Salvianolic acid A (Sal A) suppresses malignant progression of glioma and enhances temozolomide (TMZ) sensitivity via repressing transgelin-2 (TAGLN2) mediated phosphatidylinositol-3-kinase (PI3K) / protein kinase B (Akt) pathway.

Glioma originated from excessively proliferative and highly invaded glial cells is a common intracranial malignant tumor with poor prognosis. Resistance to temozolomide (TMZ) is a clinical challenge in glioma treatment due to the fact that chemoresistance remains a main obstacle in the improvement of drug efficacy. Salvianolic acid A (Sal A), originated from traditional Chinese herbal medicine Salvia miltiorrhiza, possesses anti-tumor effects and could facilitate the delivery of drugs to brain tumor tissues. In the present work, effects of Sal A on the viability, proliferation, migration, invasion and apoptosis of human glioma cell line U87 cells as well as influence of Sal A on TMZ resistance were measured, so as to identify the biological function of Sal A in the malignant behaviors and chemoresistance of glioma cells. Additionally, activation of TAGLN2/PI3K/Akt pathway in glioma cells was also detected to investigate whether Sal A could regulate TAGLN2/PI3K/Akt to manipulate the progression of glioma and TMZ resistance. Results discovered that Sal A treatment reduced the viability, repressed the proliferation, migration and invasion of glioma cells as well as promoted the apoptosis of glioma cells. Besides, Sal A treatment suppressed TAGLN2/PI3K/Akt pathway in glioma cells. Sal A treatment strengthened the suppressing effect of TMZ on glioma cell proliferation and reinforced the promoting effect of TMZ on glioma cell apoptosis, which were abolished by upregulation of TAGLN2. To conclude, Sal A treatment could suppress the malignant behaviors of glioma cells and improve TMZ sensitivity through inactivating TAGLN2/PI3K/Akt pathway.

Highlights

Sal A treatment suppresses the malignant behaviors of glioma cells.

Sal A treatment represses TAGLN2/PI3K/Akt pathway in glioma cells.

Sal A may improve TMZ sensitivity by inactivating TAGLN2/PI3K/Akt pathway.

Sal A maybe a promising drug for glioma treatment.

TAGLN2/PI3K/Akt pathway might serve as therapeutic targets for glioma.

Introduction

Cerebral glioma is a common intracranial malignant tumor with a poor clinical prognosis and it is originated from excessively proliferative and highly invaded glial cells [1]. Surgical resection or adjuvant radiotherapy and chemotherapy are conventional therapies for gliomas [2]. Body mass index (BMI) of glioma patients receiving conventional therapies significantly decreased, so nutritional nursing is of great significance to improve the prognosis of patients. Nowadays, temozolomide (TMZ) has become one of the most commonly used drugs for glioma chemotherapy [3]. However, the therapeutic effect of TMZ on glioma is largely limited by rapid drug resistance and almost all patients will develop disease or relapse, resulting in a median patient survival of 14.6 months [4,5]. Hence, it is in urgent need to resolve the occurrence of drug resistance in glioma for clinical treatment.

Transgelin-2 (TAGLN2) is an essential actin-binding protein widely expressed in human tissues and organs [6]. The direct role of TAGLN2 in a variety of biological functions depends on its regulation of cytoskeleton and actin binding process [7]. Recent studies have collectively pointed out the significance of TAGLN2 dysregulation in the occurrence and development of certain malignancies [8,9]. Importantly, it has been verified that TAGLN2 is high expressed in glioma tissues and is closely associated with tumor grade and prognosis in patients. Besides, silencing of TAGLN2 can markedly repress the growth and invasion of glioma in vitro and in vivo [10].

Phosphatidylinositol-3-kinase (PI3K) /protein kinase B (Akt) signaling pathway has been widely reported to be involved in the occurrence and development of tumors [11,12]. Also, emerging evidence has manifested that PI3K/Akt signaling is implicated in the progression of glioblastoma and chemoresistance in glioblastoma cells [13,14]. Additionally, TAGLN2 is able to participate in the malignant processes of meningioma through regulating PI3K/Akt signaling pathway [15].

Traditional Chinese herbal plant Salvia miltiorrhiza is the source of salvianolic acid A (Sal A), a water-soluble component that possesses anti-oxidative, anti-inflammatory and other therapeutic benefits [16,17]. For instance, Sal A exerts cardioprotective effects on acute myocardial infarction [18]. Sal A could suppress tumor-associated angiogenesis via inhibition of GRP78 secretion [19]. Meanwhile, Sal A exhibits inhibitory effects on tumor growth and metastasis by suppressing angiogenesis and degradation of extracellular matrix [20-22]. In addition, Zhang et al. [23] have confirmed that Sal A could facilitate the delivery of drugs to brain tumor tissues. Yet, the impact of Sal A on the malignant process of glioma and chemoresistance remains poorly understood.

In the present work, the effects of Sal A on proliferation, migration, invasion and apoptosis of glioma cells as well as the influence of Sal A on TMZ resistance were assessed, so as to demonstrate the biological function of Sal A in the malignant progression of glioma. Besides, activation of TAGLN2/PI3K/Akt signaling pathway in glioma was also detected to expound the underlying molecular mechanism. This work devoted to excavate the predictive values of Sal A and TAGLN2/PI3K/Akt signaling pathway in glioma treatment and to provide references for rational use clinically.

Materials and methods

Cell culture

Human glioma cell line U87 was purchased from the Cell Bank of Chinese Academy of Sciences and cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, NY, USA), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco, NY, USA) at 37°C with 5% CO2.

Cell treatment

U87 cells were treated with Sal A (0, 5, 10, 15, 20, 25, 50 and 100 μM; Solarbio, Beijing, China) and/or TMZ (100 μM; Solarbio, Beijing, China) for 24 h or 48 h.

Cell transfection

For upregulation of TAGLN2, pcDNA3.1 vector overexpressing TAGLN2 (Ov-TAGLN2) and the corresponding empty vector (Ov-NC) were synthesized by GenePharma (Shanghai, China). Lipofectamine 2000 (Invitrogen, CA, USA) was applied to conduct transfection in accordance with the manufacturer’s protocol.

Cell counting kit-8 (CCK-8) assay

CCK-8 assay was employed to estimate cell viability. U87 cells receiving the designed treatment were seeded into 96-well plates (5 × 103 cells/well) and cultured in a standard atmosphere. Subsequently, 10 µl of CCK-8 solution (Beyotime, Shanghai, China) was added into each well for 2-h incubation. Absorbance at 450 nm was recorded by a microplate reader (Bio-Rad, CA, USA).

5-Ethynyl-2´-deoxyuridine (EdU) staining

EdU staining was employed to estimate cell proliferation. U87 cells were fixed with 4% paraformaldehyde and then permeabilized in 0.05% Triton X-100 for 10 min. After washing thrice with PBS, cells were incubated with EdU working solution for 30 min in the dark and then stained with DAPI for 10 min in the dark. EdU-stained cells were captured and counted under a fluorescent microscope (magnification, ×200; Olympus, Tokyo, Japan).

TdT-mediated dUTP-FITC nick end-labeling (TUNEL) staining

TUNEL staining was employed to estimate cell apoptosis. TUNEL Apoptosis Detection kit (R&D Systems, MN, USA) was utilized to assess the apoptosis of U87 cells. In brief, U87 cells were fixed with 4% paraformaldehyde and then permeabilized in 0.05% Triton X-100 for 10 min. Subsequently, cells were incubated with TUNEL reaction solution for 1 h at 37°C in the dark and then stained with DAPI for 10 min in the dark. TUNEL-positive cells were captured and counted under a fluorescent microscope (magnification, ×200; Olympus, Tokyo, Japan).

Wound healing assay

Wound healing assay was employed to estimate the migratory ability of U87 cells. U87 cells were seeded in 6-well plates (4 × 105 cells/well) and cultured until 90% confluence. A 200-µl pipette tip was then used to create a ‘wound’ on the cell monolayer. The detached cells were washed twice with PBS. Serum-free medium was added to the plates and cultured for 48 h. Images of the wounds were captured at 0 and 48 h under a light microscope (magnification, ×100; Leica, Wetzlar, Germany).

Transwell assay

Transwell assay was employed to estimate the invasive ability of U87 cells. U87 cells (5 × 104) re-suspended in serum-free medium were grown in the upper chambers of Transwell inserts (BD Biosciences, CA, USA) precoated with Matrigel (Solarbio, Beijing, China). Meanwhile, 600 μl of complete medium was added into the lower chambers. Cells that had invaded during 48 h of incubation were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet (Sigma-Aldrich, MO, USA). Stained cells were imaged and counted under a light microscope (magnification, ×100; Leica, Wetzlar, Germany).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

TRIzol reagent (Invitrogen, CA, USA) was employed to extract total RNA from U87 cells in compliance with the manufacturer’s instructions. RNA was reversely transcribed into cDNA by employing PrimeScript RT Master Mix (Takara, Dalian, China) according to the manufacturer’s protocol. PCR amplifications were conducted using an SYBR-Green master mix kit (Takara, Tokyo, Japan) on ABI 7500 system (Applied Biosystems, CA, USA). GAPDH served as an internal control. PCR conditions were as follows: 95°C for 10 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec. The primer sequences for PCR assay: TAGLN2 forward, 5´- ATCACCACCCAGTGCCGAAAG −3´ and reverse, 5´- CATGGTGGAGGCCTGGATCTT −3´; GAPDH forward, 5´- GAAGGTGAAGGTCGGAGTC −3´ and reverse, 5´- GAAGATGGTGATGGGATTTC −3´. The 2−ΔΔCt method was applied to calculate mRNA levels.

Western blot analysis

Radio-immunoprecipitation assay buffer (Beyotime, Shanghai, China) was utilized to extract total protein from U87 cells in compliance with the manufacturer’s instructions. Protein concentration of each sample was determined using BCA method. Equal amount of protein samples were subjected to SDS-PAGE and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, MA, USA). After blocking with 5% BSA for 1 h, PVDF membranes were incubated at 4°C overnight with primary antibodies against Bcl-2 (Abcam, ab196495, 1:2000), Bax (Abcam, ab53154, 1:1000), TAGLN2 (Abcam, ab121146, 1:1000), p-PI3K (Abcam, ab182651, 1:1000), PI3K (Abcam, ab86714, 1:1000), p-Akt (Abcam, ab38449, 1:1000), Akt (Abcam, ab179463, 1:1000) and GAPDH (Abcam, ab181602, 1:10,000). On the second day, TBST-washed membranes were subsequently incubated with the horseradish peroxidase-conjugated secondary antibody for 1.5 h at room temperature. GAPDH served as an internal control. Protein signals were visualized using electrochemiluminescence (ECL; Beyotime, Shanghai, China) method. Protein bands were analyzed using Image J software.

Statistical analysis

Each experiment was performed in triplicate. Experimental data were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test and presented as mean values ± standard deviation (SD). P < 0.05 suggests differences with statistical significance.

Results

Sal A treatment reduces the viability and represses the proliferation of glioma cells

U87 cells were treated with 0, 5, 10, 15, 20, 25, 50 and 100 μM Sal A for 24, 48 h. It was observed that Sal A treatment led to a dose-dependent decline in the viability of U87 cells (Figure 1(a)). Then, treatment with 0, 25, 50 and 100 μM Sal A for 24 h was selected for subsequent experiments according to results above. EdU staining was employed to assess cell proliferative ability. A decrease of EdU-positive U87 cells suggested that Sal A treatment inhibited the proliferation of U87 cells (Figure 1(b)).

Figure 1.

Sal A treatment reduces the viability and represses the proliferation of glioma cells. (a) U87 cells were treated with 0, 5, 10, 15, 20, 25, 50 and 100 μM Sal A for 24, 48 h. CCK-8 assay for determination of cell viability. (b) U87 cells were treated with 0, 25, 50 and 100 μM Sal A for 24 h. EdU staining for determination of cell proliferation. ** p < 0.01, *** p < 0.001.

Sal A treatment suppresses the migration and invasion of glioma cells

Results of wound healing and transwell assays illustrated the potential effects of Sal A on glioma cell migration and invasion. Treatment with Sal A diminished the migratory ability (Figure 2(a, b)) as well as the invasive property (Figure 2(c, d)) of U87 cells in a dose-dependent manner.

Figure 2.

Sal A treatment suppresses the migration and invasion of glioma cells. U87 cells were treated with 0, 25, 50 and 100 μM Sal A for 24 h. (a, b) Wound healing assay for determination of cell migration. (c, d) Transwell assay for determination of cell invasion. * p < 0.05, ** p < 0.01, *** p < 0.001.

Sal A treatment promotes the apoptosis of glioma cells

TUNEL staining was utilized to determine the apoptosis of glioma cells. Cell apoptosis manifested as the number of TUNEL positive cells was extremely increased in Sal A-treated U87 cells indicated that Sal A treatment boosted the apoptosis of U87 cells (Figure 3(a, b)). Additionally, expressions of anti-apoptotic protein Bcl-2 and pro-apoptotic protein Bax were detected to evaluate cell apoptosis. Dose-dependent reduction of Bcl-2 expression and elevation of Bax expression further confirmed the promoting effect of Sal A on the apoptosis of glioma cells (Figure 3(c)).

Figure 3.

Sal A treatment promotes the apoptosis of glioma cells. U87 cells were treated with 0, 25, 50 and 100 μM Sal A for 24 h. (a, b) TUNEL staining for determination of cell apoptosis. (c) Western blot analysis for determination of expressions of Bcl-2 and Bax. *** p < 0.001.

Sal A treatment represses TAGLN2/PI3K/Akt pathway in glioma cells

To probe the mechanistic basis of Sal A’s anti-tumor activity in glioma, the activation of TAGLN2/PI3K/Akt pathway after Sal A treatment was measured. Dose-dependently decreased expressions of TAGLN2, p-PI3K and p-Akt in Sal A-treated U87 cells suggested that Sal A treatment inactivated TAGLN2/PI3K/Akt pathway in glioma cells (Figure 4).

Figure 4.

Sal A treatment represses TAGLN2/PI3K/Akt pathway in glioma cells. U87 cells were treated with 0, 25, 50 and 100 μM Sal A for 24 h. Western blot analysis for determination of expressions of TAGLN2, p-PI3K, PI3K, p-Akt and Akt. *** p < 0.001.

Sal A treatment improves TMZ sensitivity by inactivating TAGLN2/PI3K/Akt pathway in glioma cells

It was observed that treatment with 100 μM TMZ repressed the viability of U87 cells. Moreover, Sal A treatment further reduced the viability of U87 cells exposed to TMZ in a dose-dependent manner (Figure 5(a)). Subsequently, Ov-TAGLN2 was introduced into U87 cells to upregulate TAGLN2 expression (Figure 5(b)). Increased expressions of TAGLN2, p-PI3K and p-Akt upon upregulation of TAGLN2 evidenced that the repressing effect of co-treatment with Sal A and TMZ on TAGLN2/PI3K/Akt pathway was abrogated by Ov-TAGLN2 (Figure 5(c)). Moreover, Sal A treatment strengthened the suppressing effect of TMZ on the viability of U87 cells, which was abolished by upregulation of TAGLN2 (Figure 6(a)). In addition, Sal A treatment increased TUNEL-positive U87 cells exposed to TMZ, reinforcing the pro-apoptosis effect of TMZ on glioma cells. The strengthened apoptotic capacity of TMZ-treated U87 cells caused by Sal A was partially abrogated upon TAGLN2 overexpression (Figure 6(b, c)). To sum up, Sal A treatment enhanced TMZ sensitivity to glioma cells by inactivating TAGLN2/PI3K/Akt pathway.

Figure 5.

Sal A treatment improves TMZ sensitivity by inactivating TAGLN2/PI3K/Akt pathway in glioma cells. (a) U87 cells were co-treated with 0, 25, 50, 100 μM Sal A and 100 μM TMZ for 24 h. CCK-8 assay for determination of cell viability. (b) U87 cells were transfected with Ov-TAGLN2 or Ov-NC. RT-qPCR for determination of TAGLN2 mRNA level. (c) U87 cells receiving co-treatment with 25 μM Sal A and 100 μM TMZ for 24 h were transfected with Ov-TAGLN2 or Ov-NC. Western blot analysis for determination of expressions of TAGLN2, p-PI3K, PI3K, p-Akt and Akt. ** p < 0.01, *** p < 0.001.

Figure 6.

Sal A treatment improves TMZ sensitivity by inactivating TAGLN2/PI3K/Akt pathway in glioma cells. U87 cells receiving co-treatment with 25 μM Sal A and 100 μM TMZ for 24 h were transfected with Ov-TAGLN2 or Ov-NC. (a) CCK-8 assay for determination of cell viability. (b, c) TUNEL staining for determination of cell apoptosis. *** p < 0.001.

Discussion

Recently, increasing reports have been focusing on the regulatory effects of natural extracts on human diseases [24,25]. Among them, the anti-tumor effect of natural extracts has been widely reported [26]. Sal A, an organic compound derived from Salvia miltiorrhiza, exerts potent anti-cancer effects against various types of cancers such as breast cancer and lung cancer [27]. Zheng et al [28] report that Sal A could markedly reverse paclitaxel resistance and suppress the migration and invasion of human breast cancer cells. Tang et al [29] indicate that Sal A could reverse cisplatin resistance of lung cancer cells by suppressing c-met and attenuating Akt/mTOR pathway. Moreover, Sal A has also been shown to curb cell proliferation, cause cell cycle arrest and induce apoptosis in drug-resistant breast cancer cells [30]. In the current work, it was demonstrated that Sal A treatment reduced the viability, repressed the proliferation, migration and invasion of glioma cells as well as promoted the apoptosis of glioma cells.

TMZ is one of the most commonly used first-line drugs in clinical chemotherapy for glioma and can effectively improve the survival time and survival rate of patients with malignant glioma. TMZ resistance in glioma involves multiple mechanisms, among which DNA repair mechanism such as O6-methylguanine-DNA methyltransferase, mismatch repair and base excision repair, can repair DNA damage caused by TMZ, thereby reducing the sensitivity of glioma to TMZ [31,32]. Overcoming TMZ resistance is a challenging problem in glioma treatment.

It is well documented that TAGLN2 functions as a pivotal driver in various types of cancers, including meningioma [15], bladder cancer [33], colorectal cancer [34], esophageal squamous cell carcinoma [35] and so on. All these findings highlight that TAGLN2 is widely expressed and engaged in the development of cancers. PI3K/Akt signaling is well accepted to possess an oncogenic role in multiple malignancies [12]. Previous research has reported that TAGLN2 and its downstream PI3K/Akt pathway play important roles in glioma development and metastasis [9,12]. Meanwhile, Fan et al [36] have validated that blocking PI3K/Akt pathway could boost the apoptosis of TMZ-treated glioma cells. In addition, PI3K/Akt/NF-κB signaling pathway could be inactivated by ABCE1 depletion to enhance the sensitivity of glioma cells to TMZ [37]. Consistent with the previous studies, the present research also confirmed that inhibition of TAGLN2/PI3K/Akt pathway potentiated the suppressive effect of Sal A on TMZ resistance in glioma cells.

Conclusion

To sum up, it was identified that Sal A treatment could suppress the malignant behaviors of glioma cells and TMZ resistance through inactivating TAGLN2/PI3K/Akt pathway. Findings of this current work prompted that Sal A maybe a promising drug and TAGLN2/PI3K/Akt pathway might serve as therapeutic targets, which are able to become prospective adjuvant in glioma chemotherapy clinically.

Click here for additional data file.