Literature DB >> 35508687

Association of X-linked TLR-7 gene polymorphism with the risk of knee osteoarthritis: a case-control study.

Xutao Xi1, Arshad Mehmood2, Pengyan Niu3, Jinjie Yang3, Yintian Wang3, Heyu Zhou3, Xiaohui Han3, Lifen Ma4, Shiying Jin4, Yinxia Wu4.   

Abstract

Knee osteoarthritis (OA) is the most prevalent type of OA, and Toll-like receptor 7 (TLR7) may lead to the pathogenesis of OA. Recently, X-linked TLR7 polymorphism has been confirmed to be associated with arthritis. However, there is a lack of studies on TLR7 gene polymorphism associated with knee OA susceptibility. The current study aimed to determine whether TLR7 gene polymorphism is associated with the risk of knee OA. Genotyping of two polymorphic sites (rs3853839 and rs179010) in the TLR7 gene was performed in 252 OA patients, and 265 healthy controls using the SNaPshot sequencing technique. Data were analyzed statistically by Chi-square tests and logistic regression. Rs3853839-C allele showed frequencies of 28% and 27% in the healthy control and female knee OA groups, respectively. The differences were not statistically significant (P > 0.05). The rs3853839-CG genotype frequency was significantly lower in the female knee OA group as compared to the healthy control group (OR 0.60; 95%CI 0.36-0.99; P = 0.044). In the male hemizygote population, the rs3853839-CC showed significantly lower frequencies in the male knee OA group as compared to the healthy control group (OR 0.35; 95%CI 0.17-0.71; P = 0.0025). Regarding rs179010, there were no differences in the genotype distribution and allele frequencies between OA patients and healthy subjects under any models (P > 0.05). Stratified analysis showed that the frequency of the rs3853839-CG genotypes was lower in high Kellgren-Lawrence grades (KLG) (OR 0.48; 95%CI 0.21-1.08; P = 0.066), and significantly lower in OA patients with effusion synovitis (OR 0.38; 95%CI 0.17-0.88; P = 0.013). TLR7 rs3853839 polymorphism may play a role in the susceptibility of knee OA in the Chinese Han Population and may be associated with OA severity and the risk of effusion synovitis in Knee OA.
© 2022. The Author(s).

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35508687      PMCID: PMC9068723          DOI: 10.1038/s41598-022-11296-4

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.996


Introduction

Osteoarthritis (OA) is a degenerative joint disease that is the most common cause of disabilities among the aging population all over the world[1]. The incidence of OA increases by age and further increases with a longer lifetime. In the old population, symptomatic knee OA occurred more frequently in females than males[2]. Previous studies have shown that for elderly Chinese women, the prevalence of knee OA was higher than in Caucasian women[3]. The phenomenon may be related to ethnics and genetic factors. However, the OA pathogenesis has not been fully understood. Arthrodial cartilage degradation and subchondral bone remodeling represent the most predominant pathological changes of OA[4]. The activation of innate immunity plays a critical role in the development and progression of OA. In the last few decades, TLR-mediated pro-inflammatory signaling pathway and their downstream nuclear factor-κB (NF-κB) signaling pathway have been extensively studied in OA[5-9]. Among TLR family members, TLR7 is the master regulator of RNA-driven TLR-dependent systemic autoimmune manifestations[10]. Previous studies revealed that TLR7 expression was elevated and may be identified for OA diagnostic[11]. Moreover, the TLR7 signaling pathway may play a vital role in OA, and the TLR7 antagonist also exerts a long-lasting analgesic effect on knee OA pain[12]. TLR7 gene is located on the X-chromosome[13], which carries multiple polymorphisms potentially associated with human disease, including susceptibility and progression of HIV-1 infection, asthma, autoimmune thyroiditis, systemic lupus erythematosus (SLE)[14-17]. The rs3853839 C/G single-nucleotide polymorphism (SNP), which is located in the 3′ untranslated region of the TLR7, has been associated with an increase in TLR7 mRNA and protein expression, as well as upregulation of idiopathic subglottic stenosis (iSGS)[18-20]. In addition, rs179010 as an intronic polymorphism has already been reported to be associated with hand, foot, and mouth disease caused by enterovirus 71 in male children and SLE[21,22]. Polymorphisms in TLR genes have been associated with OA[23-25]. However, no relevant pieces of literature report the relationship between X-linked TLR7 gene polymorphism and the risk of knee OA. In this case–control study, we identified X-linked TLR7 3′ UTR gene polymorphism and intronic polymorphism with the risk of knee OA.

Materials and methods

Subjects

OA patients were recruited at the Department of Orthopedics, Handan First Hospital, between May 2018 and May 2020, while healthy controls were enrolled from the physical examination center. All recruited subjects were from the northern Chinese population in the Handan city of Hebei province. Patients were recruited if they were diagnosed with knee OA, and fulfilled the American College of Rheumatology criteria[26]. As a result, patients who met the following criteria were excluded: (a) diagnosed with hypertension, diabetes, cerebrovascular disease, tumors, and other chronic diseases; and (b) complicated with other autoimmune diseases, such as rheumatoid arthritis and SLE, among others autoimmune diseases. All patients agreed to participate in the study and signed a written informed consent before enrolment. Patient data, including age, gender, clinical manifestations, smoking, drinking, body mass index (BMI), MRI of the knee, and K-L grading, were collected and entered into a standard case report form. The study was approved by the Ethics Committee of Handan First Hospital. All methods were performed following the Declaration of Helsinki guidelines and regulations.

DNA isolation and genotyping

DNA was isolated from each patient and subjected to SNaPshot genotyping. Briefly, The peripheral venous blood (ca. 5 mL) was collected into tubes containing EDTA as an anticoagulant. Genomic DNA was extracted from the samples using the Blood Genomic DNA Extraction Kit (JieRui, Shanghai, China). The DNA was subjected to PCR using PCR MIX (Yisheng Biotech Co., Shanghai, China), targeting the SNPs. The primer's information were shown in Table 1.
Table 1

Primer information and primer sequences of TLR7.

GenesUpstream primerDownstream primerExtension primer
rs3853839CCATTCTGTGCCTTTCTTTCTTACTCTGACTGGGAACCC
AGATTGAGGTTTCCCTAAGAAGCAGGCCCAAG
rs179010AGTTATACGGTTCCTACACATTGGGTCCTCTGATTATGTA
CCTCTGATTATTTACATTTCACC
Primer information and primer sequences of TLR7.

Statistical analysis

The online software SNPStats (https://www.snpstats.net/start.htm) and the SHEsis (http://analysis.bio-x.cn) were used to construct linkage disequilibrium (LD), Hardy–Weinberg balance test haplotypes, and analyzed the interactions with related factors, while the other statistical analyses were performed using SPSS version 21.0 (IBM Corp., Armonk, NY). Results were presented as frequencies (percentages) for qualitative variables and mean ± standard deviations (SD) for quantitative variables. Comparisons between two groups were performed using unpaired student's t-test, whereas Chi-squared tests were used for categorical variables. The association between SNPs with the risk factors was analyzed using logistic regression analysis data followed by (P < 0.05) were considered statistically significant. The computed statistical power for this study was 0.99 (n = 517, P0 = 0.2, α = 0.01, OR 2) using PASS 15.0.

Results

Analysis of clinical data

A total of 252 OA patients (146 females and 106 males, respectively) and 265 healthy controls (158 females and 108 males, respectively) were enrolled. A summary of patient characteristics is presented in Table 2. There were no statistically significant differences between the case and control groups concerning age, smoking, and drinking distribution (P > 0.05). OA patients showed a slightly higher, but insignificant, mean BMI (24.3 ± 2.21) as compared to controls (24.0 ± 1.92) (P = 0.088). The KLG 2, 3, and 4 were identified in 63, 97, and 92 OA cases, respectively. Moreover, Knee magnetic resonance imaging (MRI) assessed effusion synovitis damage using semiquantitative whole-organ MRI scoring (WORMS). There were 32, 23, 45, and 25 cases for WORMS (0–3), respectively. The results are shown in Table 2.
Table 2

Demographics and clinical characteristics of participants for TLR7 SNP.

Clinical characteristicsKnee OAHCP values
n = 252n = 266
Sex0.4916
 Females146158
 Males106108
Age, y (mean ± SD)56 ± 1555 ± 110.372
Smoking0.075
 Yes7157
 No118209
Drinking0.392
 Yes5752
 No195214
Body mass index (kg/m2)24.3 ± 2.2124.0 ± 1.920.088
Kellgren–Lawrence grade
 263NANA
 397NANA
 492NANA
MRI of knee WORMS score
 032NANA
 123NANA
 245NANA
 325NANA

Knee OA knee osteoarthritis patients group, HC healthy control group, SD standard deviation, NA not assessable, WORMS Semiquantitative whole-organ MRI scoring.

Demographics and clinical characteristics of participants for TLR7 SNP. Knee OA knee osteoarthritis patients group, HC healthy control group, SD standard deviation, NA not assessable, WORMS Semiquantitative whole-organ MRI scoring.

SNP selection and genotyping

Two loci were detected on the TLR7 gene (Table 3). Rs3853839 (C > G) located on chromosome X: 12889539 (GRCh38) and rs179010 (T > C) located on X: 12884766 (GRCh38) represented respectively 3′ UTR region mutations and intron region of TLR7. Genotypic distributions of rs3853839 and rs179010 were consistent with Hardy–Weinberg equilibrium in healthy controls (P > 0.05), suggesting that the selected sample population was representative. Because the TLR7 gene is located on the X chromosome, only female subjects were used to perform the Hardy–Weinberg equilibrium test. The results are shown in Table 3.
Table 3

Selected SNPs of TLR7 and PHWE in this study.

SNPsLocationGroupGenotype (n)PHWE1000genome CHBsNucleotideFunctional region
rs3853839X:12889539CCCGGGG = 0.40
(GRCh38)Knee OA (n = 146)874019P = 0.0005C > G3_prime_UTR
HC (n = 158)826016P = 0.34
rs179010X:12884766CCCTTTT = 0.29
(GRCh38)Knee OA (n = 146)7850180.045T > CIntron
HC (n = 158)7859210.098

Knee OA osteoarthritis patients group, HC healthy control group, PHWE P value of Hardy–Weinberg equilibrium.

Selected SNPs of TLR7 and PHWE in this study. Knee OA osteoarthritis patients group, HC healthy control group, PHWE P value of Hardy–Weinberg equilibrium.

Association between two sites and OA risk under different models

Since the TLR7 gene is located on the X chromosome, the gender distribution influences the allele frequency calculations. Gene frequencies were calculated for men and women separately. The genotype distributions and allele frequencies of the two polymorphisms are shown in Tables 4 and 5.
Table 4

Association analysis between SNPs and the female Knee OA risk under different models.

SNPsModelGenotypeHC (n = 158)Knee OA (n = 146)OR (95% CI)P-value
rs3853839AlleleG224 (72%)214 (73%)10.50
C92 (28%)78 (27%)0.88 (0.62–1.26)
CodominantG/G82 (51.9%)87 (59.6%)10.13
C/G60 (38%)40 (27.4%)0.59 (0.35–0.99)
C/C16 (10.1%)19 (13%)0.90 (0.39–2.07)
DominantG/G82 (51.9%)87 (59.6%)10.072
C/G-C/C76 (48.1%)59 (40.4%)0.65 (0.40–1.04)
RecessiveG/G-C/G142 (89.9%)127 (87%)10.84
C/C16 (10.1%)19 (13%)1.09 (0.48–2.45)
OverdominantG/G-C/C98 (62%)106 (72.6%)10.044
C/G60 (38%)40 (27.4%)0.60 (0.36–0.99)
rs179010AlleleC215(0.68)206(0.71)10.50
T101(0.32)86(0.29)1.12(0.79–1.58)
CodominantC/C78 (49.4%)78 (53.4%)10.93
C/T59 (37.3%)50 (34.2%)0.97 (0.57–1.63)
T/T21 (13.3%)18 (12.3%)0.86 (0.42–1.80)
DominantC/C78 (49.4%)78 (53.4%)10.79
C/T-T/T80 (50.6%)68 (46.6%)0.94 (0.58–1.52)
RecessiveC/C–C/T137 (86.7%)128 (87.7%)10.71
T/T21 (13.3%)18 (12.3%)0.88 (0.44–1.76)
OverdominantC/C-T/T99 (62.7%)96 (65.8%)10.99
C/T59 (37.3%)50 (34.2%)1.00 (0.60–1.64)

Knee OA osteoarthritis patients group, HC healthy control group, OR odds ratios, CI confidence intervals. The data adjusted by smoke + drinking + age + BMI.

Table 5

Association analysis between SNPs and the male Knee OA risk.

SNPsGenotypeHC (n = 108)Knee OA (n = 106)OR (95% CI)P-value
rs3853839G/G75 (69.4%)84 (79.2%)10.0029
C/C33 (30.6%)22 (20.8%)0.35 (0.17–0.71)
rs179010C/C96 (88.9%)95 (89.6%)10.7
T/T12 (11.1%)11 (10.4%)1.21 (0.47–3.11)

Knee OA osteoarthritis patients group, HC healthy control group, OR odds ratios, CI confidence intervals; The data adjusted by smoke + drinking + age + BMI.

Association analysis between SNPs and the female Knee OA risk under different models. Knee OA osteoarthritis patients group, HC healthy control group, OR odds ratios, CI confidence intervals. The data adjusted by smoke + drinking + age + BMI. Association analysis between SNPs and the male Knee OA risk. Knee OA osteoarthritis patients group, HC healthy control group, OR odds ratios, CI confidence intervals; The data adjusted by smoke + drinking + age + BMI. For rs3853839, C was the minor allele and showed frequencies of 28% and 27% in the control and female knee OA groups, respectively. The differences are not statistically significant. However, in the overdominant model, the rs3853839-CG genotype frequency was significantly lower in the female knee OA group as compared to the healthy control group (OR 0.60; 95%CI 0.36–0.99; P = 0.044). In the male hemizygote population, CC showed frequencies of 30.6% and 20.8% in the control and male knee OA groups, respectively. The differences are statistically significant (OR 0.35; 95%CI 0.17–0.71; P = 0.0025). For rs179010, there were no differences in the genotype distribution and allele frequencies between OA patients and healthy subjects under any models (P > 0.05). These findings indicated that TLR7 rs3853839 polymorphism may play a role in the susceptibility of knee OA in the Chinese Han Population.

Linkage disequilibrium and haplotype analysis

LD was calculated from the female study sample. The haplotype analysis showed that rs3853839 and rs179010 were in low LD (D' = 0.2462). Thus, the haplotype analysis was not tested. The result was shown in Fig. 1.
Figure 1

Linkage disequilibrium (LD) patterns in TLR7. D' (A) and r2 (B) mean LD coefficients of the two SNPs. Each block represents the LD relationship between two SNPs. Rs3853839 indicated no LD with rs179010.

Linkage disequilibrium (LD) patterns in TLR7. D' (A) and r2 (B) mean LD coefficients of the two SNPs. Each block represents the LD relationship between two SNPs. Rs3853839 indicated no LD with rs179010.

Stratification analysis based on clinical features of OA patients

No statistically significant difference was observed in genotype and allele frequencies after stratification by age, smoking status, and BMI. The association between TLR7 polymorphisms with OA severity was also calculated. Results showed the distribution of rs3853839-CG genotypes was lower in high KLG. The weight of evidence, while not achieving statistical significance, was towards a negative association (OR 0.48; 95%CI 0.21–1.08; P = 0.066), indicating that rs3853839 may be associated with OA severity (Table6).
Table 6

Stratified analyses based on clinical features for the association between TLR7 polymorphism and the risk of Knee OA.

SNPsGenotypeClinical features itemsOR (95% CI)P-value
BMI < 24BMI ≥ 24
rs3853839G/G-C/C44 (77.2%)62 (69.7%)10.99
C/G13 (22.8%)27 (30.3%)0.99 (0.34–2.89)
rs179010C/C-T/T39 (68.4%)57 (64%)10.2
C/T18 (31.6%)32 (36%)0.51 (0.18–1.44)
Age > 55Age ≤ 55
rs3853839G/G-C/C47 (69.1%)59 (75.6%)10.38
C/G21 (30.9%)19 (24.4%)0.72 (0.34–1.51)
rs179010G/G-C/C47 (69.1%)59 (75.6%)10.38
C/G21 (30.9%)19 (24.4%)0.72 (0.34–1.51)
KLG ≤ 3KLG = 4
rs3853839G/G-C/C130 (81.2%)82 (89.1%)10.066
C/G30 (18.8%)10 (10.9%)0.48 (0.21–1.08)
rs179010C/C-T/T125 (78.1%)77 (83.7%)10.2
C/T35 (21.9%)15 (16.3%)0.63 (0.31–1.29)
Smoke = NoSmoke = Yes
rs3853839G/G-C/C135 (79.4%)77 (93.9%)10.53
C/G35 (20.6%)5 (6.1%)0.71 (0.24–2.08)
rs179010C/C-T/T128 (75.3%)74 (90.2%)10.91
C/T42 (24.7%)8 (9.8%)0.95 (0.37–2.40)

Knee OA osteoarthritis patients group, HC healthy control group, OR Odds ratios, CI confidence intervals, KLG Kellgren-Lawrence grade, BMI Body Mass Index. The data adjusted by moke + drinking + age + BMI.

Stratified analyses based on clinical features for the association between TLR7 polymorphism and the risk of Knee OA. Knee OA osteoarthritis patients group, HC healthy control group, OR Odds ratios, CI confidence intervals, KLG Kellgren-Lawrence grade, BMI Body Mass Index. The data adjusted by moke + drinking + age + BMI. We additionally dichotomized MRI-identified effusion-synovitis as none (WORSM 0) vs. any (WORSM 1–3) and investigated the relationship between the two SNPs on TLR7 and MRI-defined effusion-synovitis. For rs179010, no differences were observed in the genotype distribution frequencies between OA patients with effusion synovitis and healthy subjects (P > 0.05) under any models. However, the rs3853839 C/G + C/C genotype frequency in the effusion synovitis patient group under the dominant model was lower than that in the control group, and this difference was statistically significant (OR 0.56, 95%CI 0.33–0.95, P = 0.028). As well as, the C/G genotype frequency in the effusion synovitis patient group under the overdominant model was lower than that in the control group, and this difference was statistically significant (OR 0.48, 95%CI 0.24–0.97, P = 0.03). These results indicated that rs3853839 of TLR7 may be associated with the risk of effusion synovitis in Knee OA patients. (Table 7).
Table 7

Association between TLR7 polymorphism and the risk of effusion with synovitis in Knee OA.

SNPsModelGenotypeHCEffusion synovitisOR (95% CI)P-value
rs3853839CodominantG/G157 (59%)64 (71.9%)10.054
C/G60 (22.6%)11 (12.4%)0.45 (0.22–0.91)
C/C49 (18.4%)14 (15.7%)0.70 (0.36–1.36)
DominantG/G157 (59%)64 (71.9%)10.028
C/G-C/C109 (41%)25 (28.1%)0.56 (0.33–0.95)
RecessiveG/G-C/G217 (81.6%)75 (84.3%)10.56
C/C49 (18.4%)14 (15.7%)0.83 (0.43–1.58)
OverdominantG/G-C/C206 (77.4%)78 (87.6%)10.03
C/G60 (22.6%)11 (12.4%)0.48 (0.24–0.97)
rs179010CodominantC/C174 (65.4%)63 (70.8%)10.57
C/T59 (22.2%)18 (20.2%)0.84 (0.46–1.54)
T/T33 (12.4%)8 (9%)0.67 (0.29–1.53)
DominantC/C174 (65.4%)63 (70.8%)10.35
C/T-T/T92 (34.6%)26 (29.2%)0.78 (0.46–1.32)
RecessiveC/C–C/T233 (87.6%)81 (91%)10.37
T/T33 (12.4%)8 (9%)0.70 (0.31–1.57)
OverdominantC/C-T/T207 (77.8%)71 (79.8%)10.7
C/T59 (22.2%)18 (20.2%)0.89 (0.49–1.61)

Knee OA osteoarthritis patients group, HC healthy control group, OR Odds ratios, CI confidence intervals; The data adjusted by smoke + drinking + age + BMI.

Association between TLR7 polymorphism and the risk of effusion with synovitis in Knee OA. Knee OA osteoarthritis patients group, HC healthy control group, OR Odds ratios, CI confidence intervals; The data adjusted by smoke + drinking + age + BMI.

Discussion

Elevated levels of TLR7 signaling molecules and their positive correlation with pain in OA patients suggest the involvement of the TLR7 signaling pathway in the pathogenesis of this disease[23-25]. In this regard, TLR gene polymorphisms have been reported to be associated with OA. However, the relationship between TLR7 gene polymorphism and the risk of knee OA has not been reported. This study aimed to explore the relationship between polymorphisms of the TLR7 gene with knee OA risk. The results showed that TLR7 rs3853839-CG frequencies of female OA subjects were significantly lower than that of healthy controls in the Chinese Han population. Furthermore, rs3853839-CC frequencies of male knee OA subjects were significantly lower than that of healthy controls. Moreover, rs3853839-CG genotypes were lower in high KLG, indicating that rs3853839 was associated with OA severity. Finally, the rs3853839 C/G + C/C genotype frequency in the effusion synovitis patient group was significantly lower than that in the control group. These results indicated that TLR7 rs3853839 polymorphism may play a role in the susceptibility of knee OA and may be associated with the risk of effusion synovitis in Knee OA patients. Several studies identified that rs3853839 (G/C) as a 3′ UTR SNP in TLR7 is correlated with human disease[27]. Ming Yue et al. reported that TLR7 rs3853839-C allele with protection against HCV persistence in Chinese females[20]. The results of this study are consistent with the current study. In another study, Nan Shen et al. identified an association of rs3853839 (G/C) with SLE in 9,274 eastern Asians with a stronger effect in male than female subjects[19]. Moreover, one study reported in male participants that the reduced susceptibility to periodontitis was observed in carriers of TLR7-rs3853839-CC[28]. The results of this study supported our results. TLR7 rs3853839 polymorphism may play a role in the susceptibility of knee OA. The other SNP rs179010 was also reported to be related to human disease risk. In this respect, a study from Aya Kawasaki et al. reported that intronic SNPs rs179010 are associated with SLE independently of the 3′ UTR SNP rs3853839 in Japanese women[29]. Their study results showed rs3853839 and rs179010 were in moderate LD with each other[29]. Yaping Li et al. showed rs3853839 and rs179010 are correlated to the susceptibility and severity of hand, foot, and mouth disease caused by enterovirus 71 in male children[21]. In the current study, it was found that rs179010 gene polymorphism was not associated with knee OA risk. However, weak LD was also found between these two sites. The different results may be related to the patient selection biases. Rs3853839, located in the 3′ UTR of the TLR7, has been confirmed to be functional and be associated with an increase in TLR7 mRNA and TLR7 protein expression[18-20]; thus, this was not confirmed by the present study. Moreover, results showed that rs3853839-CG genotypes carriers were found with mild-to-moderate KLG scores (1–3). This study also found the rs3853839 CG genotype frequency in the effusion synovitis patient was lower than that in the control group. It can be speculated that these sites might be functional SNP in the pathogenesis of knee OA. The 3′ UTR is an essential regulatory region for the expression of many genes that regulate the translation, degradation, and subcellular localization of the mRNAs by influencing with RNA-binding proteins or non-coding RNAs[30]. The 3′UTR polymorphisms might significantly impact gene expression by abolishing, weakening, or creating miRNA binding sites[31]. It has been shown that the non-risk C allele of rs3853839 matches a predicted binding site of microRNA-3148 (miR-3148), compared with the G-allele construct, the C-allele construct showed greater than two-fold reduction of luciferase activity in the presence of miR-3148[18]. However, more functional experiments should be needed for further verification. Besides the TLR7 gene and other TLR genes polymorphisms have been associated with OA[23-25]. TLR7 gene expression and TLR7 signaling pathway may play a vital role in OA[11,13]. Together with the current study results, these clues have formulated a solid framework for further investigation of the mechanism of action of knee OA.

Limitations

This study has several potential limitations which should be acknowledged. Despite expanding our knowledge of TLR7 regarding phenotype and genotype, there is no relevant research to confirm that these SNPs have functional effects. The role of TLR7 in OA has remained elusive. Furthermore, the sample size of the current study was small and obtained from a single center. Since only a few studies have reported the association between TLR7 rs3853839 and rs179010 polymorphism and knee OA risk, further investigations are required to verify the results.

Conclusion

TLR7 rs3853839 polymorphism may play a role in the susceptibility of knee OA in the Chinese Han Population and may be associated with OA severity and the risk of effusion synovitis in Knee OA. This study provides a crucial basis for future research that explores the molecular mechanisms of the pathogenesis of knee OA.
  31 in total

1.  Low skeletal muscle mass and radiographic osteoarthritis in knee, hip, and lumbar spine: a cross-sectional study.

Authors:  Heewon Jeon; Shi-Uk Lee; Jae-Young Lim; Sun Gun Chung; Soong Joon Lee; Sang Yoon Lee
Journal:  Aging Clin Exp Res       Date:  2019-01-07       Impact factor: 3.636

2.  Development of criteria for the classification and reporting of osteoarthritis. Classification of osteoarthritis of the knee. Diagnostic and Therapeutic Criteria Committee of the American Rheumatism Association.

Authors:  R Altman; E Asch; D Bloch; G Bole; D Borenstein; K Brandt; W Christy; T D Cooke; R Greenwald; M Hochberg
Journal:  Arthritis Rheum       Date:  1986-08

Review 3.  Toll-Like Receptor Pathways in Autoimmune Diseases.

Authors:  Ji-Qing Chen; Peter Szodoray; Margit Zeher
Journal:  Clin Rev Allergy Immunol       Date:  2016-02       Impact factor: 8.667

4.  Sex-specific association of X-linked Toll-like receptor 7 (TLR7) with male systemic lupus erythematosus.

Authors:  Nan Shen; Qiong Fu; Yun Deng; Xiaoxia Qian; Jian Zhao; Kenneth M Kaufman; Yee Ling Wu; C Yung Yu; Yuanjia Tang; Ji-Yih Chen; Wanling Yang; Maida Wong; Aya Kawasaki; Naoyuki Tsuchiya; Takayuki Sumida; Yasushi Kawaguchi; Hwee Siew Howe; Mo Yin Mok; So-Young Bang; Fei-Lan Liu; Deh-Ming Chang; Yoshinari Takasaki; Hiroshi Hashimoto; John B Harley; Joel M Guthridge; Jennifer M Grossman; Rita M Cantor; Yeong Wook Song; Sang-Cheol Bae; Shunle Chen; Bevra H Hahn; Yu Lung Lau; Betty P Tsao
Journal:  Proc Natl Acad Sci U S A       Date:  2010-08-23       Impact factor: 11.205

Review 5.  Osteoarthritis: an update with relevance for clinical practice.

Authors:  Johannes W J Bijlsma; Francis Berenbaum; Floris P J G Lafeber
Journal:  Lancet       Date:  2011-06-18       Impact factor: 79.321

Review 6.  Role of proinflammatory cytokines in the pathophysiology of osteoarthritis.

Authors:  Mohit Kapoor; Johanne Martel-Pelletier; Daniel Lajeunesse; Jean-Pierre Pelletier; Hassan Fahmi
Journal:  Nat Rev Rheumatol       Date:  2010-11-30       Impact factor: 20.543

7.  Sex-specific association between X-linked Toll-like receptor 7 with the outcomes of hepatitis C virus infection.

Authors:  Ming Yue; Le Feng; Shai-di Tang; Jia-jia Wang; Xing-xin Xue; Wei-liang Ding; Yun Zhang; Xiao-zhao Deng
Journal:  Gene       Date:  2014-07-15       Impact factor: 3.688

8.  TLR7 single-nucleotide polymorphisms in the 3' untranslated region and intron 2 independently contribute to systemic lupus erythematosus in Japanese women: a case-control association study.

Authors:  Aya Kawasaki; Hiroshi Furukawa; Yuya Kondo; Satoshi Ito; Taichi Hayashi; Makio Kusaoi; Isao Matsumoto; Shigeto Tohma; Yoshinari Takasaki; Hiroshi Hashimoto; Takayuki Sumida; Naoyuki Tsuchiya
Journal:  Arthritis Res Ther       Date:  2011-03-11       Impact factor: 5.156

9.  Association between TLR-9 gene rs187084 polymorphism and knee osteoarthritis in a Chinese population.

Authors:  Mingfeng Zheng; Shiyuan Shi; Qi Zheng; Yifan Wang; Xiaozhang Ying; Yanghui Jin
Journal:  Biosci Rep       Date:  2017-10-17       Impact factor: 3.840

10.  Effects of TLR7 Polymorphisms on the Susceptibility and Progression of HIV-1 Infection in Chinese MSM Population.

Authors:  Tong Zhang; Junping Zhu; Bin Su; Lina Cao; Zhen Li; Huanhuan Wei; Xiaojie Huang; Kai Zheng; Aixin Li; Ning Chen; Lifeng Liu; Wei Xia; Hao Wu; Qiushui He
Journal:  Front Immunol       Date:  2020-10-26       Impact factor: 7.561

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.