNA FISH for expression of Thbs1 (pThbs1, red dots) and the YAP target gene Sca1 (pSca1, green dots); regions presenting co-localisation of Thbs1 and Sca1 are outlined in yellow. (M) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Sca1 only (green), or both (yellow). The observed mutual exclusion of red and green regions is statistically significant compared to the calculated probability of random co-expression (blue column) (n = 30 sections from five tumours). E-cadherin antibody in white demarcates epithelial cells in (A, B, D, H, L). DAPI labels nuclei in blue. Scale bar = 50 µm (10 µm in the insets). Statistical analysis was performed with two-tailed unpaired Welch’s t-tests in (C) (p=0.0506) and Wilcoxon test in (M).
Thbs1 is expressed by Lgr5+ cancer stem cells in vivo and induces YAP activation in neighbouring epithelial cells.
(A, C) Representative section of Apc mutant intestinal tumours analysed by single-molecule fluorescence in situ hybridisation (smFISH) for Thbs1 (pThbs1, red dots) and Lgr5 (pLgr5, green dots in A) or the YAP target Sca1 (pSca1, green dots in C). Examples of segmented and processed region of interest (ROI) that were automatically counted as co-localisation (Thbs1+/Lgr5+ in A or Thbs1+/Sca1+ cells in C outlined in yellow and indicated by yellow arrows) or single-probe expression (outlined in red or green and indicated by arrows of the corresponding colour) are shown. E-cadherin demarcates epithelial cells in white and DAPI labels nuclei in blue in (A) and (C). (B, D) Quantification of the frequency of tumour regions expressing exclusively one probe or co-expressing two probes (yellow): Thbs1 only in red or Lgr5 only in green (B); Thbs1 only in red or Sca1 only in green (D). The observed frequencies of co-localisation (yellow in B) or mutual exclusion (yellow in D) are statistically significant compared to the calculated probability of random co-expression (blue columns) (n = 22 sections from two tumours in B and n = 51 sections from five tumours in D). (E) Correlation of the number of RNA molecules (dots/mm²) detected by single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) for the YAP target CTGF and Thbs1 in mouse intestinal tumours. Red dots indicate large tumours (≥ 8 mm), orange dots small tumours (<8 mm). Dashed lines indicate 95% confidence intervals. (F, G) Representative sections of tumours derived from VillinCreERT2;Apcflox/+ (Apc+/- in F) or VillinCreERT2;Apcflox/flox (Apc-/- in G) immunostained for YAP1 (in red) and β-catenin (in green). Wildtype (WT) glands displaying membrane-bound β-catenin, adjacent to mutant areas presenting diffuse cytoplasmic/nuclear β-catenin expression are demarcated by dashed lines. White arrows indicate examples of cells showing high levels of nuclear YAP. Scale bars = 50 µm and 10 µm in insets. Statistical analysis was performed with Wilcoxon test in (B–D) and linear regression test with 95% confidence in (E).
Related to Figure 5.
(A, B) Representative sections of single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) targeting Thbs1 (pThbs1, red dots) in the small intestine of wildtype (WT) mice (ApcWT in A) or VillinCreERT2;Apcflox/flox mice (Apc-/- in B). (C) Quantification of the number of Thbs1 dots per field in ApcWT or Apc-/- small intestine. (D) Representative sections of smRNA FISH targeting Thbs1 (pThbs1, red dots) and the Wnt target Axin2 (pAxin2, green dots) in mouse intestinal tumours (Apc1638N). (E) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Lgr5 only (green), or co-expressing both (yellow) annotated by three independent and double-blinded investigators, corresponding to Figure 5A and B. (F, G) Representative sections of mouse intestinal tumours analysed by smRNA FISH for Thbs1 (pThbs1, green dots) and immunostained with an antibody against the epithelial marker Keratin 20 (K20 in red in F) or with anti-THBS1 antibody (in red in G). (H, I) Representative sections of Apc mutant intestinal tumours analysed by smRNA FISH for the YAP target genes Ctgf (pCtgf, green dots in H) or Cyr61 (pCyr61, green dots in I) and Thbs1 (pThbs1, red dots). (J) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Sca1 only (green), or co-expressing both (yellow) annotated by three independent and double-blinded investigators, corresponding to Figure 5C and D. (K) Representative sections of Apc mutant intestinal tumours immunostained for YAP1 (in red) and KI67 (in green). White arrows in insets show nuclear YAP1HIGH/Ki67+ cells (n = 6 sections from three tumours). (L) Representative sections of chemically induced colon tumours analysed by smRNA FISH for expression of Thbs1 (pThbs1, red dots) and the YAP target gene Sca1 (pSca1, green dots); regions presenting co-localisation of Thbs1 and Sca1 are outlined in yellow. (M) Quantification of the percentage of probe-expressing area reflecting cells expressing Thbs1 only (red), Sca1 only (green), or both (yellow). The observed mutual exclusion of red and green regions is statistically significant compared to the calculated probability of random co-expression (blue column) (n = 30 sections from five tumours). E-cadherin antibody in white demarcates epithelial cells in (A, B, D, H, L). DAPI labels nuclei in blue. Scale bar = 50 µm (10 µm in the insets). Statistical analysis was performed with two-tailed unpaired Welch’s t-tests in (C) (p=0.0506) and Wilcoxon test in (M).Consistent with these findings, we found that Thbs1+ cells in mouse tumours largely coincide with the cells expressing the widely accepted Wnt target genes Axin2 (Figure 5—figure supplement 1D) and Lgr5 (Barker et al., 2009; Figure 5A and B, Figure 5—figure supplement 1E), while they do not express the differentiation marker Keratin 20 (Figure 5—figure supplement 1F). The RNA probe recognising Thbs1 co-localises with the THBS1 protein visualised by antibody staining (Figure 5—figure supplement 1G). Furthermore, single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) showed a clear and highly significant mutual exclusion between Thbs1-expressing cells and cells showing YAP activation, as assessed by expression of the YAP targets Ctgf (Figure 5—figure supplement 1H), Cyr61 (Figure 5—figure supplement 1I), Sca1 (Figure 5C and D, Figure 5—figure supplement 1J), and indicating the presence of two distinct tumour cell populations: one Thbs1+/Sca1- (64.61% ± 29.14%) and one Thbs1-/Sca1+ (30.40% ± 27.72%) (Figure 5D). Of relevance to colon cancer, these results are confirmed both in small intestinal adenomas (Apc1638N in Figure 5 and Figure 5—figure supplement 1A–K) and chemically induced colon tumours (Figure 5—figure supplement 1L and M). At the whole-tumour scale, Thbs1 and CTGF expression are highly correlated (Figure 5E and R² = 0.84).
The THBS1-YAP axis is conserved in early stages of human colorectal cancer
The main components of the signalling axis we have uncovered, Thbs1, Ctgf, and Cyr61, but not the Wnt target gene Lgr5, are highly correlated in bulk transcriptomics of human colorectal samples (Figure 6A). To establish if the mechanism mediating paracrine cellular communication that we uncovered is conserved in human colon cancer, we then analysed a cohort of 10 human colon tumours (five low-grade adenomas and five invasive carcinomas) for their expression of THBS1, LGR5, and YAP (Figure 6B–E). Supporting our results in mouse adenomas, the analysis of human tumours at different stages revealed that Thbs1 is highly expressed in Lgr5+ cells only in early-stage adenomas (Figure 6B) but not in advanced carcinomas (Figure 6C). Extensive co-expression of Thbs1 and Lgr5 in adenomas is accompanied by the presence of large tumour regions rich in cells presenting nuclear YAP (Figure 6D), which were not visible in invasive adenocarcinomas (Figure 6E). This intriguing observation can explain why no significant correlation between Thbs1 and Lgr5 expression was found in our in silico analysis of human advanced colon cancer (Figure 6A). These results, combined with our findings in organoids and transgenic mice, suggest a key role of the Thbs1-YAP axis in tumour initiation.
Figure 6.
The THBS1-YAP pathway operates in human low-grade adenomas.
(A) Correlation matrix between the expression levels of THBS1 and the YAP targets CTGF, CYR61, and LGR5 in human colon tumours from the TCGA colon cancer bulk datasets. R indicates Spearman’s coefficient. (B–E) Representative sections of low-grade human adenomas (B, D) or advanced human carcinomas (C, E) processed by single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) for Thbs1 (pThbs1, red dots) and Lgr5 (pLgr5, green dots in B, C) or immunostained with anti-YAP1 antibodies (D, E). White arrows highlight tumour cells presenting high nuclear YAP in (D, E). n = 5 human low-grade adenomas in (B, D) and n = 5 advanced human adenocarcinomas in (C, E). (F) Graphical summary of paracrine interactions between wildtype (WT) organoids and tumoroids along the THBS1-YAP axis. Mutant tumoroids ‘corrupt’ genetically WT organoids by secreting THBS-1 (orange arrows). This results in YAP1 nuclear translocation (black nuclei in organoids or tumoroids) and ectopic proliferation as well as cystic morphology in a subset of organoids.
The THBS1-YAP pathway operates in human low-grade adenomas.
(A) Correlation matrix between the expression levels of THBS1 and the YAP targets CTGF, CYR61, and LGR5 in human colon tumours from the TCGA colon cancer bulk datasets. R indicates Spearman’s coefficient. (B–E) Representative sections of low-grade human adenomas (B, D) or advanced human carcinomas (C, E) processed by single-molecule RNA fluorescence in situ hybridisation (smRNA FISH) for Thbs1 (pThbs1, red dots) and Lgr5 (pLgr5, green dots in B, C) or immunostained with anti-YAP1 antibodies (D, E). White arrows highlight tumour cells presenting high nuclear YAP in (D, E). n = 5 human low-grade adenomas in (B, D) and n = 5 advanced human adenocarcinomas in (C, E). (F) Graphical summary of paracrine interactions between wildtype (WT) organoids and tumoroids along the THBS1-YAP axis. Mutant tumoroids ‘corrupt’ genetically WT organoids by secreting THBS-1 (orange arrows). This results in YAP1 nuclear translocation (black nuclei in organoids or tumoroids) and ectopic proliferation as well as cystic morphology in a subset of organoids.
Discussion
Our results implicate that both in intestinal tumours derived from spontaneous Apc loss and chemically induced colon tumours, cancer cells can directly recruit surrounding epithelial cells through Wnt-driven expression and secretion of the glycoprotein THBS1, which results in aberrant activation of a regenerative/foetal transcriptional programme mediated by the YAP pathway (Figure 6F), a driver of intestinal regeneration and tumorigenesis (Gregorieff et al., 2015). THBS1 is overexpressed in a large number of solid tumours, but its role in cancer is controversial. Constitutive deletion of Thbs1 in ApcMin/+ mice led to an increase in the number and aggressiveness of tumours, which was interpreted as a consequence of its anti-angiogenic role (Gutierrez et al., 2003). In human patients, consistent with our results supporting a role for THBS1 in tumour initiation but not progression (Figure 6), low expression of THBS1 has been found to correlate with more advanced grades of liver metastases derived from colorectal cancer after surgery, presence of lymph node metastases, and poor prognosis (Teraoku et al., 2016). However, THBS1 has been reported to promote the attachment of cells to the extracellular matrix, favouring cancer cell migration and invasion (Sid et al., 2008; Tuszynski et al., 1987). Indeed, a study using a model for inflammation-induced colon carcinogenesis (azoxymethane [AOM]/dextran sulphate sodium [DSS]) in Thbs1-/- mice showed a fivefold reduction in tumour burden, suggesting a role for THBS1 in tumour progression (Lopez-Dee et al., 2015). These contradictory results are most likely due to the multifaceted effects of THBS1, depending on which cells secrete it and which cells respond. Of interest, a recent study proposed that THBS1 induces focal adhesions (FAs) and nuclear YAP translocation through interaction with αvβ1 integrins in the aorta (Yamashiro et al., 2019). Moreover, FAs have been shown to directly drive YAP1 nuclear translocation in the foetal intestine and upon inflammation in adult colon (Yui et al., 2018).Here, we found that cancer cell-derived THBS1 can ‘corrupt’ WT epithelial cells in organoids, independently of stroma-derived effects, allowing us to address the specific role of THBS1 on epithelial cells. Surprisingly, we found that three neutralising antibodies targeting different epitopes of THBS1 were all able to block its effect on WT organoids. These results may indicate that THBS1 neutralisation is not due to block of a specific ligand-receptor interaction but rather to the steric interference with the trimerisation of the large soluble THBS1 isoform (450 kDa) that may no longer be free to diffuse through the Matrigel. Alternatively, it is possible that several THBS1 domains are involved in YAP activation, consistent with reports indicating that different THBS1 domains interact with integrins (Resovi et al., 2014).Our results, corroborated by consistent observations in mouse and human intestinal tumours, uncovered a novel function for the secreted multidomain glycoprotein THBS1 in affecting the behaviour of normal epithelial cells surrounding a nascent tumour. The coexistence of WT and mutant cells within emerging tumours has been the subject of recent interest: consistent with our results, paracrine communication between epithelial cells has been found to induce YAP pathway activation (Flanagan et al., 2021; Yum et al., 2021; van Neerven et al., 2021; Krotenberg Garcia et al., 2021). However, it is still debated whether YAP has a tumour suppressor (Barry et al., 2013; Cheung et al., 2020) or oncogenic role (Zanconato et al., 2016). Indeed, while the recent studies cited above suggest that cancer cells actively eliminate WT cells by cell competition, facilitating tumour expansion, our results indicate that the recruitment of WT cells by cancer cells happens at the very early steps of tumour formation and may be required for the cancer cells to seed within a hyperplastic epithelium. However, consistent with the recent literature and our analysis of human tumours, at later stages of tumorigenesis, the fitter mutant cells outcompete WT cells, as shown by the decrease in cells expressing both THBS1 and nuclear YAP in advanced human adenocarcinomas (Figure 6C and E). We thus believe that the observed differences in cell behaviour could depend on the kinetics of the effects of tumour-secreted factors on WT cells, distinguishing very early responses (within 24–48 hr) analysed in this study and later outcomes (van Neerven et al., 2021). Also, only some WT cells, responding to tumour-secreted factors by activating YAP, may be able to survive within tumours, while the majority of WT cells would be outcompeted, as proposed by Krotenberg Garcia et al., 2021.Based on the results we report here, we propose a model for tumour initiation where mutant cells can ‘corrupt’ surrounding WT epithelial cells by secreting THBS1, leading to YAP activation in the receiving cells. Through the paracrine mechanism we unravelled, causing reactivation of a regenerative foetal-like transcriptional programme, WT epithelial cells initially thrive in nascent tumours. In such a scenario, normal cells within tumours, which would escape specific therapies targeting mutant cells, could be identified by their hallmark of YAP activation, providing a novel diagnostic tool. Of relevance, THBS1 neutralisation showed a tumour-specific toxicity; we thus propose that THBS1 may represent a therapeutic target for colon cancer, potentially applicable to other epithelial tumours.
Materials and methods
Statistics and reproducibility
Experiments were performed in biological and technical replicates as stated. For each experiment, we have used at least n = 3 organoid lines originating from n = 3 different mice, and experiments with at least n = 3 replicates were used to calculate the statistical value of each analysis. All graphs show mean ± SD. Statistical analysis was performed with two-tailed unpaired Welch’s t-tests, unless otherwise stated.
Transgenic mouse models
All mouse lines used have been previously described. Intestinal tumours were generated in Apc1638N mutant mice (Fodde et al., 1994), crossed to the R26mTmG line (Muzumdar et al., 2007), or in VillinCreERT2 (el Marjou et al., 2004) crossed to Apc Delta14 (Colnot et al., 2004) mice, and Lgr5-GFP (Barker et al., 2007) mice were kindly provided by H. Clevers. GFP-expressing wildtype organoids were generated from the LifeAct-GFP mouse line (Riedl et al., 2008). Organoids used for KO experiments were obtained by crossing R26-LSL-Cas9-GFP (Platt et al., 2014) and R26CreERT2 mouse lines (Ventura et al., 2007). All mice used were of mixed genetic background.
To induce colon tumours, we followed the protocol from Tanaka et al., 2003: Notch1-CreERT2/R26mTmG mice of 5–7 months of age received a single intraperitoneal injection of AOM (Sigma #A5486) followed by DSS (MP Biomedicals #160110) administration (3% in drinking water) 1 day after the AOM injection for five consecutive days. General health status and mouse body weight were monitored daily during and after treatment. To verify the presence of colon tumours, two mice were checked 1 month after the first cycle of DSS treatment, but no tumours were detected (only signs of inflammation). We administered another cycle of DSS (3% in drinking water) for 3 days, and tumour formation was monitored by colonoscopy using a Karl Storz endoscopic system.
Human tumours
Five low-grade adenomas and five invasive adenocarcinomas were obtained from the Centre of Biological Resources of Institut Curie and examined by the service of pathology.
Organoids cultures
Wildtype organoids
Wildtype organoids were cultured and passaged as previously described (Sato et al., 2009) and derived from the small intestine or colon of 2–5-month-old mice. The Matrigel crypts mix was plated as 50 µl drops in 24-well plates or 35 µl drops in eight-well Ibidi imaging chambers (Ibidi 80827) for whole-mount staining. After polymerisation, the Matrigel drop was covered with wildtype organoid medium containing EGF, Noggin, R-spondin1 (ENR) for small intestinal organoids or EGF, Noggin, R-spondin1, CHIR99021, Y27632, Wnt3a (ENRCYW) for colonoids. Reagents, media, and buffers are listed in the Key resources table. Factors, inhibitors, and neutralising antibodies that were added to the medium are also indicated in the Key resources table.
Tumoroids
Apc1638N heterozygous mice of more than 6 months of age were dissected and intestinal tumours were harvested using forceps and micro-dissection scissors to reduce contamination with adjacent healthy tissue. Periampullary tumours were excluded from the study to avoid contamination with stomach cells. To remove the remaining healthy tissue surrounding the extracted tumour, tumours were incubated in 2 mM EDTA in PBS (pH = 8.0) for 30 min at 4°C. Tumours were then briefly vortexed to detach the remaining normal tissue, leaving clean spheres. In order to dissociate tumour cells, the tumour was chopped into 1–3 mm fragments using a razor blade and digested in 66% TrypLE (Thermo Fisher 12605010) diluted in PBS, for 10 min at 37°C under continuous agitation at 180 rpm. The supernatant containing the dissociated cells was harvested, and fresh 66% TrypLE was added to the remaining fragments for another 10 min. The supernatant was strained using a 70 µm cell strainer. Cells were then centrifuged at 400 × g for 5 min at 4°C, suspended in DMEM-F12 (2% Penicillin-Streptomycin) and plated in 50% Matrigel drops as described for wildtype organoid cultures. After polymerisation, 300 µl of EN medium containing EGF and Noggin (EN) was added. The medium was replaced every 1–2 weeks. Tumoroids were passaged every 1 (for line expansion) or 3–4 weeks (for medium conditioning). Reagents and medium composition are listed in the Key resources table.
Co-culture assay
Wildtype and tumour organoid cultures were started at least 2 weeks before co-culture in order to use stable and exponentially growing cultures. These passages guaranteed morphologically homogeneous organoids. After passage of wildtype and tumour organoids, the fragments were mixed at approximately 3:1 wildtype organoid to tumoroids ratio. Mixed fragments were plated as described above. After Matrigel polymerisation at 37°C, ENR medium (300 µl/well) was added. Reagents and medium composition are listed in the Key resources table.
Conditioned medium assay
WT organoids were passaged as previously described. After Matrigel polymerisation, 150 µl of ENR 2× concentrated and 150 µl of cM were added. Analyses were performed between 24 and 48 hr after plating, unless otherwise specified.
Tumoroid conditioned medium preparation
Established tumoroid cultures (more than two passages) were grown for 1 week. After 1 week of expansion, fresh medium was added and conditioned for 1–2 weeks depending on the organoid density. Immediately after harvesting, the cM was centrifuged at 400 × g for 5 min at 4°C to remove big debris and cell contamination. The supernatant was recovered and centrifuged again at 2000 × g for 20 min at 4°C and then ultracentrifuged at 200,000 × g for 1.5 hr at 4°C in order to remove extracellular vesicles. The supernatant was snap-frozen in liquid nitrogen and stored at –80°C.
WT conditioned medium preparation
WT intestinal organoid cultures were passaged and grown for 3 days in order to obtain high-density cultures. Then, fresh ENR medium was conditioned for 1 week and prepared as described above.
Organoid freezing
Matrigel drops containing organoids in exponential growth were collected in PBS and centrifuged twice at 400 × g for 5 min at 4°C to remove Matrigel and debris. The organoids were suspended at a high density in Cryostor10 freezing medium (six wells of organoids per 1 ml of cryogenic medium). Organoids were incubated for 10 min in Cryostor10 before being frozen.
Organoid thawing
Organoids were quickly thawed at 37°C and suspended in 5 ml of FBS prior to centrifugation at 400 × g for 5 min at 4°C. The organoids were suspended in DMEM-F12 with 2% Penicillin/Streptomycin and mixed with Matrigel at a 1:1 ratio as described above. After polymerisation at 37°C, ENR or EN medium was added. Due to the FBS impact on organoid morphology, the thawed organoids were passaged at least once and carefully checked for their morphology prior to use. Reagent and medium composition are listed in the Key resources table.
Organoid infection
Wildtype or tumour organoids were put in culture at least 1 week before viral transduction. To plate 8 wells of infected organoids, 12 wells of exponentially growing organoids were harvested in cold Cell Recovery Solution and incubated on ice for 15 min to dissolve the Matrigel. Organoids were then centrifuged at 400 × g for 5 min at 4°C. For cell dissociation, the pellet was suspended in 2 ml of AccuMax (Sigma A7089) containing CHIR99021, Y27632 (CY), and incubated at 37°C for 8 min. Digestion was then stopped by adding 2 ml of DMEM-F12 containing B27 and CY. Organoids were further mechanically dissociated by pipetting up and down 40–50 times. The cell suspension was then centrifuged at 400 × g for 5 min at 4°C. Organoids were carefully suspended in 300 µl of 66× concentrated virus (see below) containing CY and TransDux reagents prior to addition of 300 µl of cold-liquid Matrigel and plated as previously described. After polymerisation at 37°C, 300 µl/well of ENR-CY medium was added. ENR-CY was replaced by ENR 2 days later. This is essential to avoid a morphological change to cysts due to exposure to CHIR99021. After 4 days, organoids were passaged and cultured as described above. Reagents and medium composition are listed in the Key resources table.
Lentiviruses
Plasmids
Lenti-7TG was a gift from Roel Nusse (Addgene plasmid# 24314; http://n2t.net/addgene:24314; RRID:Addgene_24314). The Lenti-sgRNA-mTomato (LRT) construct was obtained by replacement of the GFP sequence with tandem Tomato in the Lenti-sgRNA-GFP (LRG), a gift from Christopher Vakoc (Addgene plasmid# 65656; http://n2t.net/addgene:65656; RRID:Addgene_65656). LentiCRISPRv2GFP was a gift from David Feldser (Addgene plasmid# 82416; http://n2t.net/addgene:82416; RRID:Addgene_82416). LentiThbs1Tg is a lentiORF-expressing mouse Thbs1 (NM_011580) –myc-DKK (Origene# MR211744L3V). pMD2.G was a gift from Didier Trono (Addgene plasmid# 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259). psPAX2 was a gift from Didier Trono (Addgene plasmid# 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260).
sgRNA cloning
Both lentivirus backbones used for the knockout experiments harboured the GeCKO cloning adaptors (Shalem et al., 2014; Sanjana et al., 2014). The sgRNAs inserted in either vectors are listed in the Key resources table.
Virus production
Lentiviral particles were produced in HEK 293T cells. Day 0: 8 × 106 cells were plated onto a T75 flask in 10 ml of complete medium. Day 1: cells were transfected using PEI/NaCl. For this, two solutions were prepared: mix A contained 625 µl NaCl 150 mM + 75 µl PEI and mix B contained 625 µl NaCl 150 mM + 6 µg of plasmid DNA at a molar ratio of 4:3:2 (lentiviral vector: psPAX2: pMD2.G). Mix A and B were incubated for 5 min at room temperature (RT) and then mixed and incubated for 15 min at RT before being added drop by drop on top of the cells. Medium was changed on day 2, and 10 ml of supernatant containing virus particles was collected on days 3 and 4. The supernatants were centrifuged for 5 min at 1500 rpm at 4°C in order to remove dead cells and debris. The virus particles were then concentrated to 300 µl using Amicon Ultra Centrifugal Filters (UFC910024; Sigma) by spinning at 1000 × g at 4°C for 1 hr.
sgRNA validation
The efficiency of sgRNAs was assessed in mouse embryonic fibroblasts (MEFs) infected with a lentivirus expressing the Cas9 enzyme along with blasticidin resistance (Addgene plasmid# 52962). 48 hr upon infection, infected MEFs were selected in 10 µg/ml blasticidin for 7 days. sgRNAs targeting Thbs1, Yap1, and Tead4 (sequences listed in the Key resources table) were cloned in the LRT lentiviral vector (expressing red Tomato fluorescent protein) and produced as described above. After transduction of the MEFs-Cas9 with LRT-Thbs1, Yap1, or Tead4, cells were FACS-sorted based on their red fluorescence and their genomic DNA extracted. For each sgRNA, the cut site region (± 200 bp) was PCR-amplified and sequenced using the same primers (listed in the Key resources table). Chromatograms were manually analysed using ApE (v2.0.61) to confirm the precise cut site, which induced mutations starting at –3 bp before the PAM sequence.
Mass spectrometry
Sample preparation
Isotope-labelled cM requires pre-loading of isotopic amino acids in order to detect all proteins synthesised and secreted by cells (Ong et al., 2002). To label newly produced proteins, two essentials isotopically labelled amino acids (IAA), arginine and lysine, were added to the culture medium. WT organoids were labelled with [²H4]-lysine (Lys4) and [13C6]-arginine (Arg6) for 2 weeks (two passages), whilst tumoroids were labelled with [13C615N2]-lysine (Lys8) and of [13C615N4]-arginine (Arg10) for 2 weeks (two passages). Then, medium was conditioned as described above using SILAC-ENR (2 × 1 week) or SILAC-EN (1 × 2 weeks). After a functional assay confirming their transforming capacities, conditioned media were concentrated. Subsequently, 2 ml of tumoroids conditioned media or 4 ml of wildtype conditioned media were precipitated by cold acetone. Dried protein pellets were then recovered with 50 µl of 2× Laemmli buffer with SDS and β-mercapto-ethanol (0.1%), boiled at 95°C for 5 min and centrifuged 5 min at 14,000 × g.
MS sample processing
Gel-based samples were cut in eight bands and in-gel digested as described in standard protocols. Briefly, following the SDS-PAGE and washing of the excised gel slices, proteins were reduced by adding 10 mM dithiothreitol (Sigma-Aldrich) prior to alkylation with 55 mM iodoacetamide (Sigma-Aldrich). After washing and shrinking of the gel pieces with 100% acetonitrile, trypsin/LysC (Promega) was added and proteins were digested overnight in 25 mM ammonium bicarbonate at 30°C. Extracted peptides were dried in a vacuum concentrator at RT and re-dissolved in solvent A (2% MeCN, 0.3% TFA) before LC-MS/MS analysis.
LC-MS/MS analysis
Liquid chromatography (LC) was performed with an RSLCnano system (Ultimate 3000, Thermo Scientific) coupled online to an Orbitrap Fusion Tribrid mass spectrometer (MS, Thermo Scientific). Peptides were trapped on a C18 column (75 μm inner diameter × 2 cm; nanoViper Acclaim PepMap 100, Thermo Scientific) with buffer A′ (2/98 MeCN/H2O in 0.1% formic acid) at a flow rate of 2.5 µl/min over 4 min. Separation was performed on a 50 cm × 75 μm C18 column (nanoViper Acclaim PepMap RSLC, 2 μm, 100 Å, Thermo Scientific) regulated to a temperature of 55°C with a linear gradient of 5–30% buffer B (100% MeCN in 0.1% formic acid) at a flow rate of 300 nl/min during 100 min. Full-scan MS was acquired in the Orbitrap analyser with a resolution set to 120,000, a mass range of m/z 400–1500 and a 4 × 105 ion count target. Tandem MS was performed by isolation at 1.6 Th with the quadrupole, HCD fragmentation with normalised collision energy of 28, and rapid scan MS analysis in the ion trap. The MS2 ion count target was set to 2 × 104, and only those precursors with charge state from 2 to 7 were sampled for MS2 acquisition. The instrument was run at maximum speed mode with 3 s cycles.
Mass spectrometry data processing
Data were acquired using the Xcalibur software (v 3.0), and the resulting spectra were interrogated by SequestHT through Thermo Scientific Proteome Discoverer (v 2.1) with the Mus musculus Swissprot database (022017 containing 16,837 sequences and 244 common contaminants). The mass tolerances in MS and MS/MS were set to 10 ppm and 0.6 Da, respectively. We set carbamidomethyl cysteine, oxidation of methionine, N-terminal acetylation, heavy 13C615N2-lysine (Lys8) and 13C615N4-arginine (Arg10), and medium 2H4-lysine (Lys4) and 13C6-arginine (Arg6) as variable modifications. We set specificity of trypsin digestion and allowed two missed cleavage sites. The resulting files were further processed by using myProMS (v 3.5) (Poullet et al., 2007). The SequestHT target and decoy search results were validated at 1% false discovery rate (FDR) with Percolator. For SILAC-based protein quantification, peptide extracted ion chromatograms (XICs) were retrieved from Thermo Scientific Proteome Discoverer. Global MAD normalisation was applied on the total signal to correct the XICs for each biological replicate (n = 3). Protein ratios were computed as the geometrical mean of related peptides. To estimate ratio significance, a t-test was performed with the R package limma (Ritchie et al., 2015) and the FDR was controlled using the Benjamini–Hochberg procedure (Benjamini and Hochberg, 1995) with a threshold set to 0.05. Proteins with at least two peptides detected, a twofold enrichment, and an adjusted p-value<0.05 were retained as significant hits.
Pathway enrichment analysis
GO terms enrichment analysis used the proteins significantly enriched in sample comparisons (T-cM/WT-cM; two peptides, fold change > 2, adjusted p-value<0.05) and the unique proteins to T-cM. GO biological processes, cellular components, and molecular functions were analysed using the UniProt-GOA Mouse file (v. 20181203). Significant GO terms had a p<0.05.
Immunofluorescence (IF)
Organoids staining
For whole-mount IF, organoids were grown on eight-well chamber slides (Ibidi 80827). For EdU staining, a 2 hr pulse of EdU (10 µM, Carbosynth Limited NE08701) preceded fixation. After fixation using 4% paraformaldehyde (Euromedex 15710) in PBS for 1 hr at RT, organoids were washed with PBS and permeabilised in PBS + 1% Triton X-100 (Euromedex 2000-C) for 1 hr at RT. Organoids were then incubated with 150 µl of diluted antibodies (listed in the Key resources table) in blocking buffer (PBS, 2% BSA, 5% FBS, 0.3% Triton X-100) overnight at RT. After three washes of 5 min in PBS, 150 µl of secondary antibodies were added together with DAPI diluted in PBS and incubated at RT for 5 hr. Organoids were then washed with PBS for three times for 5 min each and stored in a 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging. For EdU staining, the EdU signal was revealed after the secondary antibody step using the EdU Click-it kit (Thermo Fisher Scientific C10340).
Human sections IF staining
Paraffin sections 3 µm of human samples were deparaffinised and rehydrated using the standard protocol of xylene/ethanol gradient. Antigens were unmasked by boiling the slides in a citrate-based solution (Eurobio-Abcys H-3300). Slides were then incubated in blocking buffer (PBS, 2% BSA, 5% FBS). Antibodies (listed in the Key resources table) were incubated overnight at 4°C. After three washes of 5 min each in PBS, secondary antibodies were incubated at RT for 2 hr alongside DAPI. Slides were mounted in Aqua-poly/mount (Tebu Bio 18606-5).
Mouse sections IF staining
Intestinal tissue samples were fixed overnight at RT with 10% formalin prior to the paraffin embedding. 4 µm FFPE sections were prepared for β-catenin/YAP co-staining. Briefly, the tissue sections were deparaffinised five times in xylene 5 min each, rehydrated five times in ethanol 100% 5 min each, then once in ethanol 70% for 10 min. A heat-mediating antigen retrieval was made using boiling sodium citrate tribasic dihydrate solution 10 mM, PH = 6 (Sigma S4641) for 20 min. The sections were then blocked and permeabilised with 5% donkey serum 0.01% Triton X-100 for 30 min at RT before being incubated with rabbit anti-YAP dilution 1/100 (Signaling Technology #14074) and mouse anti β-catenin (BD 610153) (dilution 1/200) overnight at 4°C. The next day, slides were washed three times in PBS Tween20 0.01% and then incubated for 1 hr at RT with matching secondary antibodies donkey anti-rabbit A594 (Jackson ImmunoResearch 711-546-152) and donkey anti-mouse A488 (Jackson ImmunoResearch 715-546-150) (dilution 1/500) with DAPI. Slides were mounted using Fluoromount Aqueous Mounting Medium (Sigma F4680).
Single-molecule RNA fluorescence in situ hybridisation
smRNA FISH was performed on mouse tissue cryosections or human paraffin-embedded tumour sections using RNAscope Multiplex Fluorescent Detection Kit v2 (ACD 323110) and pipeline following manufacturer’s recommendations. Thbs1 mRNA were labelled using RNAscope Probe- Mm-Thbs1-C3 (#457891-C3) or Hs-THBS1-C2 (#426581-C2), CTGF mRNA were labelled using RNAscope Probe- Mm-CTGF (#314541) and Lgr5 mRNA were labelled using RNAscope Probe- Mm-Lgr5 (#312171) or Hs-LGR5-C3 (#311021-C3). In order to subsequently perform immunostaining after the FISH, a protease III step not exceeding 20 min was included. Subsequent antibody staining was performed as described.
Epithelial masks generation
To quantify RNAscope results only in epithelial cells, epithelial masks were generated using E-cadherin immunostaining. After Ilastik training allowing segmentation of E-cadherin-stained membranes, masks were smoothed by closing function (iteration = 15) and holes filling. Generated masks were manually corrected for consistency.
smRNA FISH dots quantification
Raw images were segmented using Ilastik (v1.3.2) and training performed on negative controls (background), positive controls, and experimental slides (dots). Segmented masks were cleaned using Fiji through an opening function, 2 px Gaussian blur and Moments threshold. Generated masks were manually checked for consistency with raw data. Aggregates of dots were excluded using watershed function and individual dots (size = 2–250 circularity = 0.50–1.00) were analysed and counted using built-in Analyse Particle function. Epithelial dots were obtained by multiplication of dot masks by the corresponding epithelial masks previously generated.
Image acquisition
Images were obtained on an Inverted Wide Confocal Spinning Disk microscope (Leica) using ×40/1.3 OIL DIC H/N2 PL FLUOR or ×20/0.75 Multi Immersion DIC N2 objectives and Hamamtsu Orca Flash 4.0 camera. Images were captured using MetaMorph. Whole-plate acquisition was performed using a dissecting microscope and Cell Discoverer 7 (Leica). Images were captured with ZEN. For RNAscope experiments, images were obtained on a PLAN APO ×40/1.3 NA objective on an upright spinning disk (CSU-X1 scan-head from Yokogawa) microscope (Carl Zeiss, Roper Scientific, France), equipped with a CoolSnap HQ2 CCD camera (Photometrics). Images were captured using MetaMorph.
Nuclear/cytoplasmic quantification
Nuclear IF ratios were obtained using a custom-made ImageJ macro. This macro segmented the nuclei on the DAPI channel using Otsu Threshold, Watershed, and Particles analysis. For each segmented nucleus, a cytoplasmic halo of eight pixels was generated and excluded from the DAPI mask to avoid false cytoplasmic measurements in neighbouring nuclei. The mean intensities of the segmented nucleus and cytoplasmic regions of interest (nROI and cROI) were then measured in the IF channel (nIF and cIF). Cells were counted only if area ratio nucleus/cytoplasm > 0.5, avoiding bias of pixel sampling either due to miss-segmentation or to overcrowded regions. Results (nIF, cIF, and ratio) were computed in Microsoft Excel. A density curve of the nIF/cIF ratio was performed for each category of organoid in order to observe peaks trends of positive and negative nuclei for IF. Threshold was defined manually in the inter-peak region at 1.1 (YAP) and 1.25 (EdU). To exclude low or non-specific signal, a minimal mean intensity cut-off for cIF was established from the experimental images. Using the threshold and the cut-off, the percentage of nIFHIGH cells per organoid was calculated.
RNA-sequencing
Organoids were harvested using Cell Recovery Solution as described above. After 15 min of Matrigel dissolution, organoids were pelleted at 500 × g for 5 min. Pellets were recovered in 1 ml of PBS in 1.5 ml tubes and pelleted again at same conditions. RNA extraction was performed using RNeasy Mini Kit (QIAGEN) following the manufacturer’s recommendations. Total RNA integrity (RINe) were subjected to quality control and quantification using an Agilent TapeStation instrument showing excellent integrity (RNA Integration Number, RIN = 10). NanoDrop spectrophotometer was used to assess purity based on absorbance ratios (260/280 and 260/230).
RNA-sequencing
RNA-sequencing libraries were prepared from 1 µg of total RNA using the Illumina TruSeq Stranded mRNA Library preparation kit that allows to prepare libraries for strand-specific mRNA-sequencing. A first step of polyA selection using magnetic beads was performed to address sequencing specifically on polyadenylated transcripts. After fragmentation, cDNA synthesis was performed followed by dA-tailing before ligation of the TruSeq indexed adapters (Unique Dual Indexing strategy). PCR amplification generated the cDNA library. After qPCR quantification, sequencing was carried out using 2 × 100 cycles (paired-end reads, 100 nucleotides) on an Illumina NovaSeq 6000 system (S1 flow cells) to get around 45 M paired-end reads per sample. FastQ files were generated from raw sequencing data using bcl2fastq where demultiplexing was performed according to indexes.
RNA-seq data processing
Sequencing reads were aligned on the Mouse Reference Genome (mm10) using the STAR mapper (v2.5.3a) (Dobin et al., 2013). Protein-coding genes from the Gencode annotation (vM13) have been used to generate the raw count table. Overall sequencing quality controls report a very high-sequencing quality, a high fraction of mapped reads, and a high enrichment in exonic reads.
Differential analysis
Expressed genes (TPM ≥ 1 in at least one sample) have then been selected for supervised analysis. The raw count table was normalised using the TMM method from the edgeR R package (v3.25.9) (Robinson et al., 2010), and the limma (Ritchie et al., 2015) voom (v3.39.19) functions were applied to detect genes with differential expression. In order to compare tumoroids versus wildtype samples, we designed a linear model as follows:where T is the type effect (T = {WT-cM, T-cM, Tumoroids}). We then restricted the dataset to WT-cM and T-cM samples, and applied the following model:where T is the type effect (T = {WT-cM, T-cM}) and S is the sample effect (S = {sample1, sample2, sample3}). All raw p-values were corrected for multiple testing using the Benjamini–Hochberg method (Benjamini and Hochberg, 1995). Genes with an adjusted p<0.05 and a log2 fold change >1 were called significant.
Pathway enrichment
We applied pathway enrichment analysis on upregulated genes (p-value<0.05 and logFC > 1) in T-cM and tumoroid samples compared to normal organoids (WT-cM) using KEGG, MSigDB curated gene sets, and MSigDB regulatory target gene sets. The enrichment analysis was performed using the R package clusterProfiler (v3.14.3) and msigdbr (v7.1.1).Source code is available at https://gist.github.com/wenjie1991/d79fe428ac80c8f2e5d781a966df3978, (Jacquemin, 2022a copy archived at swh:1:rev:0887f17c2a830b5adfc42757a744a547a8e8fc54).
Gene Set Enrichment Analysis
GSEA v4.0.3 was used to generate and calculate the enrichment score. Transcriptional signatures used for the analysis were extracted from the literature (Gregorieff et al., 2015; Yui et al., 2018; Merlos-Suárez et al., 2011; Mourao et al., 2019) and Nusse Lab (https://web.stanford.edu/group/nusselab/cgi-bin/wnt/target_genes). GSEA were calculated by gene set and 1000 permutations in our RNASeq normalised reads count matrix.
Human colon cancer gene expression analysis
The gene expression data and clinical variables from the TCGA Colon Adenoma (COAD) cohort were downloaded from TSVdb (Sun et al., 2018) on 20 June 2020. Analyses were performed on Primary Solid Tumour gene expression data subset. Pairwise correlation analysis assayed THBS1, CTGF, CYR61, and WWC2 on 285 COAD tumour samples. The expression data were transformed by log2. Then, Spearman’s correlation was calculated and visualised by the PerformanceAnalytics (v2.0.4) R package.Source code is available at https://gist.github.com/wenjie1991/6ff60b3edd5f61d0bd2ebe4f9404e46e, (Jacquemin, 2022b copy archived at swh:1:rev:5d5522e57aeb12b67347377e13e45fd3c1304836).
Data and materials availability
The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD020002 (Perez-Riverol et al., 2019). The RNA-sequencing data have been deposited in the Gene Expression Omnibus (GEO) repository under accession code GSE153160: whole-genome transcriptomic analysis of intestinal organoids and tumoroids. All other data supporting the conclusions of this study are provided in the main text or the supplementary materials.This is an important scientific investigation that gets at tumour cell impact on the microenvironment and identifies a glycoprotein thrombospondin 1 and YAP1 (THBS1-YAP1) axis that activates a transcriptional programme and has associations with poor prognosis. This less well-understood interaction between tumour cells and the normal cells in their environment is important to consider for future research to discover new treatments for patients with gastrointestinal tumours.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.Decision letter after peer review:Thank you for resubmitting your work entitled ""Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programme"" for further consideration by eLife. Your revised article has been evaluated by Wafik El-Deiry (Senior Editor) and a Reviewing Editor.The manuscript has been improved but there are some remaining issues that need to be addressed, as outlined below:Both reviewers recommended additional in vivo correlations as described.Reviewer #1:Jacquemin, et al. investigate the impact of mutant intestinal cancer cells on surrounding healthy tissue using a murine-derived organoid co-culture system. Previous work has confirmed the role of stromal cells in tumor progression, but little has been done to investigate the impact of tumor cells on nearby healthy cells. Here, the authors identify a novel mechanism in which cancer cells secrete THBS1 to initiate cancer-like behavior and YAP pathway dependency in surrounding wild-type intestinal cells. Importantly, these effects can be blocked by inhibiting THBS1 or YAP activation. Analysis of human colon tumors suggested that the THBS1-YAP axis is conserved only in early stages of colorectal cancer, indicating its key role in tumor initiation. Moreover, THBS1 is necessary for the growth of organoids derived from primary mouse tumors, further indicating its potential as a therapeutic target. Overall, the conclusions of this study are well-supported by the data and could direct the clinical development of drugs that target pro-cancer mechanisms in the tumor microenvironment.Strengths: The experimental approaches are logical and well-presented, and the data rigorously support the authors' main conclusions. Experimental replicates and use of statistical analyses throughout the paper demonstrate the high quality of this work. The contribution of the THBS1-YAP axis to tumor initiation was investigated using an organoid model, which is more physiologically relevant compared to other in vitro models such as cell lines.Weaknesses: The direct role of the THBS1-YAP axis in colorectal cancer initiation was demonstrated using in vitro organoid models, which despite several advantages lack the complete network of interactions between tumor cells, immune cells, stromal cells, secreted factors, extracellular matrix, and tumor vasculature. This complexity can have a large impact on paracrine signaling in the tumor, thus the clinical relevance of the THBS1-YAP axis is unclear from the presented data.The authors thoroughly address the controversial role of THBS1 in cancer in the Discussion, and may choose to cite one additional source with a conclusion contradictory to Figure 6G: Teraoku H, et al. Role of thrombospondin-1 expression in colorectal liver metastasis and its molecular mechanism. J Hepatobiliary Pancreat Sci. 2016 Sep;23(9):565-73. doi: 10.1002/jhbp.376. Epub 2016 Aug 21. PMID: 27404020.in vivo analyses demonstrating mutual exclusivity of THBS1 expression and YAP activation in murine tumors support the overall conclusion of this paper. However, further in vivo experiments using THBS1-neutralizing antibodies or YAP-TEAD inhibitors in mice could be valuable in validating role of the THBS1-YAP axis in colorectal cancer initiation, as in vivo models take into consideration the complicated network of interactions within the tumor microenvironment.Reviewer #2:In this study, Jacquemin et al. used organoid co-culture to investigate the interactions between normal intestinal epithelial and adenoma cells from APC-deficient mice. They found that WT organoids adopted an unpolarised hollow cystic structure in the presence of tumoroids. They then analyzed conditional media and identified Thrombospondin-1 (Thbs1) as a mediator of the morphological and behavioral changes in WT organoids. Gene expression analysis revealed that Thbs1 activated a YAP-mediated fetal/regenerative transcriptional program in WT organoids. They also analyzed mouse and human adenomas and provided some evidence that the identified paracrine signaling mechanism exists in vivo. The data from organoid and imaging experiments are of great quality and generally support the conclusions of the manuscript. However, the relevance of the described paracrine signaling mechanism to intestinal tumorigenesis remains unclear for several reasons.1) In Figure 5 and 6, the authors used RNA In Situ hybridization to detect Thbs1, Lgr5 and Yap targets in mouse and human adenoma tissues. The data showed that Thbs1 is expressed in Lgr+5 cells but not in adjacent cells with Yap activation. The presented data on mutually exclusive localization is rather indirect evidence for the proposed paracrine mechanism in vivo.2) The mechanism of Thbs1 secretion by adenoma cells is unclear. It is unclear if Thbs1 is overexpressed and regulated by the Wnt pathway in adenoma cells or tumoroids.3) The authors seemed to cherry pick the YAP/Hippo pathway among several activated pathways identified by gene expression analysis. The rationale for focusing on this pathway and potential involvement of other pathways are not quite clear.4) Figure 6A shows correlation of Thbs1, CTGF, and CYR61 expression in human colon cancer, which is somewhat inconsistent with mutually exclusive locations of these genes in adenoma cells. The Kaplan-Meier curves in Figure 6G and 6H may not be relevant as the data suggest paracrine signaling in adenomas but not adenocarcinoma cells.Recommendations for the authors:1) It would be helpful if some additional in vivo evidence could be provided. For example, whether Thbs1 is secreted by adenoma cells may be assayed by immunostaining or ELISA, and the effects of Thbs1 perturbation may be analyzable by injection of Thbs1 antibody or inhibitor.2) The authors could determine if Thbs1 is overexpressed in adenoma cells or tumoroids, and if Thbs1 is induced by transcriptional activation via the Wnt pathway in adenoma cells.3) The authors could elaborate the rationale for focusing on the YAP/Hippo pathway and discuss potential involvement of other pathways in the identified paracrine signaling.4) The authors could remove irrelevant data on colon cancer and provide some additional data from public databases on pre-cancerous lesions if available.Reviewer #1:Jacquemin, et al. investigate the impact of mutant intestinal cancer cells on surrounding healthy tissue using a murine-derived organoid co-culture system. Previous work has confirmed the role of stromal cells in tumor progression, but little has been done to investigate the impact of tumor cells on nearby healthy cells. Here, the authors identify a novel mechanism in which cancer cells secrete THBS1 to initiate cancer-like behavior and YAP pathway dependency in surrounding wild-type intestinal cells. Importantly, these effects can be blocked by inhibiting THBS1 or YAP activation. Analysis of human colon tumors suggested that the THBS1-YAP axis is conserved only in early stages of colorectal cancer, indicating its key role in tumor initiation. Moreover, THBS1 is necessary for the growth of organoids derived from primary mouse tumors, further indicating its potential as a therapeutic target. Overall, the conclusions of this study are well-supported by the data and could direct the clinical development of drugs that target pro-cancer mechanisms in the tumor microenvironment.Strengths: The experimental approaches are logical and well-presented, and the data rigorously support the authors' main conclusions. Experimental replicates and use of statistical analyses throughout the paper demonstrate the high quality of this work. The contribution of the THBS1-YAP axis to tumor initiation was investigated using an organoid model, which is more physiologically relevant compared to other in vitro models such as cell lines.Weaknesses: The direct role of the THBS1-YAP axis in colorectal cancer initiation was demonstrated using in vitro organoid models, which despite several advantages lack the complete network of interactions between tumor cells, immune cells, stromal cells, secreted factors, extracellular matrix, and tumor vasculature. This complexity can have a large impact on paracrine signaling in the tumor, thus the clinical relevance of the THBS1-YAP axis is unclear from the presented data.We agree that the clinical relevance of our results remains to be demonstrated. We would like to stress, however, that this project was aimed at studying the fundamental mechanisms of communication between epithelial cells in a tumour context, which is why we used the minimal model of self-organizing normal and tumour organoids. We are well aware of the complexity and important role of the tumour microenvironment and we believe that in vivo studies can be complicated by the pleiotropic effects of different cell types affecting tumour cells and their wild-type neighbours, which cannot be easily distinguished in vivo. The intricacy of cellular interactions in the in vivo context can explain the controversial role of the glycoprotein THBS1 in cancer revealed by several studies that we thoroughly discuss in our manuscript at lines 257-263 (ref. Gutierrez et al., 2003; Sid et al., 2008; Tuszynski et al., 1987; Lopez-Dee et al., 2015) and also the article mentioned by Reviewer 1: Teraoku H, et al., which we have now included as a citation and in our Discussion (lines 259-262).The authors thoroughly address the controversial role of THBS1 in cancer in the Discussion, and may choose to cite one additional source with a conclusion contradictory to Figure 6G: Teraoku H, et al. Role of thrombospondin-1 expression in colorectal liver metastasis and its molecular mechanism. J Hepatobiliary Pancreat Sci. 2016 Sep;23(9):565-73. doi: 10.1002/jhbp.376. Epub 2016 Aug 21. PMID: 27404020.We thank the Reviewer for this suggestion and have now included the suggested citation in our Discussion on the controversial role of THBS1 in cancer. (lines 257-263). Of relevance, in this study the analysis was performed in advanced disease, on colorectal cancer-derived liver metastases. Consistent with our results supporting a role for THBS1 in tumour initiation but not progression (Figure 6), low expression of THBS1 was found to correlate with more advanced grades of liver metastases derived from colorectal cancer after surgery, presence of lymph nodes metastases, and poor prognosis (Teraoku et al., 2016). As also suggested by Reviewer 2, in this context the Kaplan-Meyer survival curves that were presented in Figure 6G and 6H may not be relevant to the initial stages of low-grade adenomas; following the Reviewers’ suggestion, we have therefore decided to remove them.In vivo analyses demonstrating mutual exclusivity of THBS1 expression and YAP activation in murine tumors support the overall conclusion of this paper. However, further in vivo experiments using THBS1-neutralizing antibodies or YAP-TEAD inhibitors in mice could be valuable in validating role of the THBS1-YAP axis in colorectal cancer initiation, as in vivo models take into consideration the complicated network of interactions within the tumor microenvironment.We agree with the Reviewer that further in vivo experiments could better uncover the clinical relevance of our findings. However, the complexity and cellular heterogeneity of the tumour context is exactly why we have mainly performed our fundamental mechanistic studies in the minimal model of self-organizing normal and tumour organoids, where we could control culture conditions and identify mutant and wild-type epithelial cells with 100% confidence. As discussed in the manuscript, we believe that in vivo studies can be complicated by the pleiotropic effects of different cell types of the tumour microenvironment affecting tumour cells and their wild-type neighbours, explaining the contradictory roles for THBS1 in tumour progression and angiogenesis present in the literature. It is clear from the literature that the mode of action of THBS1 depends on the cells that receive its signal, further supporting our choice of focusing on a minimal stroma-free system exclusively composed of epithelial cells. Furthermore, our model predicts that neutralization of the THBS1-YAP axis would reduce tumour formation. However, the Apc +/- mouse model we use, mimicking the initial events leading to the formation of low-grade adenomas, presents very few tumours, so it would be complicated, if not unfeasible, to prove a reduction in tumour burden using these mice.Finally, as discussed in our manuscript, Lopez-Dee et al. performed an in vivo analysis, by genetically deleting Thbs1 in mice (using constitutive Thbs1 knock-out mice) upon acute inflammation-induced colon carcinogenesis (by AOM/DSS) and observed a 5-fold reduction in tumor burden, indeed consolidating our results in an in vivo context.Reviewer #2:In this study, Jacquemin et al. used organoid co-culture to investigate the interactions between normal intestinal epithelial and adenoma cells from APC-deficient mice. They found that WT organoids adopted an unpolarised hollow cystic structure in the presence of tumoroids. They then analyzed conditional media and identified Thrombospondin-1 (Thbs1) as a mediator of the morphological and behavioral changes in WT organoids. Gene expression analysis revealed that Thbs1 activated a YAP-mediated fetal/regenerative transcriptional program in WT organoids. They also analyzed mouse and human adenomas and provided some evidence that the identified paracrine signaling mechanism exists in vivo. The data from organoid and imaging experiments are of great quality and generally support the conclusions of the manuscript. However, the relevance of the described paracrine signaling mechanism to intestinal tumorigenesis remains unclear for several reasons.1) In Figure 5 and 6, the authors used RNA In Situ hybridization to detect Thbs1, Lgr5 and Yap targets in mouse and human adenoma tissues. The data showed that Thbs1 is expressed in Lgr+5 cells but not in adjacent cells with Yap activation. The presented data on mutually exclusive localization is rather indirect evidence for the proposed paracrine mechanism in vivo.We agree that the mutual exclusion of expression of THBS1 and YAP targets in mouse and human tumours is rather indirect evidence of the paracrine mechanism we unraveled in genetically defined Apc mutant and Apc WT organoids, schematized in Figure 6B. However, to strengthen the in vivo relevance of our results, we have also analysed a cohort of 10 human colon tumours (5 low-grade adenomas and 5 invasive carcinomas) for their expression of THBS1, LGR5 and YAP (Figure 6C-F). These results corroborated our findings in organoids and in mouse adenomas: in human adenomas Thbs1 is highly expressed in Lgr5+ cells. Consistent with our conclusions, this is accompanied by the presence of extensive tumour regions rich in cells presenting nuclear YAP (Figure 6C, E).2) The mechanism of Thbs1 secretion by adenoma cells is unclear. It is unclear if Thbs1 is overexpressed and regulated by the Wnt pathway in adenoma cells or tumoroids.We thank the reviewer for this important point. Yes, we show that expression of Thbs1 is triggered by constitutive Wnt activation in vivo, using VillinCreERT2;Apcflox/flox mice. In order to gain further in vivo validation of our results, we have induced acute APC loss in VillinCreERT2;Apcflox/flox mice for a short time window (4 days) and analysed Thbs1 expression in cells with high Wnt activity. As shown in Figure S5A-C (lines 208-211 in the text), these experiments indicate that Thbs1 expression is efficiently and rapidly triggered in the intestinal epithelium upon constitutive Wnt activation. These important results provide an in vivo functional validation of the colocalization of Lgr5 and Thbs we observed by smRNA FISH and indicate that Thbs1 is secreted by mutant tumour cells, just like in the organoid system.Also, we note that the conditioned medium from Apc-/- organoids faithfully reproduced the effect of T-cM, inducing a cystic morphology in wildtype organoids, confirming a direct effect of active Wnt signalling on the secretion of Thbs1. These results are presented in Figure S1C and in the text at lines 98-101.3) The authors seemed to cherry pick the YAP/Hippo pathway among several activated pathways identified by gene expression analysis. The rationale for focusing on this pathway and potential involvement of other pathways are not quite clear.Our choice of focusing on the YAP/Hippo pathway was an educated guess, based on extensive literature. We initially found the Hippo (YAP) pathway in GO analysis as an attractive potential candidate among others (Figure S4A). The further strong correlation between a YAP activation signature and T-cM exposed organoids, that we established by GSEA analysis in Figure 4A, alongside the enrichment in ECM/adhesive protein we found by mass spectrometry (Figure S2B) and the link between cystic organoid morphology and foetal/regenerative programs previously observed by the Gregorieff’s, Lutolf’s and Jensen’s labs, prompted us to study the YAP pathway in more details. We do not exclude that other pathways could contribute or enhance the phenotype, although our experiments inducing the genetic knock-out of YAP1 and TEAD4 suggest that YAP1 is required to mediate the observed cystic morphology (Figure 4H).4) Figure 6A shows correlation of Thbs1, CTGF, and CYR61 expression in human colon cancer, which is somewhat inconsistent with mutually exclusive locations of these genes in adenoma cells. The Kaplan-Meier curves in Figure 6G and 6H may not be relevant as the data suggest paracrine signaling in adenomas but not adenocarcinoma cells.The studies that allowed us to perform the correlation analysis presented in Figure 6A are based on bulk transcriptomics and cannot inform on the expression of Thbs1 and YAP target genes at the single-cell level. However, the reproducible results of mutual exclusion between Thbs1 and Yap target genes expression in mouse intestinal and colon tumours that we present in Figure 5C-D and Figure S5H-J, L-M suggest conservation in human tumours. Only single cell analyses on patient samples could inform on the mutually exclusive expression of Thbs1 and YAP target genes within the same tumour. Figure 6A simply shows that in human colon cancer, the main components of the signalling axis we have uncovered, Thbs1, CTGF and Cyr61, but not the Wnt target gene Lgr5, are all expressed in the same tumours, suggesting the existence of a functional relationship which would act through paracrine communication, according to our results.Regarding the second point, we agree that the Kaplan-Meyer curves in Figure 6G and 6H may not be relevant to pre-cancerous early stage adenomas and, following both Reviewers’ suggestion, we have decided to remove them.Recommendations for the authors:1) It would be helpful if some additional in vivo evidence could be provided. For example, whether Thbs1 is secreted by adenoma cells may be assayed by immunostaining or ELISA, and the effects of Thbs1 perturbation may be analyzable by injection of Thbs1 antibody or inhibitor.Although we agree with the Reviewer that the expression of Thbs1 in mouse and human adenomas is mainly shown at the RNA level by smRNA FISH, in Figure S5G we show by immunofluorescence with an anti-THBS1 antibody that the RNA and protein signal co-localize within mouse adenomas. We also note that the conditioned medium from Apc-/- organoids faithfully reproduced the effect of T-cM, inducing a cystic morphology in wildtype organoids (Figure S1C), confirming a direct effect of active Wnt signalling on the secretion of THBS1.Regarding the suggested systemic injection of a THBS1 neutralizing antibody or an inhibitor in mice, as explained in our response to Reviewer 1 above, we agree that further in vivo experiments could better expose the clinical relevance of our findings. However, the complexity and cellular heterogeneity of the in vivo tumoral context is why we have mainly performed our fundamental mechanistic studies in the minimal model of self-organizing normal and tumour organoids, where we could control culture conditions and identify mutant and wild-type epithelial cells with full confidence. As we discuss in the manuscript, we believe that in vivo studies can be complicated by the pleiotropic effects of different cell types of the tumour microenvironment affecting tumour cells and their wild-type neighbours, explaining the contradictory roles for THBS1 in tumour progression and angiogenesis present in the literature. It is clear from the literature that the mode of action of Thbs1 is highly pleotropic and depends on the cells that receive its signal, further supporting our choice of focusing on a minimal stroma-free system exclusively composed of epithelial cells.Furthermore, our model predicts that neutralization of the THBS1-YAP axis would reduce tumour formation. However, the Apc +/- mouse model we use, mimicking the initial events leading to the formation of low-grade adenomas, presents very few tumours, so it would be complicated, if not impossible, to prove a reduction in tumour burden using these mice.Finally, as discussed in our manuscript, Lopez-Dee et al. performed an in vivo analysis, by genetically deleting Thbs1 in mice upon acute inflammation-induced colon carcinogenesis (by AOM/DSS) and observed a 5-fold reduction in tumor burden, consolidating our results in an in vivo context.2) The authors could determine if Thbs1 is overexpressed in adenoma cells or tumoroids, and if Thbs1 is induced by transcriptional activation via the Wnt pathway in adenoma cells.We directly show that THBS1 is overexpressed in mouse intestinal and colon adenoma cells in Figure 5A, C and in Figure S5D, G-J, L-M, as well as in human adenomas in Figure 6C. The expression of THBS1 in tumoroids was originally found in the conditioned medium from tumoroids by mass spectrometry (Figure S2C). As explained above, we show that expression of Thbs1 is triggered by constitutive Wnt activation in vivo, using VillinCreERT2;Apcflox/flox mice.To validate our results in vivo, we have induced acute APC loss in VillinCreERT2;Apcflox/flox mice for a short time window (4 days) and analysed Thbs1 expression in cells with high Wnt activity. As shown in Figure S5A-C (lines 210-214 in the text), these experiments indicate that Thbs1 expression is efficiently and rapidly triggered in the intestinal epithelium upon constitutive Wnt activation. These important results provide an in vivo functional validation of the colocalization of Lgr5 and Thbs we observed by smRNA FISH and indicate that Thbs1 is secreted by mutant tumour cells, just like in the organoid system.An additional indication of secretion of THBS1 by tumoroids comes from the observation that the conditioned medium from Apc-/- organoids faithfully reproduced the effect of T-cM, inducing a cystic morphology in wildtype organoids, confirming a direct effect of active Wnt signalling on the secretion of THBS1. These results are presented in Figure Supplement 1C and described in the text at lines 98-102.3) The authors could elaborate the rationale for focusing on the YAP/Hippo pathway and discuss potential involvement of other pathways in the identified paracrine signaling.4) The authors could remove irrelevant data on colon cancer and provide some additional data from public databases on pre-cancerous lesions if available.As explained above, our choice of focusing on the YAP/Hippo pathway was an educated guess, based on extensive literature. We initially found the Hippo (YAP) pathway in GO analysis as an interesting potential candidate among others (Figure S4A). The further strong correlation between a YAP activation signature and T-cM exposed organoids, that we established by GSEA analysis in Figure 4A, alongside the enrichment in ECM/adhesive protein we found by mass spectrometry (Figure S2B) and the link between cystic organoid morphology and foetal/regenerative programs previously observed by the Gregorieff’s and Jensen’s labs, prompted us to study the YAP pathway in more details. We do not exclude that other pathways could contribute or enhance the phenotype, although our experiments inducing the genetic knock-out of YAP1 and TEAD4 suggest that YAP1 is required to mediate the observed cystic morphology (Figure 4H).
Appendix 1—key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Antibody
Anti-mouse Alexa Fluor 488 (donkey polyclonal)
Jackson ImmunoResearch
715-546-150
(1:500)
Antibody
Anti-mouse Alexa Fluor 488 (donkey polyclonal)
Jackson ImmunoResearch
711-546-152
(1:500)
Antibody
Anti-rabbit Alexa Fluor 488 (donkey polyclonal)
Thermo Fisher Scientific
A21206
(1:300)
Antibody
Anti-mouse Alexa Fluor 633 (donkey polyclonal)
Thermo Fisher Scientific
A21202
(1:300)
Antibody
Anti-rabbit Alexa Fluor 633 (goat polyclonal)
Thermo Fisher Scientific
A21071
(1:300)
Antibody
Anti-rabbit Cy3 (goat polyclonal)
Thermo Fisher Scientific
A10520
(1:300)
Antibody
Anti-rabbit Cy5 (goat polyclonal)
Thermo Fisher Scientific
A10523
(1:300)
Antibody
Anti-β-catenin (mouse monoclonal)
BD Transduction Laboratories
610153
(1:200)
Antibody
Anti-ANG (mouse monoclonal)
Abcam
ab10600
(2.5–25 μg/ml)
Antibody
Anti-E-cadherin (mouse monoclonal)
BD Transduction Laboratories
610182
(1:400)
Antibody
Anti-E-cadherin (rabbit monoclonal)
Cell Signaling Technology
3195
(1:300)
Antibody
Anti-FLAG (mouse monoclonal)
MilliporeSigma
F1804
(1 μg/ml)
Antibody
Anti-LGALS3 (mouse monoclonal)
Abcam
ab2785
(2.5–25 μg/ml)
Antibody
Anti-THBS1 (mouse monoclonal)
Novus Biologicals
2059SS
(1:100)
Antibody
Anti-THBS1 A4.1 (mouse monoclonal)
Thermo Fisher Scientific
MA5-13377
(5–20 μg/ml)
Antibody
Anti-THBS1 A6.1 (mouse monoclonal)
Novus Biologicals
NB100-2059
(5–20 μg/ml)
Antibody
Anti-THBS1 C6.7 (mouse monoclonal)
Thermo Fisher Scientific
MA5-13390
(5–20 μg/ml)
Antibody
IgG1 isotype control (MG1K) (mouse monoclonal)
Novus Biologicals
NBP1-96983
(5–20 μg/ml)
Antibody
Anti-cleaved Caspase3 (rabbit polyclonal)
Cell Signaling Technology
9661
(1:200)
Antibody
Anti-CP (rabbit polyclonal)
Abcam
ab48614
(2.5–25 μg/ml)
Antibody
Anti-CTGF (rabbit monoclonal)
R&D Systems
MAB91901-100
(1.25–12.5 μg/ml)
Antibody
Anti-HDGF (rabbit polyclonal)
Novus Biologicals
NBP1-71926
(0.5–5 μg/ml)
Antibody
Anti-Keratin 20 (rabbit monoclonal)
Cell Signaling Technology
13063
(1:200)
Antibody
Anti-Ki67 (rabbit polyclonal)
Abcam
ab15580
(1:200)
Antibody
Anti-LGALS3BP (rabbit polyclonal)
Abcam
ab217760
(2.5–25 μg/ml)
Antibody
Anti-YAP (rabbit monoclonal)
Cell Signaling Technology
14074
(1:100)
Antibody
Anti-TTR (sheep polyclonal)
Abcam
ab9015
(63–120 μg/ml)
Biological sample (Homo sapiens)
CRC adenocarcinoma
Centre of Biological Resources of Institut Curie
Biological sample (H. sapiens)
Low-grade CRC adenoma
Centre of Biological Resources of Institut Curie
Cell line (H. sapiens)
HEK293T
ATCC
12022001
Cell line (Mus musculus)
MEF
PMID:34782763
MEFs derived from E13 wt embryo, a gift from Dr. Raphael Margueron
Chemical compound, drug
Aqua poly/mount
Tebu Bio
18606-5
Pure
Chemical compound, drug
[13C6]-arginine (Arg6)
MilliporeSigma
643440
1 µl/ml
Chemical compound, drug
[13C615N4]-arginine (Arg10)
MilliporeSigma
608033
1 µl/ml
Chemical compound, drug
B27
Thermo Fisher Scientific
12587-010
1×
Chemical compound, drug
Cell Recovery Solution
Corning
354253
1×
Chemical compound, drug
CHIR99021
AMSBIO
1677-5
5 μM
Chemical compound, drug
Citrate-based solution
Vector Laboratories
H-3300
1×
Chemical compound, drug
Cryostor10
Stem Cell Technologies
07930
1×
Chemical compound, drug
DMEM
Thermo Fisher Scientific
31053028
1×
Chemical compound, drug
DMEM-F12
Thermo Fisher Scientific
11039-047
1×
Chemical compound, drug
DMEM F-12 FOR SILAC
Thermo Fisher Scientific
D1801047
1×
Chemical compound, drug
EDTA
MilliporeSigma
E6765
2 mM
Chemical compound, drug
EdU
Carbosynth Limited
NE08701
10 μM
Chemical compound, drug
FBS
Thermo Fisher Scientific
10500064
Pure
Chemical compound, drug
Fluoromount Aqueous Mounting Medium
MilliporeSigma
F4680
Pure
Chemical compound, drug
GlutaMAX
Thermo Fisher Scientific
35050038
1×
Chemical compound, drug
Glycerol
Euromedex
15710
50%
Chemical compound, drug
hiFBS
Thermo Fisher Scientific
10500064
10%
Chemical compound, drug
[²H4]-lysine (Lys4)
MilliporeSigma
616192
1 µl/ml
Chemical compound, drug
[13C615N2]-lysine (Lys8)
MilliporeSigma
608041
1 µl/ml
Chemical compound, drug
[13C615N4]-arginine (Arg10)
MilliporeSigma
608033
1 µl/ml
Chemical compound, drug
NaCl
MilliporeSigma
S9888
150 mM
Chemical compound, drug
Non-Essential Amino Acids
Thermo Fisher Scientific
11140035
1×
Chemical compound, drug
Paraformaldehyde
Euromedex
15710
4%
Chemical compound, drug
PEI
Tebu bio
24765-2
1 µg/µl
Chemical compound, drug
Penicillin-Streptomycin
Thermo Fisher Scientific
15140122
200 U/ml
Chemical compound, drug
ProLong Gold Antifade Reagent
Thermo Fsher Scientific
P36930
Pure
Chemical compound, drug
TransDux
System Biosciences
LV850A-1
1×
Chemical compound, drug
Triton X-100
Euromedex
2000C
1%
Chemical compound, drug
TrypLE
Gibco
12605
0.3×
Chemical compound, drug
TSA Plus Cyanine-3
Akoya Biosciences
NEL744001KT
1/750
Chemical compound, drug
TSA Plus Cyanine-5
Akoya Biosciences
NEL741001KT
1/750
Chemical compound, drug
TSA Plus Fluorescein
Akoya Biosciences
NEL766001KT
1/750
Chemical compound, drug
UEA
Vector Laboratories
RL-1062
1/50
Chemical compound, drug
Verteporfin
MilliporeSigma
SML0534
5–10 μM
Chemical compound, drug
Y27632
MilliporeSigma
Y0503
10 μM
Commercial assay or kit
EdU click-it kit
Thermo Fisher Scientific
C10340
Commercial assay or kit
RNAscope Multiplex Fluorescent Detection Kit v2
ACD
323110
Commercial assay or kit
RNAscope Probe Hs-LGR5-C3
ACD
311021-C3
Commercial assay or kit
RNAscope Probe Hs-THBS1-C2
ACD
426581-C2
Commercial assay or kit
RNAscope Probe Mm-CTGF
ACD
314541
Commercial assay or kit
RNAscope Probe Mm-Lgr5
ACD
312171
Commercial assay or kit
RNAscope Probe Mm-Thbs1-C3
ACD
57891-C3
Gene (H. sapiens)
Lgr5
Ensembl
ENSG00000139292
Gene (H. sapiens)
Thbs1
Ensembl
ENSG00000137801
Gene (H. sapiens)
Yap1
Ensembl
ENSG00000137693
Gene (M. musculus)
Cp
Ensembl
ENSMUSG00000003617
Gene (M. musculus)
Ctgf (CCN2)
Ensembl
ENSMUSG00000019997
Gene (M. musculus)
Hdgf
Ensembl
ENSMUSG00000004897
Gene (M. musculus)
Lgals-3
Ensembl
ENSMUSG00000050335
Gene (M. musculus)
Lgals-3bp
Ensembl
ENSMUSG00000033880
Gene (M. musculus)
Lgr5
Ensembl
ENSMUSG00000020140
Gene (M. musculus)
Tead4
Ensembl
ENSMUSG00000030353
Gene (M. musculus)
Thbs1
Ensembl
ENSMUSG00000040152
Gene (M. musculus)
Ttr
Ensembl
ENSMUSG00000061808
Gene (M. musculus)
Yap1
Ensembl
ENSMUSG00000053110
Other
Amicon Ultra Centrifugal Filters
MilliporeSigma
UFC910024
Filters used to concentrate the viral preparations
Peptide, recombinant protein
mEGF
Thermo Fisher Scientific
315-09
(50 ng/ml)
Peptide, recombinant protein
mNoggin
PeproTech
250-38
(100 ng/ml)
Peptide, recombinant protein
mRspo1
PeproTech
3474-RS
(500 ng/ml)
Peptide, recombinant protein
rmTHBS1
R&D Systems
7859-TH-050
(1–5 μg/ml)
Peptide, recombinant protein
Wnt3A
R&D Systems
1324-WN-002
(5 ng/ml)
Sequence-based reagent
STead4F
Eurofins Genomics
This paper
CTCTAACAGGTCCAACGGGC
Sequence-based reagent
STead4R
Eurofins Genomics
This paper
CAGCTCAGACAGGCTCCTTAC
Sequence-based reagent
SThbs1F
Eurofins Genomics
This paper
GCGGGAGGTTTACCTGTGTG
Sequence-based reagent
SThbs1R
Eurofins Genomics
This paper
CCTCTTTAAAAGGTCCTGGGCT
Sequence-based reagent
SYap1F
Eurofins Genomics
This paper
GCCGCATGGGCACGGTCT
Sequence-based reagent
SYap1R
Eurofins Genomics
This paper
TGCGGGCGCGCGTCGC
Sequence-based reagent
Tead4-2 sgRNA
Eurofins Genomics
This paper
CCCATCGACAATGATGCAGA
Sequence-based reagent
Thbs 1-1 sgRNA
Eurofins Genomics
This paper
CGGGGCTCAGTAACCCGGAG
Sequence-based reagent
Yap1-1 sgRNA
Eurofins Genomics
This paper
AGTCGGTCTCCGAGTCCCCG
Software, algorithm
ApE
https://jorgensen.biology.utah.edu/
v2.0.61
Software, algorithm
clusterProfiler
R package
v3.14.3
Software, algorithm
edgeR
PMID:19910308
v3.25.9
Software, algorithm
Fiji
https://imagej.net/
v1.53c
Software, algorithm
GSEA
https://gsea-msigdb.org/
v4.0.3
Software, algorithm
Ilastik
https://www.ilastik.org/
v1.3.2
Software, algorithm
Limma
PMID:25605792
Software, algorithm
msigdbr
R package
v7.1.1
Software, algorithm
PerformanceAnalytics
R package
v2.0.4
Software, algorithm
STAR mapper
PMID:23104886
v2.5.3a
Software, algorithm
Thermo Scientific Proteome Discoverer
Thermo Fisher Scientific
v2.1
Software, algorithm
UniProt-GOA Mouse
v.20181203
Software, algorithm
Xcalibur
Thermo Fisher
OPTON-30965
v3.0
Strain, strain background (M. musculus)
Apc1638N
PMID:8090754
MGI:1857951
Strain, strain background (M. musculus)
ApcΔ14
PMID:15563600
MGI:3521822
Strain, strain background (M. musculus)
C57BL/6
Charles Rivers
C57BL/6NCrl
Strain maintained in Institut Curie Mouse Facility
Authors: Koji Taniguchi; Toshiro Moroishi; Petrus R de Jong; Michal Krawczyk; Britta Moyo Grebbin; Huiyan Luo; Rui-Hua Xu; Nicole Golob-Schwarzl; Caroline Schweiger; Kepeng Wang; Giuseppe Di Caro; Ying Feng; Eric R Fearon; Eyal Raz; Lukas Kenner; Henner F Farin; Kun-Liang Guan; Johannes Haybaeck; Christian Datz; Kang Zhang; Michael Karin Journal: Proc Natl Acad Sci U S A Date: 2017-01-27 Impact factor: 11.205
Authors: Koji Taniguchi; Li-Wha Wu; Sergei I Grivennikov; Petrus R de Jong; Ian Lian; Fa-Xing Yu; Kepeng Wang; Samuel B Ho; Brigid S Boland; John T Chang; William J Sandborn; Gary Hardiman; Eyal Raz; Yoshihiko Maehara; Akihiko Yoshimura; Jessica Zucman-Rossi; Kun-Liang Guan; Michael Karin Journal: Nature Date: 2015-02-25 Impact factor: 49.962
Authors: Priscilla Cheung; Jordi Xiol; Michael T Dill; Wei-Chien Yuan; Riccardo Panero; Jatin Roper; Fernando G Osorio; Dejan Maglic; Qi Li; Basanta Gurung; Raffaele A Calogero; Ömer H Yilmaz; Junhao Mao; Fernando D Camargo Journal: Cell Stem Cell Date: 2020-07-29 Impact factor: 24.633
Authors: Zenaida P Lopez-Dee; Sridar V Chittur; Hiral Patel; Aleona Chinikaylo; Brittany Lippert; Bhumi Patel; Jack Lawler; Linda S Gutierrez Journal: PLoS One Date: 2015-10-13 Impact factor: 3.240