| Literature DB >> 35517864 |
Leila Baghani1, Niloofar Noroozi Heris1, Fatemeh Khonsari2, Sajad Dinarvand3, Meshkat Dinarvand3, Fatemeh Atyabi1,3.
Abstract
Purpose: Despite the promising therapeutic effects of gene silencing with small interfering RNAs (siRNAs), the challenges associated with delivery of siRNAs to the tumor cells in vivo, has greatly limited its clinical application. To overcome these challenges, we employed gold nanoparticles modified with trimethyl chitosan (TMC) as an effective delivery carrier to improve the stability and cellular uptake of siRNAs against epidermal growth factor receptor (EGFR) that is implicated in breast cancer.Entities:
Keywords: EGFR-siRNA; breast cancer; gold nanoparticles (AuNPs); siRNA delivery; trimethyl chitosan (TMC)
Year: 2022 PMID: 35517864 PMCID: PMC9065351 DOI: 10.3389/fmolb.2022.871541
Source DB: PubMed Journal: Front Mol Biosci ISSN: 2296-889X
The primer sequences utilized in real-time PCR.
| Forward sequence | AACACCCTGGTCTGGAAGTACG |
|---|---|
| Reverse Sequence | TCGTTGGACAGCCTTCAAGACC |
PCR, polymerase chain reaction.
FIGURE 1Synthesis and characterization of the AuNPs-TMC: (A) FTIR spectrum of TMC. (B) NMR Spectrum of TMC. (C) UV–Vis spectrum of AuNPs and AuNPs-TMC. (D) TEM image of AuNPs. (E) TEM image of AuNPs-TMC. (F) SEM image of AuNPs-TMC.
Size, PDI, and zeta potential of NPs.
| Nanoparticles | Size (nm) | PDI | Zeta Potential (mV) |
|---|---|---|---|
| AuNPs | 60 ± 5 | 0.228 ± 0.012 | −4.1 ± 2.3 |
| AuNPs-TMC | 67 ± 7 | 0.27 ± 0.023 | +45.4 ± 4.7 |
| AuNPs-TMC/siRNA (10:1 w/w ratio) | 82 ± 5 | 0.265 ± 0.019 | +11.4 ± 1.8 |
NP: nanoparticle, PDI: polydispersity index, TMC: trimethyl chitosan.
Data are shown as mean ± SD (n = 3).
FIGURE 2Stability, release profile and cellular uptake of AuNPs-TMC/siRNA. (A) Agarose gel electrophoresis for naked siRNA and different w/w ratios of AuNPs-TMC/siRNA. (B) Release Profile of siRNA from AuNPs-TMC/siRNA in 10:1 w/w ratio in 10% FBS aqueous media at 37°C. The percentage of free siRNA was measured at 0, 1, 2, 4, 6, and 24 h time points, data are presented as mean ± SD of triplicates. Cellular uptake of AuNPs-TMC/Cy5-labeled siRNA (w/w ratio 10:1) in MCF-7 cells after 4 h incubation. (C) Confocal microscopy images (The cell nuclei were stained by DAPI). (D) Flow cytometry analysis; which is shown in histogram with the X-axis indicating the mean fluorescence intensity and the Y-axis indicating the cell count.
FIGURE 3Therapeutic effects of AuNPs-TMC/siRNA. (A) Cell viability percentage of MCF-7 cells after 48 h incubation with AuNPs-TMC, Free siRNA and AuNPs-TMC/siRNA (w/w ratio 10:1) at different concentration of NPs (28, 56 and 112 μg/ml) and siRNA (50, 100 and 200 nM). Data is shown as mean ± SD (N = 3). Statistical analysis: Two-way ANOVA, post-test Sidak, (***p < 0.001 significantly difference between columns). (B) Relative gene expression percent of EGFR in MCF-7 cells after 24 h incubation with AuNPs-TMC/EGFR-siRNA in w/w ratio of 10:1 (56 μg/ml/100 nM) using RT-PCR method. (KD = knockdown). (C) Apoptosis assay in MCF-7 cancer cells following no treatment and treatment with AuNPs-TMC, Free siRNA and AuNPs-TMC/EGFR-siRNA (56 μg/ml/100 nM) after 24 h using annexin V-FITC/PI staining.