Inositol-1,4,5-Trisphosphate Receptor-1 and -3 and Ryanodine Receptor-3 May Increase Ooplasmic Ca2+ During Quail Egg Activation.

We previously reported that egg activation in Japanese quail is driven by two distinct types of intracellular Ca2+ ([Ca2+]i): transient elevations in [Ca2+]i induced by phospholipase Czeta 1 (PLCZ1) and long-lasting spiral-like Ca2+ oscillations by citrate synthase (CS) and aconitate hydratase 2 (ACO2). Although the blockade of inositol 1,4,5-trisphosphate receptors (ITPRs) before microinjections of PLCZ1, CS, and ACO2 cRNAs only prevented transient increases in [Ca2+]i, a microinjection of an agonist of ryanodine receptors (RYRs) induced spiral-like Ca2+ oscillations, indicating the involvement of both ITPRs and RYRs in these events. In this study, we investigated the isoforms of ITPRs and RYRs responsible for the expression of the two types of [Ca2+]i increases. RT-PCR and western blot analyses revealed that ITPR1, ITPR3, and RYR3 were expressed in ovulated eggs. These proteins were degraded 3 h after the microinjection of PLCZ1, CS, and ACO2 cRNAs, which is the time at which egg activation was complete. However, degradation of ITPR1 and ITPR3, but not RYR3, was initiated 30 min after a single injection of PLCZ1 cRNA, corresponding to the time of the initial Ca2+ wave termination. In contrast, RYR3 degradation was observed 3 h after the microinjection of CS and ACO2 cRNAs. These results indicate that ITPRs and RYR3 differentially mediate in creases in [Ca2+]i during egg activation in Japanese quail, and that downregulation of ITPRs and RYR3-mediated events terminate the initial Ca2+ wave and spiral-like Ca2+ oscillations, respectively. 2022, Japan Poultry Science Association.

Introduction

In all vertebrates examined to date, the fertilizing sperm immediately induces an increase in intracellular Ca2+ concentrations ([Ca2+]i) after sperm-egg fusion (Stricker, 1999; Runft ). This [Ca2+]i increase evokes a series of events to cause egg activation, such as the resumption of egg meiosis, exocytosis of cortical granules, maternal protein synthesis, and pronuclear formation, thereby leading to initiation of the first zygotic cell cycle program (Miyazaki ; Stricker, 1999; Ducibella ; Runft ).

Although an intracellular [Ca2+]i increase in fertilizing eggs is a universally conserved phenomenon in animals, the shape and pattern of the [Ca2+]i response vary widely among species (Stricker, 1999). A technique used for in vitro fertilization in sea urchin and frog revealed a single [Ca2+]i increase from the sperm entry site that propagated throughout the egg within 5 min (Stricker, 1999). In mammalian eggs, the initial elevation in [Ca2+]i is followed by periodic oscillatory increases that spike every 5–15 min and repetitive oscillations that continue until at least the pronuclei are formed (Ca2+ oscillation; Miyazaki ; Jones ; Nakada ). In physiologically polyspermic species such as the newt, 2–20 sperms successively enter at different points on the egg surface, with sequential increases in [Ca2+]i occurring at each sperm entry site as small waves; however, each Ca2+ wave does not reach the opposite site of the egg (Harada , 2011; Iwao, 2012). Therefore, multiple Ca2+ waves induced by all fertilizing sperm appear to be important for propagation over the entire egg to result in complete egg activation.

Birds also exhibit physiological polyspermy during fertilization (Harper, 1904; Patterson, 1910; Fofanova, 1965; Nakanishi ; Waddington ). In the Japanese quail, 100–200 sperm successively enter the egg cytoplasm during fertilization, a number that is markedly higher than that in newt and even other avian species (Mizushima, 2017). We previously reported a unique pattern of increase in [Ca2+]i in quail eggs following microinjection of 2 ng of sperm protein extract, which is equivalent to 200 sperm (SE) (Mizushima ). SE evoked two phases of [Ca2+]i changes: an initial transient increase in [Ca2+]i followed by multiple long-lasting spiral-like signals. A transient Ca2+ wave was initiated at the injection site of the germinal disc immediately after SE injection and spread concentrically into the egg cytoplasm. A spiral-like Ca2+ signal then occurred at the injection site 10–15 min after microinjection and continued for at least 1 h. We also demonstrated that the initial transient Ca2+ wave was required for the resumption of second meiosis, whereas induction of the spiral-like Ca2+ signal appeared to be necessary for ensuring the completion of all events to accelerate the cell cycle progression of initial and early cleavage (Mizushima ). Furthermore, removing extracellular Ca2+ by adding a Ca2+ chelator did not affect the induction of an increase in [Ca2+]i, indicating that the main sources of Ca2+ during egg activation are egg organelles. Although we reported, for the first time, an increase in [Ca2+]i in avian eggs during fertilization, the underlying cellular and molecular mechanisms have not yet been elucidated in detail.

Inositol 1,4,5-trisphosphate receptor type 1 (ITPR1) is mainly responsible for the [Ca2+]i increase associated with fertilization in mammals (Miyazaki ; Fissore ; Jones and Whittingham, 1996; Lee ; Ito ). The essential role of ITPR1 in fertilization was confirmed using functional-blocking antibodies, with antibody injection precluding the [Ca2+]i increase triggered by sperm penetration. Following fertilization, ITPR1 was progressively degraded, which corresponded to the termination of sperm-initiated Ca2+ oscillations at the interphase stage (He ; Brind ; Jellerette ; Malcuit ). This down-regulation was induced by ubiquitination and subsequent degradation by the proteasome, which desensitized ITPR1 (Brind ). Gating of ITPR1 and Ca2+ release requires binding of IP3, a product of the hydrolysis of phosphatidylinositol 4,5-bisphosphate by phospholipase C (PLC). Phospholipase Czeta1 (PLCZ1) was originally isolated as a sperm-specific isoform from mice, and microinjection of its complementary RNA (cRNA) or recombinant protein into the mouse egg elicited Ca2+ oscillations similar to those observed during fertilization. Therefore, PLCZ1 may be responsible for the production of IP3 (Saunders ). Previous studies on PLCZ1 demonstrated its ability to induce [Ca2+]i increases across mammalian, chicken, and fish species (Cox ; Kouchi ; Yoneda ; Yoon and Fissore, 2007; Coward , 2011).

However, we discovered that PLCZ1 was responsible for the induction of the initial transient Ca2+ increase in Japanese quail, whereas citrate synthase (CS) and aconitate hydratase 2 (ACO2) were needed for long-lasting spiral-like Ca2+ oscillations. Heparin and 2-aminoethoxydiphenyl borate, antagonists of ITPRs, precluded the initial Ca2+ wave but not the long-lasting spiral-like Ca2+ signal (Mizushima ). These findings suggest that CS- and ACO2-induced spiral-like Ca2+ oscillations are generated by cellular events that differ from the PLCZ1-induced IP3 production pathway. In addition, microinjection of cyclic adenosine diphosphateribose, an activator of ryanodine receptors (RYRs), induced similar spiral-like Ca2+ signal patterns in eggs, which may be mediated via RYRs. Although three separate isoforms of ITPRs (ITPR1, ITPR2, and ITPR3) and RYRs (RYR1, RYR2, and RYR3), which are encoded by different genes, have been isolated from birds (Percival ; Guillemette ), the type of receptor responsible for the [Ca2+]i increase during egg activation in Japanese quail remains unclear. Therefore, this study was conducted to identify the maternal isoforms of ITPRs and RYRs expressed in eggs and investigate the downregulation of ITPRs and RYRs after microinjections of sperm-borne egg-activating factors to reveal their involvement in quail egg activation.

Materials and Methods

Animals

Male and female Japanese quail, Coturnix japonica, 8–20 weeks of age (Motoki Corporation, Saitama, Japan), were maintained individually under a photoperiod of 14 h light:10 h dark (lights on at 05:00) with ad libitum access to water and a commercial diet (Muroran Uzuraen, Muroran, Japan). All experimental procedures for the care and use of animals were approved by the Animal Care and Use Committee of Hokkaido University (approval number 14-0135).

Microinjections of PLCZ1, CS, and ACO2 cRNAs

To prepare PLCZ1, CS, and ACO2 cRNAs, the PCR products of quail PLCZ1, CS, and ACO2 cloned into the pGEM-T easy vector (Mizushima ) were subcloned into pTNT plasmids (Promega, Madison, WA, USA), which were then subjected to RNA synthesis using a Ribomax RNA synthesis system (Promega). RNA concentrations were measured using a spectrophotometer (NanoDrop 8000, Thermo Fisher Scientific, Waltham, MA, USA).

Unfertilized eggs were recovered from the anterior magnum within 2 h of egg oviposition (Mizushima ), and each egg was microinjected with PLCZ1 (60 ng/µL), CS (100 ng/µL), and ACO2 (100 ng/µL) cRNAs and then cultured in vitro for 30 min or 3 h. All procedures used for microinjections and in vitro cultures were performed as described by Mizushima and Ono , respectively.

mRNA Expression Analysis of ITPRs and RYRs

Total RNA was extracted from tissues such as the ovary, whole brain, heart, liver, stage X blastoderms isolated from freshly laid eggs, or the germinal discs of eggs collected from the infundibulum 30 min after predicted ovulation; 0.2 µg of total RNA was reverse-transcribed using a ReverTra Ace kit (TOYOBO, Osaka, Japan). The sample volume was 10 µL. One microliter of cDNA from germinal disc samples was amplified using gene-specific primers for the ITPR1, 2, and 3 and RYR1, 2, and 3 genes, and the γ-tubulin (TUBG) gene was amplified as an internal control for cDNA (Table 1). The specificity of PCR was confirmed by sequence analysis.

Table 1.

Oligonucleotide primers used for RT-PCR

Gene	Forward primer, 5′ → 3′	Reverse primer, 5′ → 3′	Accession number
ITPR1	GGTAAACCCTGACTATGAGG	GTAATCCTGCTGAGAATGCC	AB_839359
ITPR2	GCTCAGATATTCGGGATCCT	ACTTCCTCTTCATCAATGTC	AB_839360
ITPR3	AGGAGCTGTCAGACCAGAAG	ACCTCCTCCTCTGAGTACTC	AB_839361
RYR1	GCTGACCGAGAAGAGCAAGT	TCGAAGAACCTACAGACCCCA	XM_032441838.1
RYR2	AAGTCACAGGATCCCAACGC	TGAGCCAGACTCTGTTGGTTA	XM_032443314.1
RYR3	TCGTAGAGAGAAAACGTGCTCC	AGTGTCTGCATGAAGGAGGC	XM_032444977.1
TUBG	ATGCCGCGGGAGATCATCAC	TCACTGCTCCTGTGTGCCCC	XM_015886034.2

Western Blot Analysis of ITPRs and RYRs

Germinal discs were collected according to the method described by Mizushima and dissolved in intracellular-like medium (120 mM KCl, 0.1 mM EGTA, 10 mM Na-β-glycerophosphate, 0.2 mM PMSF, 1 mM DTT, and 20 mM HEPES–NaOH, pH 7.5) by homogenization and sonication. The supernatant was collected by centrifugation at 10,000 ×g for 10 min. Each extract was heated at 70°C for 5 min, and 20 µg protein per lane was resolved by SDS-PAGE (Laemmli, 1970) on a 6% polyacrylamide gel and transferred onto a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). Following transfer and blocking for 30 min using a detector block (SeraCare Life Sciences, Milford, MA, USA), the membrane was incubated at 4°C overnight with a rabbit anti-rat ITPR1 antibody (Alomone Labs Ltd., Jerusalem, Israel), rabbit anti-human ITPR3 antibody (LifeSpan BioSciences, Inc., Seattle, WA, USA), or mouse anti-chicken RYR antibody (GeneTex, Inc., Irvine, CA). The membrane was then incubated at 4°C for 1 h with a goat anti-rabbit or a donkey anti-mouse secondary antibody coupled with horse-radish peroxidase (Millipore). An anti-chicken γ-tubulin monoclonal antibody (Sigma-Aldrich, St. Louis, MO, USA) was used to detect TUBG after separating the proteins on a 12% polyacrylamide gel. Immunoreactivity was detected using Immobilon Western Detection Reagent (Millipore) and LAS 3000 (GE Healthcare, Little Chalfont, UK). Visualized blots were digitized using ImageJ 1.48v software (NIH, Bethesda, MD, USA).

Statistical Analysis

Protein expression levels were normalized relative to those of the TUBG protein as an internal control. Data were expressed as the mean±standard deviation and analyzed for significant differences by ANOVA. Means were compared using Tukey's test. Differences were considered to be significant at P<0.05.

Results

Expression Profiles of ITPRs and RYRs in Quail Tissues

To investigate the presence of all ITPR and RYR transcripts in quail, we initially analyzed mRNAs isolated from various tissues, as tissue-specific expression of each ITPR and RYR isoform has been reported in mammals (Newton ; Giannini ). Fig. 1 shows the mRNA expression levels of ITPRs and RYRs in the ovary, brain, heart, liver, and blastoderm of quail determined by RT-PCR. The PCR products of ITPR1 and ITPR2 were detected in all tissues, except for ITPR1 in the heart. In contrast, the PCR products of ITPR3 were only detected in the ovary, brain, and blastoderm. Analyses of the mRNA distribution of RYR1 and RYR2 revealed the expression of the former in the ovary, brain, and liver and of the latter in only the brain and heart. In contrast, the mRNA expression of RYR3 was detected in all tissues. These results demonstrate that multiple types of ITPRs and RYRs were co-expressed in most tissues, and their expression profiles were similar to those of murine tissues (Newton ; Giannini ). Collectively, these results indicate the presence of all transcripts encoding three distinct isoforms of bona fide ITPRs and RYRs in quail.

Fig. 1.

Tissue distribution of mRNAs for Two hundred nanograms of total RNA extracts from the ovary (Ova), brain (B), heart (H), liver (Li), or blastoderm (BD) were subjected to RT-PCR using specific primers. As a negative control, distilled water (H2O) was used. A representative gel of three independent experiments is shown.

Expression of ITPRs and RYRs in Quail Eggs

Figure 2A shows the mRNA expression of the ITPR and RYR isoforms in the germinal discs of ovulated eggs detected by RT-PCR. The PCR products of ITPR1, ITPR3, and RYR3 showed the predicted sizes, whereas those of ITPR2, RYR1, and RYR2 were below the detection limit. Western blot analysis showed that anti-ITPR1, anti-ITPR3, and anti-RYR3 re-acted with bands at approximately 270, 250, and 500 kDa, respectively (Fig. 2B). The bands did not react with the normal rabbit or mouse IgG bands. These results indicate that the ITPR1, ITPR3, and RYR3 proteins are present in ovulated eggs.

Fig. 2.

mRNA and protein expression of (A) mRNA expression of ITPRs and RYRs in quail eggs. Two hundred nanograms of total RNA extracts from the germinal discs of eggs collected from the infundibulum 30 min after predicted ovulation were subjected to RT-PCR using specific primers. As a non-RT control, mRNA from the germinal disc was treated in the same manner, except that reverse transcriptases (–) were omitted. A representative gel of three independent experiments is shown. (B) Protein expression of ITPR1, ITPR3, and RYR3 in quail eggs. Twenty micrograms of protein extracts from the germinal disc were separated by SDS-PAGE, transferred onto polyvinylidene fluoride membranes, and detected with anti-ITPR1, ITPR3, and RYR3 antibodies or control normal rabbit/mouse IgG.

Down-regulation of ITPRs and RYRs After a Microinjection of Sperm-borne Egg-activating Factors

To investigate the involvement of ITPR1, ITPR3, and RYR3 in the generation of the initial Ca2+ wave and spiral-like Ca2+ oscillations, we examined the degradation of these proteins after microinjections of sperm-borne egg-activating factors. As shown in Fig. 3A and 3C, the intensities of the bands for the ITPR1 and ITPR3 proteins were both significantly weaker following triple injection of PLCZ1, CS, and ACO2 cRNA than those observed in eggs injected with solvent 30 min after microinjection. However, RYR3 was not degraded (Fig. 3A and 3C). In addition, similar degradation of the ITPR1 and ITPR3 proteins was observed 30 min after single injection of PLCZ1 cRNA (Fig. 3B and 3C). In contrast, when the eggs were microinjected with CS and ACO2 cRNAs without PLCZ1 cRNA, RYR3 protein expression as well as ITPR1 and ITPR3 protein levels did not decrease after 30 min of incubation (Fig. 3B and 3E). Time-course studies indicated that RYR3 was degraded by CS and ACO2 cRNAs with or without PLCZ1 cRNA 3 h after injection (Fig. 3D–F). In contrast, neither ITPR1 nor ITPR3 protein degradation occurred following microinjections of CS and ACO2 cRNAs, even after 3 h (Fig. 3E and 3F).

Fig. 3.

Changes in ITPR1, ITPR3, and RYR3 protein expression levels in quail eggs activated by injections of (A and D) Western blotting analysis 30 min (A) and 3 h (D) after microinjection of a mixture of cRNAs of 3 sperm factors (3SF) (PLCZ1, CS, and ACO2). (B and E) Western blotting analysis 30 min (A) and 3 h (D) after microinjection of PLCZ1 cRNA alone or CS and ACO2 cRNA. (C and F) Quantification of immunoreactivity 30 min (C) and 3 h (F) after the cRNA microinjection. Band intensities were quantified and expressed as the means±standard deviations of three independent experiments. Values with different letters are significantly different (P<0.01).

Discussion

In the present study, we demonstrated for the first time that ITPR1 and ITPR3 are expressed at both the mRNA and protein levels in quail eggs. In mice, although all ITPR isoform mRNAs were expressed in the egg, the ITPR1 and ITPR2 proteins were predominant (Fissore ). The ITPR3 protein was present to a lesser extent, if any, because it was not observed by immunochemistry and its detection by Western blotting required more than 1000 eggs (Fissore ). ITPR1 was localized in the periphery of ovulated MII mouse eggs, whereas ITPR2 was restricted to the cortical vesicle. The cortical vesicle plays a pivotal role in responding to the polyspermy block by releasing its contents outwards to make the zona pellucida refractory to the binding and fusion of a second sperm (the zona reaction). Therefore, ITPR2 may not release the large amount of Ca2+ required to trigger Ca2+ oscillations but may amplify the signaling events required for the polyspermy block in mouse eggs. In contrast, neither a membrane block nor intracellular organelles similar to the cortical vesicle have been detected in polyspermic eggs, such as in birds (Mizushima, 2017). In addition, an interesting feature of the ITPR2 mRNA expression pattern in the present study is its absence in quail eggs, although ITPR2 mRNA was expressed in all tissues studied. These results support the hypothesis that ITPR2 may be involved in the polyspermy block, a process that does not occur in avian eggs in which polyspermic fertilization takes place.

In mammalian eggs, 70–80% of the ITPR1 protein was degraded when the eggs were microinjected with PLCZ1 cRNA or sperm (Malcuit ). Additionally, microinjection of the anti-ITPR1 antibody completely inhibited fertilization-associated increases in [Ca2+]i, indicating the role of ITPR1 in the release of most of the Ca2+ from intracellular Ca2+ stores during egg activation. In contrast to mouse eggs, ITPR3 was expressed at significant levels in quail eggs, and ITPR1 and ITPR3 were both progressively degraded 30 min after the microinjection of PLCZ1 cRNA. It is important to note that the timing of ITPR degradation synchronized with that of the termination of the initial transient [Ca2+]i increase (Mizushima ). These results strongly support that gating of both ITPR1 and ITPR3 in response to sperm entry is involved in inducing the initial [Ca2+]i increase. Microinjection of mouse PLCZ1 cRNA, which triggered Ca2+ oscillations in mouse eggs, only generated a Ca2+ wave and not mammalian-like Ca2+ oscillations in quail eggs (data not shown). A previous study reported that IP3-activated Ca2+ signals differ in somatic cells expressing different ITPR isoforms (Ehrlich and Watras, 1988; Khodakhah and Ogden, 1993; Hajnnoczky and Thomas, 1994). This result implies that the different ITPR types contribute to the distinct regulation of Ca2+ release from cells and may have different affinities for IP3 (Newton ; Joseph ). In addition, ITPR isoforms assemble as homo- or heterotetramers to form functional channels; thus, it is reasonable to postulate that the different binding affinities of IP3 to each channel in mouse and quail eggs contribute to the species-specific patterns of [Ca2+]i increases (Nucifora ).

Interestingly, RYR3 was downregulated during egg activation in quail. We previously reported that an RYR agonist generated a Ca2+ spike similar to that of CS- and ACO2-induced spiral-like oscillations (Mizushima ). Collectively, these findings and the present results suggest that the periodic and long-lasting Ca2+ spikes are mediated via RYR3. Although the duration of CS- and ACO2-generated spiral-like oscillations has not been examined, intracytoplasmic sperm injection-treated quail eggs initiated the first cleavage 3 h after microinjections, indicating the completion of quail egg activation within 3 h of these injections (Mizushima ). This assumption is supported by the present results showing that RYR3 was degraded 3 h after microinjection.

RYRs have not been detected in frog and hamster eggs using RYR-specific antibodies (Miyazaki ; Parys ). Furthermore, RYR agonists did not induce changes in [Ca2+]i, suggesting that RYRs do not play a major role in Ca2+ release from intracellular Ca2+ stores during egg activation in these species (Miyazaki ; Nuccitelli ). Although conflicting findings on the presence of RYR2 and RYR3 in mouse and bovine eggs have been reported by immunological studies (Carroll and Swann, 1992; Swann, 1992; Kline and Kline, 1994; Yue and 1998), evidence suggests that a functional disturbance in ITPR1 inhibits all aspects of egg activation in mice, hamsters, and humans (Miyazaki ; Xu ; Goud ).

In summary, our results suggest that ITPR1, ITPR3, and RYR3 regulate the two distinct Ca2+ signals generated by PLCZ1, CS, and ACO2 in Japanese quail. However, as single injection of CS or ACO2 cRNA did not induce significant release of Ca2+ from quail eggs (Mizushima ), further studies are needed to identify the cellular and biochemical components mediating Ca2+ release from RYR3 channels.