Guo Wang1,2, Xiaoyan Lin1,2, Han Han1,2, Hongxu Zhang3,4, Xiaoli Li1,2, Mei Feng1,2, Chunming Jiang1,2. 1. Department of Pediatrics, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, Hangzhou Zhejiang, P.R. China. 2. Department of Pediatrics, Affiliated Hangzhou Hospital of Nanjing Medical University, Hangzhou First People's Hospital, Hangzhou Zhejiang, P.R. China. 3. Department of Ophthalmology, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, Hangzhou Zhejiang, P.R. China. 4. Department of Ophthalmology, Affiliated Hangzhou Hospital of Nanjing Medical University, Hangzhou First People's Hospital, Hangzhou Zhejiang, P.R. China.
Abstract
Glioblastoma multiforme (GBM) is a malignant cancer with severely poor survival, and the cells continue to thrive during hypoxia and toxic stress through autophagy. To validate the oncogenic role of long noncoding RNA H19 in GBM progression and examine whether autophagy and/or miR-491-5p participate in the process. The expression of H19 and autophagy-related genes in GBM and healthy control tissues was assessed via quantitative polymerase chain reaction. In addition, cell viability, proliferation, apoptosis and autophagy were respectively determined via cell counting kit-8 assay, clone formation assay, flow cytometry, western blotting and green fluorescent protein-microtubule-associated protein 1 light chain 3 alpha fluorescence analysis in vitro. Furthermore, a rescue assay was performed using rapamycin or miR-491-5p antagomir to examine the role of autophagy or miR-491-5p in H19-mediated regulation of proliferation and apoptosis. RNA pull-down and dual-luciferase reporter assays were employed to analyze the interaction between H19 and miR-491-5p. Additionally, tumor growth in a xenograft-bearing mouse model and autophagy in tumor mass were analyzed in vivo. The expression H19 was increased in GBM and was positively correlated with LC3 or Beclin-1. Silencing H19 inhibited growth and promoted apoptosis in GBM cells both in vitro and in vivo, and miR-491-5p was identified as one of the important mediators. H19 regulated the autophagy signaling pathway at least partly via miR-491-5p. Increased H19 expression in GBM exerts oncogenic effects by sponging miR-491-5p and enhancing autophagy. Therefore, H19 may be explored as a target for GBM therapy.
Glioblastoma multiforme (GBM) is a malignant cancer with severely poor survival, and the cells continue to thrive during hypoxia and toxic stress through autophagy. To validate the oncogenic role of long noncoding RNA H19 in GBM progression and examine whether autophagy and/or miR-491-5p participate in the process. The expression of H19 and autophagy-related genes in GBM and healthy control tissues was assessed via quantitative polymerase chain reaction. In addition, cell viability, proliferation, apoptosis and autophagy were respectively determined via cell counting kit-8 assay, clone formation assay, flow cytometry, western blotting and green fluorescent protein-microtubule-associated protein 1 light chain 3 alpha fluorescence analysis in vitro. Furthermore, a rescue assay was performed using rapamycin or miR-491-5p antagomir to examine the role of autophagy or miR-491-5p in H19-mediated regulation of proliferation and apoptosis. RNA pull-down and dual-luciferase reporter assays were employed to analyze the interaction between H19 and miR-491-5p. Additionally, tumor growth in a xenograft-bearing mouse model and autophagy in tumor mass were analyzed in vivo. The expression H19 was increased in GBM and was positively correlated with LC3 or Beclin-1. Silencing H19 inhibited growth and promoted apoptosis in GBM cells both in vitro and in vivo, and miR-491-5p was identified as one of the important mediators. H19 regulated the autophagy signaling pathway at least partly via miR-491-5p. Increased H19 expression in GBM exerts oncogenic effects by sponging miR-491-5p and enhancing autophagy. Therefore, H19 may be explored as a target for GBM therapy.
H19 promotes GBM progression by regulating the autophagy signaling pathway.H19 regulates the autophagy signaling pathway at least partly via miR-491-5p.H19 may be a potential target for GBM therapy.
Introduction
Glioblastoma multiforme (GBM) is a type of malignant glioma tumor with a low survival rate [1,2]. Surgery followed by radiotherapy or chemotherapy with agents, such as temozolomide and bevacizumab, is the standard treatment of GBM [3]. However, despite the availability of various treatment methods, the overall survival of patients with GBM remains very low, with the 5-year postsurgical survival being <6% and the median overall postsurgical survival being 15–23 months [4]. Therefore, it is critical to investigate certain molecular mechanisms in detail to identify new drug targets to treat GBM.Autophagy is an evolutionarily conserved cellular process that regulates the degradation of proteins and whole organelles in cells via delivery to lysosomes [5]. During the early stages of cancer, loss-of-function or abnormal autophagy promotes the progression of cancer by inhibiting the degradation of damaged components or proteins in cells under oxidative stress. However, in advanced tumors, autophagy helps cells to overcome stressful environments such as hypoxia, nutrient deprivation and toxicity caused by chemotherapeutic drugs [6]. Therefore, autophagy plays a dual role in tumorigenesis. During the origin of tumors, autophagy removes the misfolded proteins and damaged organelles, thus inhibiting oxidative damage and tumorigenesis [7,8]. However, in the advanced stages of tumors, autophagy can confer stress tolerance to chemotherapeutics and hypoxia [9]. In recent years, drugs targeting autophagy have been used to strengthen the effects of chemotherapy drug treatment and have shown promising results [10]. However, the molecular mechanisms of autophagy in GBM warrant further investigation.Long noncoding RNAs (lncRNAs) are a class of newly identified noncoding RNAs that are longer than 200 nucleotides [11]. lncRNAs can bind to mRNAs, microRNAs (miRNAs), DNA and proteins and hence regulate gene expression at the epigenetic, transcriptional, post-transcriptional and translational levels [12]. As a type of noncoding somatic driver, lncRNAs also harbor recurrent indels such as general mRNAs or miRNAs, which may also have oncogenic effects [13]. At present, studies most frequently focus on the epigenetics of lncRNAs. Dysregulated expression of many lncRNAs, such as HOX transcript antisense RNA (HOTAIR) and nuclear enriched abundant transcript 1 (NEAT1), has been implicated in the tumorigenesis and development of GBM because these lncRNAs function as guides, scaffolds, sponges, repressors, and enhancers [13-15]. The lncRNA H19 is abnormally expressed and affects the progression of cancer through various mechanisms, such as acting as a precursor to oncogenic miRNAs (miR-675-5p and miR-675-3p), sequestering anti-tumor miRNAs and modifying cancer epigenetics [16-18]. In glioblastoma, H19 is highly expressed in GBM tissues, associated with a poor prognosis and further promotes GBM progression [19,20]. It is also able to promote the oncogenic characteristics of glioblastoma cells like invasion, angiogenesis and stemness [20], and it is significantly induced in a hypoxic microenvironment where it further activates Hif-1α and binds to miR-181d to promote oncogenic effects [21].In this study, H19 was found to have a potential binding site for the seed sequence of miR-491-5p, which is a well-established tumor suppressor [22-24]. This interaction may be a novel mechanism underlying the oncogenic function of H19 in GBM. Therefore, we hypothesized that H19 promotes proliferation and autophagy during GBM development by regulating miR-491-5p, and miR-491-5p or the autophagy signaling pathway or both are important for H19 to exert its effects in GBM. To validate this hypothesis, several molecular and cellular experiments were designed and performed, and the results were verified in vitro using tumor xenograft-bearing mice.
Materials and methods
Ethics statement
All experiments involving human tissue specimens were performed in accordance with the ethics committee of Nanjing Medical University. The animal experiments were approved by the animal care committee of Nanjing Medical University in compliance with institutional guidelines for the care and use of animals (Fig. S1). This study was in accordance with the 1975 Declaration of Helsinki as revised in 2013.
Human tissue specimens
To determine the expression of H19, miR-491-5p and autophagy-related genes, clinical specimens were obtained from patients with GBM who underwent surgery, and healthy brain tissues were donated from patients undergoing brain tissue resection owing to craniocerebral injury or body donation. All specimens were obtained with informed consent. In addition, no significant difference was found in age (53 ± 6.7 and 55 ± 8.7 years, respectively) and sex (male/female: 12/13 and 15/10, respectively) between patients in the GBM and normal control groups.
Quantitative polymerase chain reaction
Total RNA was extracted and purified using the TRIzol reagent (Invitrogen, USA) and reverse transcribed to complementary DNA (cDNA) using the PrimeScript reverse transcription (RT) reagent kit (Takara, Japan). Quantitative polymerase chain reaction (qPCR) was performed on an ABI 7500 real-time PCR system with SYBR® Green Real-time PCR Master Mix (ABI, USA). The relative expression of target genes was calculated by comparing with the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 using the 2−ΔΔCt method. The primer sequences used are listed in Table 1.
Table 1.
qPCR primer list
Name
Sequence (5’-3’)
H19 primer
F: GATGACAGGTGTGGTCAACG
R: CAGACATGAGCTGGGTAGCA
miR-491-5p primer
F: GGAGTGGGGAACCCTTCC
R: GTGCAGGGTCCGAGGT
U6 primer
F: ACCCTGAGAAATACCCTCACAT
R: GACGACTGAGCCCCTGATG
GAPDH primer
F: GTAACCCGTTGAACCCCATT
R: CCATCCAATCGGTAGTAGCG
Beclin-1 primer
F: ACCGTGTCACCATCCAGGAA
R: GAAGCTGTTGGCACTTTCTGT
ATG5 primer
F: ATGACTAGC-CGGGGGAACACC
R: CCAGTTTACCAT-CACTGCC
qPCR primer list
Cell culture
The GBM cell lines U87 and U251 were purchased from the American Type Culture Collection (ATCC, USA) and cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), streptomycin (100 µg/mL) and penicillin (100 U/mL). All cell lines were maintained at 37°C and 5% CO2 atmosphere. Before the experiment, U87 and U251 cells were cultured and passaged for 14 days.
Construction of lentivirus carrying a short hairpin RNA targeting H19 and H19-knockdown cells
A short hairpin RNA targeting H19 (sh-H19) lentiviral construct was established based on the pLKO.1 vector (Addgene, USA) and subsequently enclosed in HEK293T cells as previously described [25]. After 48 and 72 h, the viral particles were harvested and purified using a high-speed centrifuge. U87 and U251 cells were transfected with the sh-H19 lentivirus for 48 h. The cells were screened using puromycin (3 μg/mL) for continuous 2 weeks, and U87 and U251 cell lines with stably low H19 expression were established.
Transfection of miRNA mimics and antagomir
The miR-491-5p mimic and antagomir were synthesized by GenePharma (Shanghai, China. The miR-491-5p antagomir sequence was 5´-CCUCAUGGAAGGGUUCCCCACU-3´, and the miR-491-5p mimic sequence was 5´-AGUGGGGAACCCUUCCAUGAGG-3´. The miR-491-5p mimic (50 nM) or miR-491-5p antagomir (100 nM) was transfected into cells using Lipofectamine 2000. The cells were transfected with the mimic or antagomir for 48 h and used for further experiments.
Cell counting kit-8 assay
To measure cell viability, exponentially growing cells were transplanted in a 96-well plate (10,000 cells/well). Then the incubation was performed for 12 h. At 0, 12, 24, 48 and 96 h, the cell counting kit-8 (CCK-8) solution was put into each well and the incubation continued for 1 h away from the light. The absorbance of cells in each well was measured at 450 nm using a microplate reader.
Green fluorescent protein–microtubule-associated protein 1 light chain 3 alpha fluorescence
The pEGFP-LC3 plasmid (Addgene, USA) was transiently transfected into U87 and U251 cells as previously described [25]. The cells were fixed, and their nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen, USA). The results were visualized and images were captured using a fluorescence microscope (Nikon, Japan). U87, U251 and the cells with stably low expression of H19 were divided into six groups and treated with phosphate-buffered saline (PBS) or rapamycin, and images were captured using a fluorescence microscope (Echo-labs, USA).
Luciferase activity assay
As reported in a previous study, the original and mutated interacting sequences of miR-491-5p in the H19 sequence were subcloned into the pMir reporter vector and named H19-wt and H19-mut, respectively [21]. The vectors and miR-491-5p mimics were co-transfected into U87 cells using Lipo2000. After 48 h, the relative luciferase activity was measured using a microplate reader (Thermo Fisher Scientific, USA).
RNA pull-down assay
To determine whether miR-491-5p directly interacted with H19, RNA pull-down assay was performed using biotin-labeled H19 as a probe, and miR-491-5p was determined using qPCR. U87 and U251 cells were cross-linked with paraformaldehyde, lysed, sonicated and hybridized using specific biotinylated probes. The subsequent procedure was performed as described in a previous study [26]. The antisense sequence of the H19 probe served as the negative control.
Colony formation assay
U87 and U251 cells were seeded in 6-well plates (3 × 103 cells every well) and subjected to incubation at 37°C and 5% CO2 atmosphere, and the medium was changed every 2 days. The culture was terminated after 14 days, and the clones were fixed with 5% paraformaldehyde for 30 min and subsequently washed thrice with PBS. The fixed cells were stained with 0.1% crystal violet, and the number of clones per well was counted using a method described in a previous study [27].
Flow cytometry
After the cells were transfected with sh-H19 in the absence or presence of rapamycin or miR-491-5p antagomir, they were collected and centrifuged [28]. The cells were washed twice with cold PBS to remove the excessive medium. Subsequently, 2 × 105 cells were collected and suspended in 500 μL of binding buffer. Thereafter, 5 μL of Annexin V-FITC was added, and the cells were incubated at 4°C for 30 min. After the cells were washed with PBS and centrifuged, 5 μL of propidium iodide (PI) was added, mixed and incubated at room temperature for 5 min. The apoptotic rate of cells was determined using flow cytometry (FlowJo version 10.0; FACS CaliburTM, BD, USA).
Western blotting
Cells were treated with the radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, China) containing a protease inhibitor cocktail (Roche, USA). An equal amount of protein samples was separated via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (12% gel) with a running buffer, and the proteins were transferred onto polyvinylidene fluoride membranes using a transfer buffer. Subsequently, the membranes were blocked with 5% fat-free milk for 30 min and probed with primary anti-LC3 (1:1000, Santa Cruz, USA), anti-Beclin-1 (1:2000, ab207612, Abcam), p62 (1:10000, ab109012, Abcam) and anti-β-actin (1:5000, Santa Cruz, USA) antibodies at 4°C for 12 h. The membranes were washed thrice with PBST and incubated with horseradish peroxidase-conjugated (HRP) secondary antibody (1:2000, Santa Cruz, USA) for 1 h at room temperature. The expression of targeted proteins was analyzed using an ECL detection system (Thermo Fisher Scientific, USA) and quantified via densitometry using the ImageJ software.
In vivo experiments
The experiments were partly based on a method described in a previous study [29]. Male BABL/c nude mice aged 6 weeks were purchased from Shanghai Sippr-BK Laboratory Animal Co., Ltd. Briefly, the mice were fed in a specific pathogen-free (SPF) environment and randomly divided into 3 groups (named as sh-NC, sh-H19 and sh-19+ antamiR, respectively; 6 mice per group), and approximately 1 × 107 U87 or sh-H19 U87 cells were subcutaneously injected in their armpit region. After 4 days of injection, 2 nmol of miR-491-5p antagomir was injected into the tumors of the sh-19+ antamiR group. In the following days, the tumors were measured every 7 days. After 5 weeks, the mice were sacrificed via CO2 asphyxiation, and the tumors were used for further experiments including qPCR, western blotting and immunohistochemical (IHC) analysis.
IHC analysis
Tissue sections were deparaffinised, rehydrated with a graded series of alcohols and heated in citrate buffer (10 mM, pH 6.0) at a sub-boiling temperature for 10 min. Thereafter, the sections were blocked with 3% H2O2 and incubated with goat serum, followed by incubation with the primary antibody Ki-67 (ab15580, 1:1000, Abcam) and a secondary antibody (ab205718, 1:2000, Abcam) at room temperature for 2 h and 1 h, respectively. The sections were then stained with diaminobenzidine (DAB) and hematoxylin. After dehydration and mounting, the sections were photographed using a digital microscope camera (OLYMPUS, Japan).
Statistical analysis
Data were analyzed and graphs were generated using GraphPad Prism 8.0. All results were represented as mean ± standard deviation (SD) of at least three independent tests. Pearson’s correlation analysis was used to analyze the correlation between two genes. The Student’s t-test was used for comparing two groups, whereas one-way analysis of variance followed by Tukey’s post hoc test was used for comparing multiple groups. A P-value of <0.05 (* or #), 0.01 (** or ##) and 0.001 (*** or ###) indicated significant differences.
Results
In this study, we speculated that reduced expression of miR-491-5p in GBM mediates the oncogenic function of H19, including its promotive effects on autophagy. To validate this speculation, we examined the association among H19, miR-491-5p and autophagy-related genes by measuring their expression at different levels, assessed the effects of H19 knockdown on cell proliferation and apoptosis and evaluated the rescuing effects of possible mediators.
H19 is highly expressed in GBM and positively correlated with autophagy-related genes
The differential expression profile of H19 in GBM was analyzed using qRT-PCR. The results demonstrated that H19 expression was significantly higher in GBM than in healthy control tissues (Figure 1a). The expression levels of the autophagy-related genes MAP1LC3A (LC3) and BECN1 (Beclin1) were also analyzed in GBM and healthy control tissues. Compared with healthy control tissues, GBM tissues had significantly high expression of MAP1LC3A and BECN1 (Figure 1(b–c)). The correlation of H19 with MAP1LC3A and BECN1 was analyzed via linear regression, revealing that H19 expression was significantly positively correlated with MAP1LC3A and BECN1 in GBM and healthy control tissues (Figure 1(d–e)).
Figure 1.
Expression levels of H19, MAP1LC3A (LC3) and Beclin-1 (BECN1) in GBM and the association among them. (a) H19 expression in GBM and normal tissues was detected via qPCR; (b, c) The expression of MAP1LC3A and BECN1 in GBM and normal tissues was measured via qPCR; (d) Correlation analysis of H19 and MAP1LC3A; (e) Correlation analysis of H19 and BECN1. ***P < 0.001, compared with normal tissues.
Expression levels of H19, MAP1LC3A (LC3) and Beclin-1 (BECN1) in GBM and the association among them. (a) H19 expression in GBM and normal tissues was detected via qPCR; (b, c) The expression of MAP1LC3A and BECN1 in GBM and normal tissues was measured via qPCR; (d) Correlation analysis of H19 and MAP1LC3A; (e) Correlation analysis of H19 and BECN1. ***P < 0.001, compared with normal tissues.
H19 promotes the proliferation and inhibits the apoptosis of GBM cells
To investigate the role of H19 in GBM progression, the sh-H19 lentivirus was constructed and U87 and U251 cell lines with low H19 expression were established. The inhibition efficiency was confirmed via qRT-PCR (Figure 2a). CCK-8 and colony formation assays demonstrated that the proliferation of GBM cells was significantly lower in H19-knockdown U87 or U251 cells than in the control group (Figure 2(b,c)). Moreover, H19 knockdown significantly increased the apoptotic rates of U87 and U251 cells (Figure 2d). These findings suggest that increased H19 expression in GBM promotes the proliferation and inhibits the apoptosis of tumor cells.
Figure 2.
Effects of H19 knockdown on the viability, proliferation and apoptosis of GBM cells. (a) qPCR analysis for analyzing the efficiency of H19 knockdown; (b) CCK-8 assay for analyzing cell viability in the sh-H19 and sh-NC groups; (c) Colony formation assay for analyzing cell proliferation in the sh-H19 and sh-NC groups; (d) Flow cytometry for analyzing cell apoptosis in the sh-H19 and sh-NC groups. *P< 0.05, **P < 0.01, ***P < 0.001, compared with the sh-NC group.
Effects of H19 knockdown on the viability, proliferation and apoptosis of GBM cells. (a) qPCR analysis for analyzing the efficiency of H19 knockdown; (b) CCK-8 assay for analyzing cell viability in the sh-H19 and sh-NC groups; (c) Colony formation assay for analyzing cell proliferation in the sh-H19 and sh-NC groups; (d) Flow cytometry for analyzing cell apoptosis in the sh-H19 and sh-NC groups. *P< 0.05, **P < 0.01, ***P < 0.001, compared with the sh-NC group.
H19 promotes proliferation and inhibits apoptosis via autophagy
A study demonstrated that H19 inhibited the progression of autophagy in cardiomyocyte cells [30]. In this study, H19 expression was found to be positively associated with MAP1LC3A and BECN1, which demonstrated that H19 might regulate the activity of autophagy. A rescue study was performed to determine whether H19 promotes GBM progression via autophagy, in which rapamycin was used as an autophagy agonist. The results of CCK-8 and colony formation assays demonstrated that rapamycin could rescue the inhibitory effects of H19 knockdown on the proliferation of GBM cells (Figure 3(a–b)). In addition, the promoting effects of H19 knockdown on apoptosis were significantly hindered by rapamycin in U87 and U251 cells (Figure 3c). Furthermore, western blotting was used to investigate the effects of H19 on the autophagy signaling pathway. The relative levels of the autophagy markers Beclin-1 and the LC3-II/LC3-I ratio were markedly decreased after H19 knockdown; however, the decreased levels were reversed after rapamycin treatment (Figure 3d). The expression of p62, a substrate molecule in autophagy, was increased owing to the inhibition of autophagy induced by H19 knockdown; however, its expression was reduced after autophagy was reactivated by rapamycin (Figure 3d). In addition, a green fluorescent protein–microtubule-associated protein 1 light chain 3 alpha (GFP-LC3) vector was used to evaluate the LC3 puncta in GBM cells. GFP-LC3 fluorescence images demonstrated that H19 knockdown decreased the number of GFP-LC3 puncta in the sh-H19 group as compared with the control shRNA (sh-NC) group; however, the results were reversed after rapamycin treatment (Figure 3e). Therefore, these results suggest that H19 promotes GBM progression by activating the autophagy signaling pathway.
Figure 3.
Inhibitory effects of H19 knockdown on the growth and autophagy of GBM cells were reversed by rapamycin. (a) CCK-8 and colony formation assays for detecting the proliferation ability of GBM cells in the sh-NC, sh-H19 and sh-H19+ rapamycin groups; (b) Colony formation assay for detecting the proliferation of GBM cells in each group; (c) Flow cytometry for detecting apoptosis in the sh-NC, sh-H19 and sh-H19+ rapamycin groups; (d) Western blotting for analyzing the expression of Beclin-1, p62, LC3-I and LC3-II in GBM cells in the sh-NC, sh-H19 and sh-H19+ rapamycin groups. (e) GFP-LC3 fluorescence analysis for detecting the LC3 positive structure and autophagy activity in the sh-NC, sh-H19 and sh-H19+ rapamycin groups. **P < 0.01, ***P < 0.001, compared with the sh-NC group; ##P < 0.01, ###P < 0.001, compared with the sh-H19 group; scale bar = 5 μm.
Inhibitory effects of H19 knockdown on the growth and autophagy of GBM cells were reversed by rapamycin. (a) CCK-8 and colony formation assays for detecting the proliferation ability of GBM cells in the sh-NC, sh-H19 and sh-H19+ rapamycin groups; (b) Colony formation assay for detecting the proliferation of GBM cells in each group; (c) Flow cytometry for detecting apoptosis in the sh-NC, sh-H19 and sh-H19+ rapamycin groups; (d) Western blotting for analyzing the expression of Beclin-1, p62, LC3-I and LC3-II in GBM cells in the sh-NC, sh-H19 and sh-H19+ rapamycin groups. (e) GFP-LC3 fluorescence analysis for detecting the LC3 positive structure and autophagy activity in the sh-NC, sh-H19 and sh-H19+ rapamycin groups. **P < 0.01, ***P < 0.001, compared with the sh-NC group; ##P < 0.01, ###P < 0.001, compared with the sh-H19 group; scale bar = 5 μm.
H19 regulates the level of miR-491-5p through direction interaction
The downstream signaling pathway of H19 in the progression of GBM was further investigated. The Encyclopedia of RNA Interactomes (ENCORI) database (http://starbase.sysu.edu.cn/) was used to search the possible miRNA candidates of H19, followed by literature mining to identify candidate miRNAs with known oncogenic effects in human cancers [31-33]. Subsequently, human miR-491-5p was identified as a possible downstream competing candidate for H19. H19 could bind to specific sites including the seed region of miR-491-5p to exert its antagonistic effects on miR-491-5p (Figure 4a). The result of RNA pull-down assay showed that miR-491-5p was enriched by H19 (Figure 4b), and the luciferase reporter assay validated that H19 could bind to miR-491-5p in U87 cells (Figure 4c). Furthermore, the expression of miR491-5p was significantly downregulated in GBM tissues and was negatively correlated with H19 (Figure 4(d–e)). In addition, the expression of miR-491-5p was higher in H19-knockdown cells than in parental U87 and U251 cells (Figure 4f).
Figure 4.
Prediction and validation of the interaction between H19 and miR-491-5p. (a) The binding sites of miR-491-5p and H19 were predicted using the ENCORI database; (b) RNA pull-down assay using a biotin-labeled H19 probe was performed, and miR-491-5p expression was measured via qPCR to analyze the direct interaction between H19 and miR-491-5p; anti-H19: antisense of the H19 probe (negative control), H19: H19 probe; (c) Validation of the binding between H19 and miR491-5p in U87 cells was performed via dual-luciferase reporter assay; (d) qPCR analysis was performed to analyze miR-491-5p expression in GBM and normal tissues; (e) Correlation analysis of miR-491-5p and H19 in GBM and normal tissues; (f) qPCR was performed to detect the level of miR-491-5p in response to H19 knockdown in U87 and U251 cells. **P < 0.01, ***P < 0.001, compared with mimic-NC, normal tissues or sh-NC.
Prediction and validation of the interaction between H19 and miR-491-5p. (a) The binding sites of miR-491-5p and H19 were predicted using the ENCORI database; (b) RNA pull-down assay using a biotin-labeled H19 probe was performed, and miR-491-5p expression was measured via qPCR to analyze the direct interaction between H19 and miR-491-5p; anti-H19: antisense of the H19 probe (negative control), H19: H19 probe; (c) Validation of the binding between H19 and miR491-5p in U87 cells was performed via dual-luciferase reporter assay; (d) qPCR analysis was performed to analyze miR-491-5p expression in GBM and normal tissues; (e) Correlation analysis of miR-491-5p and H19 in GBM and normal tissues; (f) qPCR was performed to detect the level of miR-491-5p in response to H19 knockdown in U87 and U251 cells. **P < 0.01, ***P < 0.001, compared with mimic-NC, normal tissues or sh-NC.
H19 promotes GBM progression and autophagy by sponging miR-491-5p
The tumor suppressive effects of miR-491-5p were preliminarily investigated, and it was observed that the miR-491-5p mimic significantly reduced absorption at 450 nm in both U87 and U251 cells (Fig. S2). To investigate whether H19 regulated the cell phenotype and autophagy signaling pathway by sponging miR-491-5p, rescue experiments using a miR-491-5p antagomir (named antimir) were performed. The increase in miR-491-5p expression induced by H19 knockdown was reversed after the experiments (Figure 5a). CCK-8 and colony formation assays demonstrated that the inhibition of cell growth (viability and proliferation) induced by sh-H19 was reversed after silencing miR-491-5p in U87 and U251 cells (Figure 5(b,c)). In addition, flow cytometry revealed that the increase in the apoptotic rates induced by sh-H19 was partly but significantly reversed after miR-491-5p inhibition (Figure 5d). Western blotting further indicated that miR-491-5p mimic effectively impeded sh-H19-induced inhibition of autophagy (Figure 5e). Altogether, these results indicated that H19 promoted cell proliferation, inhibited cell apoptosis and activated autophagy mainly by downregulating miR-491-5p in GBM cells.
Figure 5.
miR-491-5p overexpression disturbed the inhibitory effects of sh-H19 on the malignancy and autophagy of GBM cells in vitro. (a) qPCR was performed to detect the level of miR-491-5p in response to sh-H19 and miR-491 antagomir in U87 and U251 cells; (b) CCK-8 assay was performed to analyze the effects of sh-H19 and miR-491 antagomir on the viability of U87 and U251; (c) Colony formation assay was performed to analyze the effects of sh-H19 and miR-491 antagomir on the proliferation of U87 and U251 cells; (d) Flow cytometry was performed to analyze the apoptotic rate of cells in each group; (e) Western blotting was performed to analyze the expression of Beclin-1, p62, LC3-I and LC3-II in U87 and U251 cells. **P < 0.01, ***P < 0.001, compared with the sh-NC group; ##P < 0.01, ###P < 0.001, compared with the sh-H19 group; antamiR: miR-491-5p antagomir.
miR-491-5p overexpression disturbed the inhibitory effects of sh-H19 on the malignancy and autophagy of GBM cells in vitro. (a) qPCR was performed to detect the level of miR-491-5p in response to sh-H19 and miR-491 antagomir in U87 and U251 cells; (b) CCK-8 assay was performed to analyze the effects of sh-H19 and miR-491 antagomir on the viability of U87 and U251; (c) Colony formation assay was performed to analyze the effects of sh-H19 and miR-491 antagomir on the proliferation of U87 and U251 cells; (d) Flow cytometry was performed to analyze the apoptotic rate of cells in each group; (e) Western blotting was performed to analyze the expression of Beclin-1, p62, LC3-I and LC3-II in U87 and U251 cells. **P < 0.01, ***P < 0.001, compared with the sh-NC group; ##P < 0.01, ###P < 0.001, compared with the sh-H19 group; antamiR: miR-491-5p antagomir.Furthermore, the potential targets of miR-491-5p were investigated to identify more related molecules involved in the regulation of autophagy by H19 in GBM cells. On overlapping autophagy-related genes from the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database and the predicted target genes of miR-491-5p using TargetScan, endoplasmic reticulum-to-nucleus signaling 1 (ERN1) was identified as a related gene (Fig. S3).
H19 promotes GBM cell progression and autophagy in vivo
We further validated the role of H19 in GBM progression and investigated whether miR-491-5p could reverse H19-induced progression of GBM in vivo. sh-H19 or shNC-infected U87 cells were injected into nude mice. The subcutaneous tumor formation experiments demonstrated that H19 knockdown significantly inhibited the growth of subcutaneous tumors, whereas co-inhibition of H19 and miR-491-5p with sh-H19 and miR-491-5p antagomir (antamiR) reversed the inhibition of GBM progression induced by sh-H19 in vivo (Figure 6(a–c)). IHC staining for Ki-67 demonstrated that the inhibitory effects of sh-H19 on proliferation were reversed after co-inhibition of miR-491-5p (Figure 6d). In addition, western blotting of Beclin-1, p62, LC3-I and LC3-II proteins demonstrated that H19 knockdown inhibited the autophagy signaling pathway; however, the inhibition was reversed by inhibiting miR-491-5p (Figure 6e). Therefore, these results suggest that H19 is involved in activating the autophagy signaling pathway and promoting the progression of GBM by regulating miR-491-5p both in vitro and in vivo.
Figure 6.
Suppressed miR-491-5p antagonized the anti-tumor and anti-autophagy effects of sh-H19 in vivo. (a) Tumor xenograft size in each group; (b, c) Quantitative analysis of the volume and weight of the tumor xenograft; (d) IHC analysis of Ki-67 in the GBM tissues generated with cells with various treatments; (e) Western blotting for analyzing the expression of Beclin-1, p62, LC3-I and LC3-II in the three groups of xenografts. **P < 0.01, ***P < 0.001, compared with the sh-NC group; #P < 0.05, ##P < 0.01, ###P < 0.001, compared with the sh-H19 group.
Suppressed miR-491-5p antagonized the anti-tumor and anti-autophagy effects of sh-H19 in vivo. (a) Tumor xenograft size in each group; (b, c) Quantitative analysis of the volume and weight of the tumor xenograft; (d) IHC analysis of Ki-67 in the GBM tissues generated with cells with various treatments; (e) Western blotting for analyzing the expression of Beclin-1, p62, LC3-I and LC3-II in the three groups of xenografts. **P < 0.01, ***P < 0.001, compared with the sh-NC group; #P < 0.05, ##P < 0.01, ###P < 0.001, compared with the sh-H19 group.
Discussion
Previous studies have demonstrated that lncRNAs play diverse roles in regulating gene transcription, post-transcription modifications, translation and epigenetic modifications. Aberrant expression or dysfunction of lncRNAs is closely associated with various diseases, especially cancer [34]. The lncRNA H19 is associated with the progression of various cancers [35]. A study demonstrated that the lncRNA H19 rs217727 polymorphism was significantly associated with cancer risk in allelic, homozygous, heterozygote dominant and recessive models [36,37]. In addition, H19 expression is associated with the recurrence-free survival of patients with esophageal squamous cell cancer, and H19 serves as a marker of response to neoadjuvant chemotherapy in breast cancer [38,39]. Studies on the molecular mechanisms of H19 have reported that H19 promotes the progression of breast, hepatocellular and nasopharyngeal cancers by promoting proliferation and invasion or inhibiting apoptosis by sponging various miRNAs [40-42]. H19 is highly expressed in GBM cells, especially predominantly enriched in the cytoplasmic and nuclear region, and promotes tumorigenicity and stemness in U87 and U251 cells; however, the regulatory mechanisms of H19 underlying the progression of GBM remain unclear [43-45]. In this study, H19 was found to promote the proliferation and inhibit the apoptosis of GBM cells in vitro and in vivo.Autophagy is an intracellular degradative process in response to numerous stressful conditions, including organelle damage, hypoxia, the development of abnormal proteins and nutrient deprivation [46]. In rapidly growing solid tumors such as GBM, hypoxia and nutrient deprivation are the major microenvironmental factors for growth [47]. Enhanced autophagy allows GBM cell survival by maintaining energy production, thus leading to tumor growth and therapeutic resistance during hypoxia. Enhanced autophagy results from both silencing of autophagy-suppressive genes and activation of autophagy-promoting genes. For example, ribosomal protein L5 (RPL5) can suppress autophagy; however, its expression level is quite low in GBM [48,49]. Moreover, high expression of LC3 or Beclin-1 is associated with a poor prognosis in patients with glioma [50].In this study, GBM cells were transfected with the GFP-LC3 vector to observe autophagy initiation. The fusion protein GFP-LC3 allows the measurement of autophagy initiation through the evaluation of LC3 dots or puncta in cells [51,52]. GFP-LC3 and intrinsic LC3 have different effects on autophagy. However, in some situations, they are similar or the same. For example, GFP-LC3 expression has little or no effect on autophagy in the liver, lung and spleen, which is the same effect exerted by LC3 expression [53]. GFP-LC3-I is converted to GFP-LC3-II in the same way as endogenous LC3, GFP-LC3-II only localizes to autophagic membranes and endogenous LC3-II may localize in autophagosomes and autolysosomes [53,54]. In addition, GFP-LC3 increases both LC3-I and LC3-II levels [53]. Despite some differences, GFP-LC3 behaves in a similar or the same way as endogenous LC3 for monitoring the early stages of autophagy [55,56]. Therefore, extrinsic GFP-LC3 alone may still not reflect the actual entire process of autophagy [55]. In this study, GFP fluorescence labeling of LC3 and western blotting of Beclin-1, LC3 and endogenous p62 revealed an association between H19 and autophagy in GBM.Furthermore, studies have reported that the lncRNA H19 participates in the regulation of the autophagy signaling pathway. In a mouse model of acute myocardial infarction, overexpression of H19 reduced the infarct size and improved cardiac function by activating autophagy. In addition, H19 promotes the autophagy signaling pathway in acute myocardial infarction via the distinct subgroup of the Ras family member 3/mammalian target of rapamycin (DIRAS3/mTOR) signaling pathway [30,57]. However, the promotion of autophagy by H19 induces tamoxifen or 5-Fu resistance in breast and colorectal cancers [58,59]. In this study, elevated expression of H19 in GBM cells was positively correlated with the autophagy-related genes MAP1LC3A and BCEN1 and promoted autophagic initiation and autophagic degradation. Furthermore, H19 knockdown in U87 and U251 cells promoted the proliferation and inhibited the apoptosis of GBM cells by inhibiting the autophagy signaling pathway. However, the inhibition was reversed after rapamycin treatment, indicating that H19 promotes GBM progression by activating autophagy.Recent studies have revealed that lncRNAs may act as competing endogenous RNAs by sponging the targeted miRNAs and promoting the expression of downstream mRNAs. In this study, H19 regulated GBM progression by sponging miR-491-5p. miR-491-5p inhibits GBM progression by targeting genes such as epidermal growth factor receptor (EGFR), cell division protein kinase 6 (CDK6), matrix metallopeptidase 9 (MMP9) and B-cell lymphoma-extra-large (Bcl-xL and BCL2L1). In addition, studies have demonstrated that miR-491-5p knockdown promotes cell proliferation in primary Ink4a-Arf-null mouse glial apoptosis progenitor cells [32,60]. However, another study reported that miR-491 could inhibit glioma development by inhibiting the Wnt signaling pathway [61]. In this study, the luciferase assay validated that H19 could bind to miR-491-5p and inactivate miR-491-5p. H19 knockdown in U87 and U251 cells promoted the expression of miR-491-5p, indicating that miR-491-5p is regulated by H19. H19 silence supressed the proliferation and enhanced the apoptosis of GBM cells; however, this phenotype was reversed after miR-491-5p knockdown. In addition, H19 knockdown inhibited GBM progression by inhibiting autophagy. Consistent with the results of this study, miR-491-5p inhibited cisplatin resistance in gastric cancer cells by targeting calpain small subunit 1 (CAPNS1) [62]. Furthermore, autophagy-related genes warrant in-depth investigation. miR-491-5p can inhibit the autophagy signaling pathway by targeting insulin-like growth factor 2 (IGF2) [63]. This downregulated miRNA may also participate in autophagy in GBM by regulating the MAPK, PI3K/Akt and mTOR pathways [64,65]. ERN1, the potential target of miR-491-5p identified in this study, is associated with autophagy. Recent studies have reported that ERN1 may inactivate mTOR, mediate pro-survival autophagy and suppress autophagic death in cancer cells [66-68]. Therefore, H19 can promote GBM progression by inhibiting miR-491-5p and activating the autophagy signaling pathway.
Conclusion
H19 can promote GBM progression by regulating proliferation and apoptosis by activating the autophagy signaling pathway; in addition, it can regulate autophagy at least partly by sponging miR-491-5p in GBM cells. These findings indicate that H19 may be a therapeutic target for GBM; however, the clinical significance of H19 and other related genes involved in autophagy regulated by H19 require further investigation.Click here for additional data file.