| Literature DB >> 35531073 |
Zhe Chen1, Hong Zhou2, Haoliang Hu3, Linxi Chen1.
Abstract
Entities:
Keywords: MTHFD1; One-carbon units; RPMI; SHMT1; SHMT2; TSH
Mesh:
Substances:
Year: 2022 PMID: 35531073 PMCID: PMC9072622 DOI: 10.3389/pore.2022.1610337
Source DB: PubMed Journal: Pathol Oncol Res ISSN: 1219-4956 Impact factor: 2.874
FIGURE 1Inhibiting SHMT1 may be a vital target for a series of tumor diseases with low SLC19A1 expression. Low expression of SLC19A1 causes the poor capacity of cancer cells to retain intracellular folates, thereby resulting in a low level of folate conditions. Then, a 1C metabolic switch toward cytosolic 1C flux rather than mitochondrial 1C flux enables cancer cells to depend on SHMT1. Finally, SHMT-mediated cytosolic 1C metabolic flux can provide DNA replication and methylation for the growth of tumors with low SLC19A1 expression. Inhibiting SHMT1 can impair the growth of tumors with low SLC19A1 expression.
The analysis of potential SHMT1 inhibitors.
| Name | Structure | Mechanisms | Effects | Refers |
|---|---|---|---|---|
| Pyrazolopyran scaffold derivative 2.12 |
| Lower dissociation constant by 50-fold | Causing apoptosis in lung cancer cell lines | [ |
| Mimosine |
| Inhibit transcription by chelating zinc | Inhibiting DNA replication | [ |
| Arsenic trioxide |
| SHMT1 degradation | Increasing genome instability | [ |
| Spiro-dihydroindene analogues |
| Strong target affinities | Inhibiting plasmodial DNA replication | [ |
| Tetrahydrofolate |
| Substrate inhibition dependent on pH | Adapting cellular environments | [ |
| 3-bromopyruvate |
| Reacting with Cysteine residues in a nucleophilic substitution | As a potent novel anti-tumour agent | [ |
| AGF347 |
| Molecular Modeling to design small-molecule inhibitor | Showing antitumor efficacies against lung, colon, and pancreatic cancer | [ |
| Lometrexol |
| Targeting GARFT | As panel antifolates to treat cancer | [ |
| miR-198 | 3′CTTGGATAGAGGGGAGACCTG | Binding to 3′ UTR1 of SHMT1 mRNA to downregulating its expression | Suppressing lung adenocarcinoma cells proliferation | [ |
| MiR-218-5p | 3′UGUACCAAUCUAGUUCGUGUU-5′ | Binding to 3′ UTR1 of SHMT1 mRNA to downregulating its expression | Suppressing killing effect of NK cells to lung adenocarcinoma | [ |