Literature DB >> 35490230

Anaplasma phagocytophilum in Marmota himalayana.

Ran Duan1, Dongyue Lv1, Rong Fan1, Guoming Fu2, Hui Mu1, Jinxiao Xi3, Xinmin Lu4, Hua Chun2, Jun Hua2, Zhaokai He1, Shuai Qin1, Yanyan Huang2, Meng Xiao1, Jinchuan Yang1, Huaiqi Jing1, Xin Wang5.   

Abstract

BACKGROUND: Human granulocytic anaplasmosis is a tick-borne zoonotic disease caused by Anaplasma phagocytophilum. Coinfections with A. phagocytophilum and other tick-borne pathogens are reported frequently, whereas the relationship between A. phagocytophilum and flea-borne Yersnia pestis is rarely concerned.
RESULTS: A. phagocytophilum and Yersnia pestis were discovered within a Marmota himalayana found dead in the environment, as determined by 16S ribosomal rRNA sequencing. Comparative genomic analyses of marmot-derived A. phagocytophilum isolate demonstrated its similarities and a geographic isolation from other global strains. The 16S rRNA gene and GroEL amino acid sequence identity rates between marmot-derived A. phagocytophilum (JAHLEX000000000) and reference strain HZ (CP000235.1) are 99.73% (1490/1494) and 99.82% (549/550), respectively. 16S rRNA and groESL gene screenings show that A. phagocytophilum is widely distributed in marmots; the bacterium was more common in marmots found dead (24.59%, 15/61) than in captured marmots (19.21%, 29/151). We found a higher Y. pestis isolation rate in dead marmots harboring A. phagocytophilum than in those without it (2 = 4.047, p < 0.05). Marmot-derived A. phagocytophilum was able to live in L929 cells and BALB/c mice but did not propagate well.
CONCLUSIONS: In this study, A. phagocytophilum was identified for the first time in Marmota himalayana, a predominant Yersinia pestis host. Our results provide initial evidence for M. himalayana being a reservoir for A. phagocytophilum; moreover, we found with the presence of A. phagocytophilum, marmots may be more vulnerable to plague. Humans are at risk for co-infection with both pathogens by exposure to such marmots.
© 2022. The Author(s).

Entities:  

Keywords:  Anaplasma phagocytophilum; Anaplasmosis; Coinfection; Marmota himalayana; Plague; Yersinia pestis

Mesh:

Substances:

Year:  2022        PMID: 35490230      PMCID: PMC9055747          DOI: 10.1186/s12864-022-08557-x

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   4.547


Background

Marmota himalayana is the predominant plague host within the marmots of the Qinghai-Tibet Plateau, this mammal inhabits high-frigid shrubs as well as a meadow-steppe zone at altitudes between 2,700 and 5,450 m. The flea species Callopsylla dolabris and Oropsylla silantiewi are the main plague vectors, and Ixodes crenulatus is the primary Ixodes species bearing Y. pestis [1]. Pneumonic plague is the dominant plague type in humans and it has an extremely high mortality rate [2-4]. Human granulocytic anaplasmosis (HGA) is a tick-borne zoonotic disease caused by A. phagocytophilum. Since the first laboratory-confirmed human case in the US in 1994 [5], A. phagocytophilum has been found in many countries [6-9], including China. Ixodes scapularis, Ixodes pacificus, and Ixodes persulcatus are the main vectors of A. phagocytophilum [10]. Coinfections of A. phagocytophilum have been found mainly with the tick-borne pathogens of Lyme disease and Babesiosis [11, 12]. To the best of our knowledge, this is the first report of the plague host M. himalayana being a reservoir of A. phagocytophilum; the tick species I. crenulatus may serve as its vector. The co-existence of A. phagocytophilum and Y. pestis in M. himalayana and its parasitic Ixodes vector imply a risk for coinfection in humans; these findings provide valuable insights for the disease control of both pathogens. Our comparative genome analysis provides further evidence for the divergent evolution of marmot-derived A. phagocytophilum when compared to global strains, possibly due to geographic isolation.

Results

A. phagocytophilum was discovered in plague-infected M. himalayana

We isolated Y. pestis from marmot A, marmot B, and their parasites (Fig. 1). Cloning and sequencing of the 16S rRNA partial sequence (1470 bp) of samples from marmot A showed that only Y. pestis and A. phagocytophilum were present in approximately 100 clones. The top BLAST hit of our A. phagocytophilum sequence was the A. phagocytophilum reference str. HZ (CP000235.1), with 100% query coverage and 99.52% identity (1463/1470). In the neighbor-joining tree constructed based on the 16S rRNA genes of the genera Anaplasma and Ehrlichia and the species Rickettsia rickettsii, our sequence was closely clustered with that of the A. phagocytophilum str. HZ (Fig. 2A).
Fig. 1

M. himalayana infected with A. phagocytophilum and Y. pestis. A and B marmot A and marmot B found shortly after they had died. C Enlarged pulmonary nodules in marmot A

Fig. 2

Neighbor-joining trees based on 16S rRNA gene nucleotide and GroEL amino acid sequences. A tree based on 16S rRNA gene sequences of Anaplasma and Ehrlichia genera, and on R. rickettsii species. B tree based on GroEL amino acid sequences within the Anaplasma genus

M. himalayana infected with A. phagocytophilum and Y. pestis. A and B marmot A and marmot B found shortly after they had died. C Enlarged pulmonary nodules in marmot A Neighbor-joining trees based on 16S rRNA gene nucleotide and GroEL amino acid sequences. A tree based on 16S rRNA gene sequences of Anaplasma and Ehrlichia genera, and on R. rickettsii species. B tree based on GroEL amino acid sequences within the Anaplasma genus

A. phagocytophilum is widespread in M. himalayana and its presence is associated with that of Y. pestis

In this study, the total detection rate of A. phagocytophilum was 19.21% (29/151) in captured marmots and 24.59% (15/61) in marmots found dead (Table 1). Among the marmots found dead, the Y. pestis isolation rate was significantly higher in A. phagocytophilum-carrier marmots than in the others (Table 2, χ2= 4.047, p < 0.05). Among the A. phagocytophilum-positive M. himalayana animals, all 44 marmots carried the same sequences (nested PCR) of the 16S rRNA gene (MT020436). The groESL gene sequences (nested PCR) were of two types, 24 marmots had identical sequences (MT018452), and 20 marmots possessed a synonymous mutation (A349C). Positive samples for A. phagocytophilum included those from heart, liver, spleen, lung, bone marrow, and from the I. crenulatus and O. silantiewi marmot parasites (Table S1).
Table 1

M. himalayana positive for A. phagocytophilum (A. p)

MarmotNumber of samplespositive for A. pNumber of marmotspositive for A. p(a)Number of marmotstested for A. p(b)A. p positivity rate(a/b)
Found dead29156124.59%
Captured372915119.21%
Total664421220.75%
Table 2

Y. pestis in dead M. himalayana was isolated more frequently in those bodies harboring A. phagocytophilum*

A. phagocytophilumY. pestis isolationY. pestis isolation rate
 + -
 + 10566.67%
-172936.96%
Total273444.26%

*χ2 = 4.047, p < 0.05

M. himalayana positive for A. phagocytophilum (A. p) Y. pestis in dead M. himalayana was isolated more frequently in those bodies harboring A. phagocytophilum* *χ2 = 4.047, p < 0.05

Analysis of groEL gene and its deduced protein within the Anaplasma genus

The primary stage PCR product of the groESL operon was 1380 bp, representing partial CDSs of groES and groEL, and encoding 415 amino acids of GroEL for the marmot-derived A. phagocytophilum (QPF77578.1). We successfully obtained partial sequence of the groESL gene operon (1380 bp) from 12 samples of nine marmots, resulting in five sequence types with the lowest similarity at 99.49% (1373/1380). The main sequence type was present in six samples (MT018452). Samples of marmot 7 and marmot 9 showed non-synonymous mutations, and the other samples showed synonymous mutations (Fig. 3).
Fig. 3

Polymorphisms of the groEL gene and GroEL protein between marmot-derived A. phagocytophilum. Yellow highlights and red letters: nonsynonymous mutations. * 216 nucleotide mutation confirmed twice by sequences of primary PCR and nested PCR

Polymorphisms of the groEL gene and GroEL protein between marmot-derived A. phagocytophilum. Yellow highlights and red letters: nonsynonymous mutations. * 216 nucleotide mutation confirmed twice by sequences of primary PCR and nested PCR For the GroEL encoding region, the sequence identity between the main sequence type of our marmot-derived A. phagocytophilum and that of the A. phagocytophilum str. HZ was 94.07% (1173/1247) for nucleotides and 99.52% (413/415) for amino acids. To display a phylogenetic association within the Anaplasma genus, we constructed a neighbor-joining tree of GroEL comprised of six Anaplasma species (Fig. 2B). The nucleotide sequence identities within the Anaplasma genus, from highest to lowest, were 94.0% for A. phagocytophilum, 80.6% for Anaplasma platys, and 78.0%–74.6% for other Anaplasma species (Table S2).

Propagation of A. phagocytophilum in BALB/c mice

Among the inoculated mice, the liver of one mouse at 8 DPI was positive for A. phagocytophilum, as confirmed by 16S rRNA and groESL partial sequence analyses. For the remaining mice at 8, 12, and 16 DPI, neither gene was detected. The PCR controls were normal. The 281/282 bp of the 16S rRNA gene (nested PCR) of the positive mouse sample was identical to the marmot-derived sequence (MT020436), and only one mutation (A245G) was found. The 478/480 bp of the groESL operon (nested PCR) of the positive mouse sample was identical to MT018452, and only two mutations (C453T and T469C) were detected.

Propagation of A. phagocytophilum in L929 cells

The homogenate-infected L929 cells showed cytopathic effects (Fig. 4A), while the control cells did not (Fig. 4B). We found morulae in the cytoplasm of infected cells (Fig. 4C, red arrow), but not in those of control cells (Fig. 4D). Both A. phagocytophilum specific PCRs based on the 16S rRNA gene (nested PCR) and groESL operon (nested PCR) were positive in infected cells, and their sequences showed 100% identity with that of the marmot-derived sequences (MT020436 and MT018452). All PCR controls were normal. No target sequence in the control cells was positive for the pathogen genes.
Fig. 4

A. phagocytophilum propagated in L929 cells (A, C) and control cells (B, D). A, B 40X objective (direct observation). C, D oil immersion objective (Giemsa staining)

A. phagocytophilum propagated in L929 cells (A, C) and control cells (B, D). A, B 40X objective (direct observation). C, D oil immersion objective (Giemsa staining)

Comparative analysis of whole-genome sequenced A. phagocytophilum

The whole nucleotide sequence of A. phagocytophilum strain is 1,261,482 bp with a G + C content of 41.2 mol% (Figure S1) and 1,035 coding genes. The 16S rRNA gene sequence identity between the whole-genome sequenced marmot-derived A. phagocytophilum (JAHLEX000000000; rRNA_Scaffold20_6351-7844) and the reference strain HZ (CP000235.1) was 99.73% (1490/1494), the GroEL amino acid sequence identity rate was 99.82% (549/550). Its genome is collinear with those of other A. phagocytophilum strains (Figure S2). The overview of global genomes demonstrated that most sequence identities were greater than 90% between the marmot-derived strain and other A. phagocytophilum strains (Fig. 5A). The phylogenetic tree of worldwide strains showed that the marmot-derived strain lies in the branch of A. phagocytophilum but at a distance from the other compared strains; in addition, the clustering of A. phagocytophilum strains was correlated with the geographic distribution (Fig. 5B).
Fig. 5

Genome overview and phylogenetic tree of A. phagocytophilum. A Sequence similarity between marmot-derived A. phagocytophilum (in the center) and other compared strains. The legend shows the GC content and GC skew for the marmot-derived isolate, and the sequence identity on a sliding scale. B: Phylogenetic tree of A. phagocytophilum from various countries and sources

Genome overview and phylogenetic tree of A. phagocytophilum. A Sequence similarity between marmot-derived A. phagocytophilum (in the center) and other compared strains. The legend shows the GC content and GC skew for the marmot-derived isolate, and the sequence identity on a sliding scale. B: Phylogenetic tree of A. phagocytophilum from various countries and sources

Discussion

The M. himalayana plague focus is the largest and most prevalent plague focus in China [3, 4], the Subei Mongolian Autonomous County and Akesai Kazakh Autonomous County are the most prevalent regions in this plague focus. Each year from May to October, dozens of Y. pestis isolates are found in a number of marmots found dead in the environment. During the 2019 plague surveillance, two marmots were found shortly after their death (Fig. 1), and we isolated Y. pestis and A. phagocytophilum from their organs and infested parasites (Table S1). Successively, a total of 44 marmots were confirmed to be A. phagocytophilum carriers by genetic analysis of the 16S rRNA and groESL partial sequences from 2019 and 2020. The A. phagocytophilum positive rate for live marmots was as high as 20.75% (44/212) and that for marmots found dead was even higher at 24.59% (15/61) (Table 1). We found that A. phagocytophilum-carrier marmots seem to have a higher risk of dying from a Y. pestis infection, suggesting a pathogenic synergy between the two pathogens. In dead marmots, the isolation rate of Y. pestis was higher in A. phagocytophilum-carrier marmots (66.67%, 10/15) than in others (36.96%, 17/46) (Table 2). Neutrophils, the killers of Y. pestis [13], are damaged by A. phagocytophilum [14]. The innate immune defense of marmots with A. phagocytophilum may be weakened, and the marmots may be more vulnerable to plague. Further infection of BALB/c mice and L929 cells (Fig. 4) with A. phagocytophilum-positive samples confirmed its presence in M. himalayana. However, the A. phagocytophilum strain does not appear to spread well in BALB/c mice; at 8 DPI, only one mouse with the bacteria in its liver was recovered, and by 12 DPI the infection seemed to have been eradicated. The whole genome of the marmot-derived strain showed collinearity (Figure S2) and similarity (Fig. 5A) with 13 other worldwide sequenced strains. It shared 99.73% (1490/1494) identity in its 16S rRNA gene and 99.82% (549/550) identity in its GroEL protein with the reference strain HZ (CP000235.1). The phylogenetic tree of these strains demonstrated a correlation with the geographic distribution, with the marmot strain from the Qinghai-Tibet Plateau of China falling outside of the conglomerate of the other 13 global sequenced strains. The divergence of our marmot strain might be due to geographic isolation resulting in diverging evolution. GroEL proteins are used as valuable evolutionary tools because they provide defining evolutionary association among the eubacterial lineages [15, 16]. The 1380-bp groESL sequence of A. phagocytophilum from nine marmots formed five types, suggesting a genetic diversity of this bacterium in M. himalayana. With this study, we are proposing that M. himalayana may serve as a reservoir for A. phagocytophilum. We found the bacterium widespread in the marmots we tested (Table 1, 20.75%), from heart, liver, spleen, lung, bone marrow, to blood-feeding fleas and ticks (Table S1). Maintenance of A. phagocytophilum depends on the presence of suitable mammalian hosts and appropriate vectors in the local environment [17, 18]. Rodents such as mice, squirrels, woodrats [19], and Ixodes ticks such as I. scapularis, I. pacificus, and I. persulcatus [10] are thought to be important for the enzootic cycle of A. phagocytophilum. In China, A. phagocytophilum is mainly found in the northeast, where Ixodes ticks are densely distributed in the forest [20]. In the northwest of China, A. phagocytophilum has been found within the M. himalayana plague focus, from Apodemus agrarius and Haemaphysalis qinghaiensis, but the site is located southeast and 1400 km away from our study site and presents more precipitation [21]. To the best of our knowledge, this is the first time that I. crenulatus, the main tick species transmitting Y. pestis in M. himalayana, has been found to be positive for A. phagocytophilum, indicating that the tick may act as a transmission vector for it. In addition to tick bites, potential routes for A. phagocytophilum transmission include blood transfusions and direct contact with contaminated fluids [22, 23]. A higher bacterial load during the transmission (such as in wounds) may lead to a more serious infectious outcome. The plague transmission route ‘marmot-human’ has been increasing in the M. himalayana plague focus of the Qinghai-Tibet Plateau, owing to marmot skinning or eating among poachers and hired herders. The frequencies of primary septic plague and pneumonic plague have increased, leading to a higher mortality rate and worse prognoses [13]. It is conceivable that A. phagocytophilum be transmitted by this route. More than a third (37.04%, 10/27) of the dead marmots infected with Y. pestis that we found were also A. phagocytophilum carriers (Table 2); thus, both bacteria could spread simultaneously to humans. Plague appeared to be exacerbated in the A. phagocytophilum-carrier marmots and this could also be the case in humans. A. phagocytophilum-carrier marmots were more likely to die from Y. pestis infections (Table 2). For human granulocytic anaplasmosis, 36% of the cases are reported to be severe enough to warrant hospitalization [24], and approximately 17% of the hospitalized patients require admission to an intensive care unit [25]. Whether the A. phagocytophilum strain derived from M. himalayana causes clinical manifestations in humans remains to be seen, but coinfection with Y. pestis and A. phagocytophilum may lead to a worse condition than a plague infection alone.

Conclusions

In here, we propose that the M. himalayana may serve as a reservoir for A. phagocytophilum. Plague appears to be exacerbated in A. phagocytophilum-carrier marmots, and humans are at risk for infection by exposure to such marmots through ticks, potentially leading to complicated disease. These findings provide valuable insights for the control of plague and anaplasmosis. The marmot-derived A. phagocytophilum seems to have evolutionarily diverged from other worldwide strains, possibly due to its geographic isolation. Related projects will be launched for further exploration.

Methods

Y. pestis isolation and 16S rRNA gene analysis of dead M. himalayana

On May 30, 2019, during the plague monitoring period, two M. himalayana (designated A and B) were found dead in Subei county (Gansu Province, China) within the M. himalayana plague focus in the Qinghai-Tibet Plateau. The animals exhibited several parasites (A, 2 fleas and 30 ticks; B, 25 fleas and 52 ticks) and bright-red bloody noses (Fig. 1A), suggesting the possibility that they had died shortly before they were found. The marmots laid near a cave entrance within 10 m apart and may have belonged to the same family. Samples including organs (heart, liver, spleen, lungs, and bone marrow) and parasites (I. crenulatus, C. dolabris, O. silantiewi) were collected from the dead animals. The classification of ticks and fleas was performed according to their morphology by professionals of local CDC. After homogenization, the samples were applied onto a Yersinia-selective agar (Oxoid) for Y. pestis isolation at 28℃ for 48 h. Next, a single suspect colony of Y. pestis was purified on agar, and the purified passage was identified by gene amplifications (Table 3; caf1 and pla) and specific phage lysis [26, 27].
Table 3

Universal primers for the 16S rRNA gene, and specific primers for the 16S rRNA and groESL genes of A. phagocytophilum, and primers for Y. pestis genes

Target genePCR stagePrimer nameSequenceProduct lengthReference
16S rRNA-a27FAGA GTT TGA TCM TGG CTC AGvaried[28]
1492RTAC GGY TAC CTT GTT ACG ACT T
16S rRNA

Primary

PCR

Eh-out1TTG AGA GTT TGA TCC TGG CTC AGA ACG653[31, 32]
Eh-out2CAC CTC TAC ACT AGG AAT TCC GCT ATC

Nested

PCR

Eh-gs1GTA ATA CT GTA TAA TCC CTG282
Eh-gs2GTA CCG TCA TTA TCT TCC CTA
HGA1GTC GAA CGG ATT ATT CTT TAT AGC TTG389
HGA2TAT AGG TAC CGT CAT TAT CTT CCC TAC
groESL

Primary

PCR

HS1TGG GCT GGT A(A/C) TGA AAT1431[33]
HS6CCI CCI GGI ACI A(C/T) ACC TTC

Nested

PCR

HS43AT(A/T) GC(A/T) AA(G/A) GAA GCA TAG TC480
HS45ACT TCA CG(C/T) (C/T) TCA TAG AC
caf1- afra-1FGGAACCACTAGCACATCTGTT249[27]
fra-1RACCTGCTGCAAGTTTACCGCC
pla- apla-2FACTACGACTGGATGAATGAAAATC456
pla-2RGTGACATAATATCCAGCGTTAATT

astands for conventional PCR

We considered the possibility of finding pathogens other than Y. pestis given the enlarged pulmonary nodules found in marmot A (Fig. 1C). DNA was extracted from tissues of marmot A using a Blood & Tissue kit (Qiagen) and a PCR was performed using universal primers for the 16S rRNA gene [28] (Table 3). The amplification product was purified (Cycle-Pure Kit, Omega), cloned (T3 Cloning Kit, Transgene), and bidirectionally sequenced (AuGCT Biotechnology). The 16S rRNA gene sequences were checked against those in the GenBank database by BLASTN [29, 30].

Screening of A. phagocytophilum in M. himalayana by 16S rRNA and groESL genes

In addition to marmots A and B, 210 M. himalayana were collected during the 2019 to 2020 plague monitoring period in county Subei and county Akesai. The two counties are 51 km apart, both located in the M. himalayana plague focus of the Qinghai-Tibet Plateau. The tested samples included heart, liver, spleen, lung, and marrow tissues and the I. crenulatus, and O. silantiewi parasites of marmots. Nested PCRs were conducted to amplify the 16S rRNA [31, 32] and groESL partial sequences [33] of A. phagocytophilum. We used a DNA sample from marmot A that was positive for A. phagocytophilum as a positive control; a DNA sample of marmot tissue negative for A. phagocytophilum was used as a negative control. PCR products were bidirectionally sequenced and assembled. We identified positive samples of A. phagocytophilum on the basis of alignment with both the 16S rRNA (primers HGA1 and HGA2) and groESL (primers HS43 and HS45) gene sequences of the A. phagocytophilum reference strain HZ (CP000235.1) [34]. We defined negative samples as those with a single sequence alignment (or without alignments) with the A. phagocytophilum str. HZ sequence. We purified the primary-stage groESL PCR products of positive samples for gene cloning and sequencing. Universal primers for the 16S rRNA gene, and specific primers for the 16S rRNA and groESL genes of A. phagocytophilum, and primers for Y. pestis genes Primary PCR Nested PCR Primary PCR Nested PCR astands for conventional PCR

Statistical analysis of A. phagocytophilum presence in dead marmots

We adopted Chi-square tests to assess the difference in Y. pestis isolation rates between dead marmots positive or negative for A. phagocytophilum. We considered p-values < 0.05 as statistically significant. The statistical analysis was performed using SPSS Version 19.0 (IBM Corp., USA).

Phylogenetic analysis of 16S rRNA and groESL partial sequences

For nucleotide sequences of the 16S rRNA gene within the genera Anaplasma and Ehrlichia, and the species R.rickettsii, we constructed a neighbor-joining tree following the bootstrap method (1000 replications) and the Kimura 2-parameter model (MEGA 5.0). GroEL amino acid sequences were deduced from groESL partial sequences, and we constructed a neighbor-joining tree comparing them with others within the Anaplasma genus using the bootstrap method (1000 replications) and the Poisson model (MEGA 5.0). BioEdit 7.1.3.0 was used for the sequence identity matrix.

BALB/c mice inoculation and sequencing

Specific pathogen-free (SPF) grade 16–18 g female BALB/c mice were organized into three groups, provided with a clean and comfortable environment and sufficient drinking water and space. We collected mouse spleen and liver specimens at three time points: 8, 12, and 16 days post infection (DPI). We prepared a sample of marmot spleen that was positive for A. phagocytophilum but negative for Y. pestis using a homogenizer. The mice were intraperitoneally inoculated with 0.5 mL of the marmot homogenate. Control mice were intraperitoneally inoculated with normal saline. The DNA extractions (Blood & Tissue Kit, Qiagen), PCR examinations (Table 3), and the definition of positive samples for A. phagocytophilum were the same as those described in the Methods Sect. 2.

Propagation of A. phagocytophilum in cell culture

Mouse fibroblast cell line L929 cells (National Collection of Authenticated Cell Cultures, Shanghai, China) were cultured in Dulbecco’s Modified Eagle’s Medium (HyClone) supplemented with 10% fetal bovine serum (Gibco), 2.5% HEPES (Gibco), 100 U/mL of penicillin (Gibco), 100 µg/mL of streptomycin (Gibco) and 0.25 µg/mL of amphotericin B (Inalco SpA) at 37℃, in a humidified atmosphere with 5% CO2. L929 cells were infected with marmot homogenate positive for A. phagocytophilum but negative for Y. pestis. A control experiment without the infection was also set using L929 cells. We directly observed the cells under an EVOS XL Core Imaging System. Cultured cells with Giemsa staining were examined under an Echo Revolve microscope. The 16S rRNA and groESL genes of A. phagocytophilum in the experimental cells were detected (Table 3) and sequenced.

Whole genome sequencing and comparative analysis of marmot-derived A. phagocytophilum

Bacterial cells were released from the infected host cells using Dounce homogenization, differential centrifugation, and Percoll density gradient centrifugation [35]. The draft genome of the marmot-derived A. phagocytophilum was sequenced in NovaSeq system (Illumina, USA). Reads mapping was performed for 13 A. phagocytophilum genome (Table S3) using Bowtie2 V2.2.4 with the parameters –end-to-end –sensitive -I 200 -X 400 –threads 8. The marmot-derived A. phagocytophilum of this study was assembled using SPAdes v3.10.0. We compared the 13 strains and the marmot-derived A. phagocytophilum on the basis of the amino acid sequences of 616 core proteins using BRIG. A phylogenetic tree was constructed based on these A. phagocytophilum strains and a strain of Rickettsia felis (GenBank: CP000053) as an out-group using MEGA 7. Additional file 1: Figure S1. Sequencing depth and G+C content of the whole-genome sequenced marmot-derived A. phagocytophilum (JAHLEX000000000). Additional file 2: Figure S2. Collinearity between marmot-derived A. phagocytophilum (JAHLEX000000000) and 13 worldwide strains. Additional file 3: Table S1. Characteristics of samples positive for A. phagocytophilum in M. himalayana. Grey column: samples screened for A. phagocytophilum. √: Positive samples for A. phagocytophilum, confirmed by both 16s rRNA and groESL gene sequences. *: Positive samples had a 1380-bp cloned sequence of groESL. a: Y, marmots found dead in the environment. N, marmots captured for plague surveillance. Additional file 4: Table S2. Nucleotide sequence identity matrix for groEL genes within the Anaplasma genus. Additional file 5: Table S3. Characteristics of 13 A. phagocytophilum strains compared in this study.
  29 in total

1.  First evidence of Anaplasma infection in Crete, Greece. Report of six human cases.

Authors:  D Chochlakis; A Psaroulaki; S Kokkini; S Kostanatis; E Arkalati; E Karagrannaki; K Tsiatis; Y Tselentis; A Gikas
Journal:  Clin Microbiol Infect       Date:  2009-12       Impact factor: 8.067

2.  Ixodes pacificus (Acari: Ixodidae) as a vector of Ehrlichia equi (Rickettsiales: Ehrlichieae).

Authors:  P J Richter; R B Kimsey; J E Madigan; J E Barlough; J S Dumler; D L Brooks
Journal:  J Med Entomol       Date:  1996-01       Impact factor: 2.278

3.  Diagnosis and Management of Tickborne Rickettsial Diseases: Rocky Mountain Spotted Fever and Other Spotted Fever Group Rickettsioses, Ehrlichioses, and Anaplasmosis - United States.

Authors:  Holly M Biggs; Casey Barton Behravesh; Kristy K Bradley; F Scott Dahlgren; Naomi A Drexler; J Stephen Dumler; Scott M Folk; Cecilia Y Kato; R Ryan Lash; Michael L Levin; Robert F Massung; Robert B Nadelman; William L Nicholson; Christopher D Paddock; Bobbi S Pritt; Marc S Traeger
Journal:  MMWR Recomm Rep       Date:  2016-05-13

4.  Immunodominant major outer membrane proteins of Ehrlichia chaffeensis are encoded by a polymorphic multigene family.

Authors:  N Ohashi; N Zhi; Y Zhang; Y Rikihisa
Journal:  Infect Immun       Date:  1998-01       Impact factor: 3.441

Review 5.  Evolution of the chaperonin families (Hsp60, Hsp10 and Tcp-1) of proteins and the origin of eukaryotic cells.

Authors:  R S Gupta
Journal:  Mol Microbiol       Date:  1995-01       Impact factor: 3.501

6.  Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease.

Authors:  S M Chen; J S Dumler; J S Bakken; D H Walker
Journal:  J Clin Microbiol       Date:  1994-03       Impact factor: 5.948

Review 7.  Human granulocytic ehrlichiosis in Europe.

Authors:  J R Blanco; J A Oteo
Journal:  Clin Microbiol Infect       Date:  2002-12       Impact factor: 8.067

Review 8.  Human granulocytic anaplasmosis.

Authors:  Johan S Bakken; Stephen Dumler
Journal:  Infect Dis Clin North Am       Date:  2008-09       Impact factor: 5.982

Review 9.  Emerging tick-borne infections in mainland China: an increasing public health threat.

Authors:  Li-Qun Fang; Kun Liu; Xin-Lou Li; Song Liang; Yang Yang; Hong-Wu Yao; Ruo-Xi Sun; Ye Sun; Wan-Jun Chen; Shu-Qing Zuo; Mai-Juan Ma; Hao Li; Jia-Fu Jiang; Wei Liu; X Frank Yang; Gregory C Gray; Peter J Krause; Wu-Chun Cao
Journal:  Lancet Infect Dis       Date:  2015-10-06       Impact factor: 25.071

10.  Database indexing for production MegaBLAST searches.

Authors:  Aleksandr Morgulis; George Coulouris; Yan Raytselis; Thomas L Madden; Richa Agarwala; Alejandro A Schäffer
Journal:  Bioinformatics       Date:  2008-06-21       Impact factor: 6.937

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.