| Literature DB >> 35492598 |
Yuwares Malila1, Pornnicha Sanpinit1, Wilawan Thongda1,2, Anuwat Jandamook3, Yanee Srimarut1, Yupin Phasuk3, Sajee Kunhareang3.
Abstract
The objectives of this study were to examine the effects of cyclic thermal stress on histological characteristics of breast muscle and gene expression regarding adipose infiltration and inflammation in breast muscles collected from different breeds of chickens. The birds, from commercial broilers (CB, Ross 308, 3 weeks), native (NT, 100% Thai native Chee, 9 weeks), H75 (crossbred; 75% broiler and 25% NT, 5 weeks), and H50 (crossbred; 50% broiler and 50% NT, 7 weeks), were equally assigned into control or treatment groups. The control samples were reared under a constant temperature of 26 ± 1°C, while the treatment groups were exposed to 35 ± 1°C (6 h per day). After a 20-day thermal challenge, 12 male birds per treatment group were randomly collected for determination of live body weight, breast weight, numbers of growth-related myopathies, and breast meat chemical composition. Histological lesions were evaluated in the pectoralis major muscle immediately collected within 20 min postmortem based on hematoxylin and eosin staining. The results indicated that despite interaction between thermal stress and breed effects, thermal challenge significantly reduced feed intake, live body weight, and breast weight of the birds and increased moisture content in breast meat (p < 0.05). An interaction between the two main factors was found for protein content (p < 0.05) for which control CB showed less protein than the other groups. Heat stress decreased histological scores for adipose infiltration in CB (p < 0.05), but it did not significantly influence such scores in the other groups. CB received histological scores for adipose tissue at greater extent than those for the other groups. Differential absolute abundance of CD36, FABP4, LITAF, PDGFRA, PLIN1, PPARG, POSTN, SCD1, and TGFB1 in the muscle samples well-agreed with the trend of histological scores, suggesting potential involvement of dysregulated fibro-adipogenic progenitors together with imbalanced lipid storage and utilization in the breast muscle. The findings demonstrated that the cyclic thermal challenge restricted growth performance and breast mass of the birds, but such effects attenuated infiltration of adipose tissue and inflammatory cells in the CB breast muscle.Entities:
Keywords: chicken; droplet digital polymerase chain reaction; fat accumulation; heat stress; immune cell infiltration
Year: 2022 PMID: 35492598 PMCID: PMC9039046 DOI: 10.3389/fphys.2022.858735
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Chemical composition of standard commercial broiler diets.
| Nutrient | Starting phase (1 day–21 days) | Growing phase (22 days to Market age) |
|---|---|---|
| Metabolizable energy (kcal/kg) | 3,100 | 3,200 |
| Moisture (%) | 13 | 13 |
| Crude protein (%) | 21 | 20 |
| Crude fiber (%) | 5 | 5 |
| Fat (%) | 4 | 4 |
Primers.
| NCBI accession number | Gene ID | Gene annotation | Sequence (5′ → 3′) | Amplicon length (bp) | Template amount (ng) | Annealing temperature (°C) |
|---|---|---|---|---|---|---|
| NM_206,991.1 |
| Adiponectin | F: AGCAGAACCACTACGACAGC | 166 | 10 | 60 |
| — | — | — | R: ACGTTGTTCTCCTGGAACTGG | — | — | — |
| NM_001,030,731 |
| CD36 molecule | F: TACCAGACCAGTAAGACCGTGAAGG | 156 | 25 | 60 |
| — | — | — | R: AATGTCTAGGACTCCAGCCAGTGT | — | — | — |
| NM_204,290.1 |
| Fatty acid–binding protein 4 | F: TATGAAAGAGCTGGGTGTGG | 168 | 10 | 60 |
| — | — | — | R: GCTGTGGTCTCATCAAACTC | — | — | — |
| NM_204,267.1 |
| Lipopolysaccharide-induced tumor necrosis factor-alpha factor | F: ACTATCCTCACCCCTACCCTGTC | 95 | 25 | 60 |
| R: TGTTGGCATAGGCTGTCCTG | ||||||
| XM_040,666,999.1 |
| Lipin 1 | F: CCTTTCACTGTAATGCTGGT | 173 | 10 | 60 |
| — | — | — | R: TGGAGTGGTATGGTCATCAG | — | — | — |
| NM_205,282.1 |
| Lipoprotein lipase | F: AGGAGAAGAGGCAGCAATA | 222 | 10 | 60 |
| — | — | — | R: AAAGCCAGCAGCAGATAAG | — | — | — |
| NM_001,030,363.1 |
| Myogenic factor 5 | F: TGAACCAAGCATTCGAGACC | 141 | 10 | 60 |
| R: AGTAGTTCTCCACCTGTTCCCT | ||||||
| NM_204,749.2 |
| Platelet-derived growth factor receptor, alpha | F: AAGAGAGTGCCATTGAAACCG | 155 | 10 | 60 |
| R: GCAGTTAGAAGGTGTCTGGGAT | ||||||
| NM_001,127,439.1 |
| Perilipin 1 | F: GCCAAGGAGAACGTGCT | 142 | 10 | 60 |
| — | — | — | R: TCACTCCCTGCTCATAGACC | — | — | — |
| NM_001,001,460.1 |
| Peroxisome proliferator activated | F: CCAGCGACATCGACCAGTTA | 182 | 100 | 60 |
| — | — | Receptor, gamma | R: TCCCATCCTTAAAGAGTTCA | — | — | — |
| NM_001,030,541.1 |
| Periostin | F: GCCTGGTGTGACAAACATCC | 119 | 10 | 60 |
| — | — | — | R: TGGTTGCCATGAGATCAGGTT | — | — | — |
| NM_204,890.1 |
| Stearoyl-CoA desaturase 1 | F: GGCTGACAAAGTGGTGATG | 137 | 50 | 60 |
| — | — | — | R: GGATGGCTGGAATGAAGA | — | — | — |
| NM_001,318,456.1 |
| Transforming growth factor beta 1 | F: GACGATGAGTGGCTCTCCTTC | 195 | 10 | 60 |
| R: GTGCTTCTTGGCAATGCTCT |
Live body weight at slaughter age, breast weight, and breast yield (%) of the chicken samples.
| Sample | Feed intake | Live body weight (g) | Breast weight (g) | Breast yield | |
|---|---|---|---|---|---|
| CB (42d) | Control | 98.3 ± 11.6 | 1,962.5 ± 188.8 | 164.8 ± 43.6 | 8.3 ± 1.5 |
| — | Treatment | 85.6 ± 3.0 | 1,695.0 ± 106.3 | 119.3 ± 13.5 | 7.0 ± 0.4 |
| H75 (56d) | Control | 85.0 ± 3.8 | 1,575.0 ± 125.8 | 82.3 ± 19.1 | 5.2 ± 1.0 |
| — | Treatment | 88.2 ± 13.2 | 1,576.3 ± 115.9 | 88.8 ± 15.9 | 5.6 ± 0.8 |
| H50 (70d) | Control | 94.4 ± 8.6 | 2,150.0 ± 122.5 | 132.8 ± 15.7 | 6.2 ± 0.7 |
| — | Treatment | 79.8 ± 6.3 | 1,905.0 ± 85.4 | 121.5 ± 10.1 | 6.4 ± 0.4 |
| NT (84d) | Control | 64.4 ± 3.8 | 1,345.0 ± 68.1 | 60.5 ± 8.2 | 4.5 ± 0.4 |
| — | Treatment | 63.9 ± 8.2 | 1,185.0 ± 54.5 | 52.5 ± 4.4 | 4.4 ± 0.3 |
| Main effects | — | — | — | — | — |
| Stress | Control | 86.9 ± 15.05 | 1,758.1 ± 347.5 | 110.1 ± 48.1 | 6.8 ± 1.9 |
| — | Treatment | 78.8 ± 11.54 | 1,590.3 ± 283.2 | 95.5 ± 30.8 | 6.5 ± 1.2 |
| Breed | CB | 92.0a ± 10.4 | 1,828.8b ± 201.4 | 142.0a ± 38.5 | 8.4a ± 1.4 |
| — | H75 | 86.4a ± 8.3 | 1,575.6c ± 112.0 | 85.5b ± 16.7 | 6.1b ± 1.0 |
| — | H50 | 87.1a ± 10.5 | 2,027.5a ± 163.4 | 127.1a ± 13.6 | 6.9 b ± 0.6 |
| — | NT | 64.2b ± 5.7 | 1,265d ± 102.8 | 56.5c ± 7.5 | 5.0c ± 0.4 |
|
| — | — | — | — | — |
| Stress | — | 0.03 | 0.0004 | 0.04 | 0.34 |
| Breed | — | <0.0001 | <0.0001 | <0.0001 | <0.0001 |
| Interaction | — | 0.12 | 0.11 | 0.09 | 0.15 |
Mean ± standard deviation (n = 12).
Feed intake during the last 3 weeks before specific market age.
Breast yield was expressed in percentage as breast weight relative to live body weight.
Slaughter age (days) of each chicken strain.
a, b, c, d Significant differences due to different breeds (p < 0.05).
FIGURE 1Live body weight and cases of meat abnormalities in the chickens from different breeds. The birds were reared at a constant temperature (control, 26°C) or received heat challenge (treatment, 35°C, 6 h daily) for 20 days before reaching their market ages. (A) Markers and error bars depict average and standard deviation of live body weight (n = 12 per group), respectively. (B) Venn diagrams illustrate occurrence of growth-related myopathies, including white striping (WS) and wooden breast (WB), in breast muscles (n = 12 per group). CB: commercial broilers; H75: crossbreeds, 75% broiler background and 25% Thai native background; H50: crossbreeds, 50% broiler background and 50% Thai native background; NT: Thai native chicken.
Chemical composition (g/100 g sample) of breast samples.
| Sample | Moisture | Crude protein | Crude fat | Carbohydrate | Ash | |
|---|---|---|---|---|---|---|
| CB | Control | 75.87 ± 0.55 | 20.87d ± 0.84 | 1.09 ± 0.19 | 1.01 ± 0.50 | 1.16 ± 0.12 |
| — | Treatment | 74.74 ± 0.22 | 22.51c ± 0.27 | 0.76 ± 0.12 | 0.59 ± 0.27 | 1.40 ± 0.07 |
| H75 | Control | 73.85 ± 0.29 | 23.03bc ± 0.43 | 0.72 ± 0.30 | 0.70 ± 0.26 | 1.69 ± 0.16 |
| — | Treatment | 73.96 ± 1.03 | 23.05bc ± 1.08 | 0.60 ± 0.17 | 0.82 ± 0.37 | 1.57 ± 0.30 |
| H50 | Control | 74.12 ± 0.41 | 23.27abc ± 0.34 | 0.63 ± 0.27 | 0.47 ± 0.49 | 1.51 ± 0.13 |
| — | Treatment | 73.25 ± 0.87 | 24.12a ± 0.57 | 0.45 ± 0.13 | 0.45 ± 0.20 | 1.74 ± 0.20 |
| NT | Control | 73.31 ± 0.40 | 23.91ab ± 0.60 | 0.28 ± 0.08 | 0.57 ± 0.21 | 1.94 ± 0.08 |
| — | Treatment | 73.39 ± 0.21 | 23.63ab ± 0.34 | 0.42 ± 0.13 | 0.71 ± 0.32 | 1.85 ± 0.02 |
| Main effects | — | — | — | — | — | — |
| Stress | Control | 74.29 ± 1.06 | 22.77 ± 1.29 | 0.68 ± 0.36 | 0.69 ± 0.41 | 1.57 ± 0.32 |
| — | Treatment | 73.89 ± 0.87 | 23.33 ± 0.85 | 0.56 ± 0.18 | 0.64 ± 0.30 | 1.64 ± 0.24 |
| Breed | CB | 75.31a ± 0.72 | 21.69b ± 1.05 | 0.93a ± 0.23 | 0.80 ± 0.43 | 1.28c ± 0.16 |
| — | H75 | 73.91b ± 0.70 | 23.04a ± 0.76 | 0.66b ± 0.24 | 0.76 ± 0.30 | 1.63b ± 0.23 |
| — | H50 | 73.69b ± 0.78 | 23.69a ± 0.63 | 0.54 bc ± 0.22 | 0.46 ± 0.35 | 1.62b ± 0.20 |
| — | NT | 73.35b ± 0.30 | 23.77a ± 0.48 | 0.35c ± 0.12 | 0.64 ± 0.26 | 1.89a ± 0.07 |
|
| — | — | — | — | — | — |
| Stress | — | 0.03 | 0.02 | 0.08 | 0.71 | 0.25 |
| Breed | — | <0.0001 | <0.0001 | <0.0001 | 0.23 | <0.0001 |
| Interaction | — | 0.08 | 0.02 | 0.10 | 0.38 | 0.07 |
Mean ± standard deviation (n = 12).
a, b, c, dSignificant differences due to different treatment groups or different breeds (p < 0.05).
FIGURE 2Histological findings for hematoxylin and eosin (H&E)–stained pectoralis major muscle sections. Examples of microscopic images (scale bar of 100 μm) of H&E–stained pectoralis major muscles collected from different chicken breeds. The birds were reared at a constant temperature (control, 26°C) or received heat challenge (treatment, 35°C, 6 h daily) for 20 days before reaching their market ages. CB: commercial broilers; H75: crossbreeds, 75% broiler background and 25% Thai native background; H50: crossbreeds, 50% broiler background and 50% Thai native background; NT: Thai native chickens. Arrows and stars indicate accumulation of inflammatory cells and adipose tissue, respectively.
FIGURE 3Bar graphs indicating frequency and average histological lesion scores. (A,B) Frequency, expressed in percentage, of each histological score observed in pectoralis major muscles of each treatment group. (C,D) Average histological scores. Bars and error bars depict average and standard errors in the scores, respectively. CB: commercial broilers; H75: crossbreeds, 75% broiler background and 25% Thai native background; H50: crossbreeds, 50% broiler background and 50% Thai native background; NT: Thai native chickens. Different letters above bars denote statistical significance (p < 0.05).
FIGURE 4Absolute transcript abundance of 13 target genes associated with lipid metabolisms and muscle injury in the pectoralis major muscle of chickens from different breeds. The birds were reared at a constant temperature (control, 26°C) or received heat challenge (treatment, 35°C, 6 h daily) for 20 days before reaching their market ages. Bars and error bars depict average and standard error in copies per 20-µL reaction, respectively. CB: commercial broilers; H75: crossbreeds, 75% broiler background and 25% Thai native background; H50: crossbreeds, 50% broiler background and 50% Thai native background; NT: Thai native chicken. Different letters above individual bars denote statistical significance among different treatment groups (p < 0.05). Different letters above horizontal lines indicate significance due to different breeds (p < 0.05). Asterisks indicate the reduced expression of particular genes in stressed samples compared to their control counterparts (p < 0.05).
Correlation coefficient between histological scores, white striping (WS) and wooden breast (WB) abnormalities, and absolute transcript abundance.
| Pearson’s correlation coefficient | Spearman’s rank correlation coefficient1 | |||
|---|---|---|---|---|
| Inflammation | Adipose tissue infiltration | WS | WB | |
| Inflammation | na | na | 0.45* | 0.36 |
| Adipose tissue infiltration | na | na | 0.46* | 0.47** |
| WS | na | na | na | 0.67*** |
| WB | na | na | 0.67*** | na |
|
| −0.08 | −0.12 | 0.03 | 0.01 |
|
| 0.43* | 0.56** | 0.66*** | 0.51** |
|
| 0.57** | 0.76*** | 0.61** | 0.51** |
|
| 0.29 | 0.37* | 0.45* | 0.31 |
|
| −0.19 | −0.17 | 0.14 | 0.03 |
|
| 0.27 | 0.40* | 0.51* | 0.48** |
|
| −0.18 | −0.03 | 0.37 | 0.30 |
|
| 0.36* | 0.73*** | 0.51** | 0.47** |
|
| 0.61** | 0.81*** | 0.57** | 0.47** |
|
| 0.49** | 0.67*** | 0.52** | 0.43* |
|
| 0.38* | 0.66*** | 0.44* | 0.48** |
|
| 0.51** | 0.62** | 0.54** | 0.47** |
|
| 0.47** | 0.54** | 0.54** | 0.42* |
*p < 0.05, **p < 0.01, ***p < 0.0001, na = not applicable.