Literature DB >> 35482762

MafB, WDR77, and ß-catenin interact with each other and have similar genome association profiles.

Lizhi He1, Mingshi Gao2, Henry Pratt2, Zhiping Weng2, Kevin Struhl1.   

Abstract

MafB (a bZIP transcription factor), ß-catenin (the ultimate target of the Wnt signal transduction pathway that acts as a transcriptional co-activator of LEF/TCF proteins), and WDR77 (a transcriptional co-activator of multiple hormone receptors) are important for breast cellular transformation. Unexpectedly, these proteins interact directly with each other, and they have similar genomic binding profiles. Furthermore, while some of these common target sites coincide with those bound by LEF/TCF, the majority are located just downstream of transcription initiation sites at a position near paused RNA polymerase (Pol II) and the +1 nucleosome. Occupancy levels of these factors at these promoter-proximal sites are strongly correlated with the level of paused Pol II and transcriptional activity.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35482762      PMCID: PMC9049301          DOI: 10.1371/journal.pone.0264799

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.752


Introduction

Transient activation of the Src oncoprotein in a non-transformed breast cell line (MCF-10A) mediates an epigenetic switch to a stably transformed state [1]. This epigenetic switch is mediated by a positive feedback loop whose maintenance results in a chronic inflammatory state required for transformation. This loop involves inflammatory transcription factors NF-κB, STAT3, and AP-1 proteins that form complexes that directly regulate hundreds of genes in oncogenic pathways [1-4]. This regulatory network functions coherently in many cancer types, and it provides the basis for a cancer inflammation index that classifies cancer types in a manner distinct from mutation or developmental origin [4]. More than 40 DNA-binding transcription factors contribute to the transformed state in this inducible model of breast cellular transformation, with potential target sites identified via DNA sequence motifs [5]. In addition, cellular transformation depends on transcriptional co-activators that are key components of signal transduction pathways and are recruited to target sites by DNA-binding proteins. Such co-activators include the YAP and TAZ paralogues, the ultimate targets of the Hippo signaling pathway [6], and the calcium-binding cytokines S100A8 and S100A9 [7]. Here, we describe an unexpected connection between MafB, WDR77, and ß-catenin. MafB is a cousin of AP-1 transcription factors, with related but not identical DNA-binding specificity [8]. It ranked 6th on an ordered list of candidate transcription factors involved in transformation, and indeed MafB depletion reduces transformation in this model [5]. In addition, a few reports link MafB to cancer [9-11]. WDR77 is a transcriptional co-activator of the androgen and other hormone receptors [12]. Overexpression of WDR77 stimulates tumorigenesis in breast and other cancer types [13,14]. WDR77 is also a subunit of the 20S methylosome complex that includes PRMT5, an enzyme that symmetrically di-methylates arginines in spliceosomal Sm proteins and histones [15]. ß-catenin, the ultimate effector of the Wnt signaling pathway, plays critical roles in development and diseases including cancer [16-19]. ß-catenin is a major component of adherens junctions at the cell membrane where it regulates cell growth and adhesion. Upon activation of the Wnt pathway, ß-catenin translocates to the nucleus and acts as a transcriptional co-activator, primarily via its interaction with the LEF/TCF family of DNA-binding transcription factors. Here, we show that MafB, WDR77, and ß-catenin are important for transformation, interact directly with each other, and have similar genomic binding profiles. Surprisingly, the majority of common MafB/WDR77/ß-catenin target sites are located just downstream of transcription initiation sites at a position near paused RNA polymerase (Pol) II and the +1 nucleosome. Occupancy levels of these factors at these promoter-proximal sites are strongly correlated with the level of Pol II and transcriptional activity.

Results

The initial connection between MafB, WDR77, and ß-catenin

Our inducible model of breast cellular transformation is based on a derivative of the non-transformed cell line MCF-10A that expresses ER-Src, a fusion between the v-Src oncoprotein and the ligand-binding domain of estrogen receptor [20,21]. Treatment of these cells with tamoxifen activates v-Src and triggers an epigenetic switch between non-transformed and transformed cells. This work began with our interest in transcriptional co-activators involved in cellular transformation in this model. We previously analyzed the YAP and TAZ paralogs that are the ultimate effectors of the Hippo signaling pathway [6], as well as the calcium-binding cytokines S100A8 and S100A9 [7]. Here, we initiated studies on ß-catenin, the ultimate target of the Wnt signaling pathway that acts as a transcriptional co-activator of the LEF/TCF transcription factors and has many connections to cancer [16-19]. Using mass spectrometry, we identify many proteins interacting with ß-catenin, one of which is WDR77. In seemingly unrelated work, we began to further analyze MafB, a cousin of AP-1 transcription factors, that we identified as a strong candidate for being involved in transformation [5]. As discussed below, ChIP-seq experiments revealed a striking similarity in genomic binding profiles of MafB, WDR77, and ß-catenin.

MafB, WDR77, and ß-catenin are important for transformation

Using CRISPR-Cas9, we generated derivatives of the ER-Src cell line individually knocked out for MafB, WDR77, or ß-catenin (Fig 1A). We examined their effect on transformation by their ability to grow in conditions of low attachment in the presence of tamoxifen [22]. All three knockout cell lines show a substantial defect in cell growth in low attachment conditions as compared to the parental cell line (Fig 1B). In contrast, the knockout and parental cell lines show similar growth under conditions of high attachment (Fig 1C). In addition, siRNA depletion experiments indicate that all three of these proteins reduce transcriptional induction of STAT3 (Fig 1D) and AP-1 (Fig 1E) reporter constructs under transformation conditions. Thus, MafB, WDR77, and ß-catenin are important for transformation.
Fig 1

β-catenin, MafB, and WDR77 are important for transformation.

(A) Western blots of β-catenin, MafB, and WDR77 in CRISPR knocked-out (CRISPR-KO) and CRISPR control cells (CRISPR-Ctrl). (B, C) Relative growth in low attachment (B) or normal (high-attachment)(C) conditions of transformed (tamoxifen treated; TAM shown in darker colors) and non-transformed (ethanol treated; ETH shown in lighter colors) cells with the indicated knockouts. (D, E) Relative STAT3 (D) or AP-1 (E) reporter (luciferase) activity in non-transformed and transformed cells upon the indicated siRNA knockdowns. Error bars indicated ± SD of 3 replicates.

β-catenin, MafB, and WDR77 are important for transformation.

(A) Western blots of β-catenin, MafB, and WDR77 in CRISPR knocked-out (CRISPR-KO) and CRISPR control cells (CRISPR-Ctrl). (B, C) Relative growth in low attachment (B) or normal (high-attachment)(C) conditions of transformed (tamoxifen treated; TAM shown in darker colors) and non-transformed (ethanol treated; ETH shown in lighter colors) cells with the indicated knockouts. (D, E) Relative STAT3 (D) or AP-1 (E) reporter (luciferase) activity in non-transformed and transformed cells upon the indicated siRNA knockdowns. Error bars indicated ± SD of 3 replicates.

MafB, WDR77, and ß-catenin physically interact with each other

As mentioned above, WDR77 was identified as a ß-catenin-interacting protein by immunoprecipitation followed by mass spectrometry. To confirm this and the other interactions, we performed co-immunoprecipitation (co-IP) in cytoplasm, nucleoplasm, and chromatin fractions in non-transformed and transformed cells. Each individual protein co-immunoprecipitated the other two proteins in the chromatin fraction (Fig 2A and 2B). This indicates that these three proteins interact with each other, although not necessarily in the same complex. The interactions of ß-catenin with WDR77 and MafB are direct because they can be observed by coimmunoprecipitation of histidine-tagged recombinant proteins generated in E. coli (Fig 2C).
Fig 2

The direct interaction of β-catenin, MafB, and WDR77.

(A) Co-IP of endogenous β-catenin, MafB, and WDR77 proteins in the cytoplasm (Cyt), nucleoplasm (Nuc), and chromatin (Chr) fractions of transformed (T) and non-transformed (E) cells. IgG was used as a co-IP control. (B) Western blots of the indicated proteins in fractions from the cell-free extract prior to the co-IP. Fractions are defined by MEK1/2 (cytoplasm), U1 SnRNP70 (nucleoplasm), and H3 (chromatin). (C) co-IP of recombinant β-catenin, MafB, and WDR77 proteins.

The direct interaction of β-catenin, MafB, and WDR77.

(A) Co-IP of endogenous β-catenin, MafB, and WDR77 proteins in the cytoplasm (Cyt), nucleoplasm (Nuc), and chromatin (Chr) fractions of transformed (T) and non-transformed (E) cells. IgG was used as a co-IP control. (B) Western blots of the indicated proteins in fractions from the cell-free extract prior to the co-IP. Fractions are defined by MEK1/2 (cytoplasm), U1 SnRNP70 (nucleoplasm), and H3 (chromatin). (C) co-IP of recombinant β-catenin, MafB, and WDR77 proteins.

MafB, WDR77, and ß-catenin associate with common genomic loci

We performed ChIP-seq to identify the genomic target sites of MafB, WDR77, and ß-catenin in both non-transformed and transformed cells. Binding by ß-catenin (and to a lesser extent MafB) is increased in transformed cells, whereas binding by WDR77 occurs at similar levels in non-transformed and transformed cells (Fig 3A). We do not understand why transformed cells show increased ß-catenin binding to target sites but not total chromatin binding; perhaps this reflects post-translational modification of ß-catenin in transformed cells. Strikingly, and in accord with their physical interactions, these three proteins bind to many common genomic locations (Fig 3A). As will be discussed in more detail below, most of these common target loci are located near the transcriptional start site (TSS), unlike the preferred distal locations for the AP-1 transcription factor JUND and the YAP and TAZ co-activators that are important for transformation (Fig 3B). As expected from its interaction with LEF/TCF family of transcription factors, ß-catenin target sites are bound by LEF and TCF to comparable extents (Fig 3C).
Fig 3

Similar genome association profiles of ß-catenin, MafB, and WDR77.

(A) Heatmap of ChIP-seq signals of the indicated proteins in tamoxifen- (TAM) or ethanol (ETH)-treated cells. Each row of the heatmap corresponds to a genomic region bound by ß-catenin in transformed cells, with rows sorted by the average ChIP-seq signal across six experiments. TSS-proximal and TSS-distal peaks are shown separately. (B) Percentage of ChIP-seq peaks of the indicated proteins that are TSS proximal. (C) Correlation of TCF and LEF ChIP-seq signals at TSS-proximal and TSS-distal peaks of ß-catenin in transformed cells-TAM peaks. Pearson correlation coefficients are shown.

Similar genome association profiles of ß-catenin, MafB, and WDR77.

(A) Heatmap of ChIP-seq signals of the indicated proteins in tamoxifen- (TAM) or ethanol (ETH)-treated cells. Each row of the heatmap corresponds to a genomic region bound by ß-catenin in transformed cells, with rows sorted by the average ChIP-seq signal across six experiments. TSS-proximal and TSS-distal peaks are shown separately. (B) Percentage of ChIP-seq peaks of the indicated proteins that are TSS proximal. (C) Correlation of TCF and LEF ChIP-seq signals at TSS-proximal and TSS-distal peaks of ß-catenin in transformed cells-TAM peaks. Pearson correlation coefficients are shown.

Many MafB/WDR77/ß-catenin target sites are located just downstream of paused Pol II

Unexpectedly, many of the TSS-proximal ß-catenin, MafB, and WDR77 target sites are located downstream of the TSS (Fig 4, with one example locus shown in panel A). This location is in marked contrast to the location of target sites for YAP (Fig 4B) and numerous transcription factors that are typically located 50–200 bp upstream of the TSS. Peak summit analysis indicates that the ß-catenin, MafB, and WDR77 target sites are located between paused Pol II and the +1 nucleosome, which is defined by associated chromatin mark H3-K4me3 (Fig 4B and 4C). MafB and WDR77 peaks coincide about 25 bp downstream of paused Pol II, whereas ß-catenin peaks are located ~40 bp further downstream (Fig 4C).
Fig 4

Many ß-catenin/MafB/WDR77 sites are located between paused Pol II and +1 nucleosome.

(A) Genome browser view of ChIP-seq signals of the indicated proteins in non-transformed (ETH) or transformed (TAM) calls at an example locus (SNHG5). (B) Histogram of ChIP-seq peak summits around the TSS in transformed cells. (C) Aggregated ChIP-seq signal with the regions between -1000 and +500 with respect to the TSS. Dashed line shows the summit (position with the highest aggregated signal), and the +1 nucleosome is centered at the summit of the H3K4me3 signal.

Many ß-catenin/MafB/WDR77 sites are located between paused Pol II and +1 nucleosome.

(A) Genome browser view of ChIP-seq signals of the indicated proteins in non-transformed (ETH) or transformed (TAM) calls at an example locus (SNHG5). (B) Histogram of ChIP-seq peak summits around the TSS in transformed cells. (C) Aggregated ChIP-seq signal with the regions between -1000 and +500 with respect to the TSS. Dashed line shows the summit (position with the highest aggregated signal), and the +1 nucleosome is centered at the summit of the H3K4me3 signal. These unexpected results made us consider the possibility of an experimental artifact. In this regard, the ß-catenin, MafB, and WDR77 ChIP-seq experiments involved a two-step procedure in which protein-protein crosslinking with a mixture of homobifunctional reagents with different spacer lengths was followed by the formaldehyde treatment to link proteins to DNA. However, multiple lines of evidence argue against an artifact. First, ß-catenin association was observed in chromatin from transformed cells but not non-transformed cells (Figs 3A and 4A). Second, the antibodies for ß-catenin (rabbit), MafB (goat), and WDR77 (mouse) come from different species. Third, biological replicates that involved different chromatin samples gave reproducible results. Fourth, using the same procedure and sometimes the same chromatin samples, the unexpected pattern was not observed in ChIP-seq experiments for YAP, TAZ, or TEAD [6] or other proteins (e.g. the example locus in Fig 4A). Fifth, the pattern observed for ß-catenin, MafB, and WDR77 is quite specific, and it is clearly different from that of a previously described artifact in which virtually any nuclear protein associates weakly with highly transcribed coding regions [23,24].

MafB/WDR77/ß-catenin association near the Pol II pause site is correlated with, but does not affect, transcriptional activity

To identify genes regulated by MafB, WDR77, or ß-catenin, we individually depleted these factors by siRNA-mediated knockdown in tamoxifen-treated cells. RNA-seq analysis identifies ~3000 differentially expressed genes for each depletion as compared with a control siRNA. Roughly equal number of genes show increased or decreased expression, and the transcriptional profiles show significant overlap between differentially expressed genes (Fig 5A and 5B). These transcriptional profiles also resemble those observed upon depletion of various DNA-binding proteins that affect transformation efficiency, reflecting the positive feedback loop required for transformation [5].
Fig 5

ß-catenin/MafB/WDR77 binding is correlated with transcriptional activity.

(A) Number of genes shared between upregulated (top and left) and downregulated (bottom and right) gene sets following RNAi against the indicated proteins. The top-right black square (near-zero shared genes) indicates that the directionality of expression change is highly conserved. (B) Log2 expression fold-change of individual protein-coding genes (rows of the heatmap) between control and RNAi knockdown. (C) Violin plot showing expression levels in transformed cells of sets of genes defined as with or without proximal ß-catenin/MafB/WDR77 ChIP-seq peaks. (D) MA plot showing the gene expression levels of ß-catenin RNAi and control. Blue dots indicate genes whose TSSs are bound by ß-catenin, red dots indicate differentially expressed genes (FDR < 10%), and green dots indicate differentially expressed genes that are bound by ß-catenin (both). The few purple dots indicate that ß-catenin binding is not causally associated with significant changes in gene expression after RNAi knockdown.

ß-catenin/MafB/WDR77 binding is correlated with transcriptional activity.

(A) Number of genes shared between upregulated (top and left) and downregulated (bottom and right) gene sets following RNAi against the indicated proteins. The top-right black square (near-zero shared genes) indicates that the directionality of expression change is highly conserved. (B) Log2 expression fold-change of individual protein-coding genes (rows of the heatmap) between control and RNAi knockdown. (C) Violin plot showing expression levels in transformed cells of sets of genes defined as with or without proximal ß-catenin/MafB/WDR77 ChIP-seq peaks. (D) MA plot showing the gene expression levels of ß-catenin RNAi and control. Blue dots indicate genes whose TSSs are bound by ß-catenin, red dots indicate differentially expressed genes (FDR < 10%), and green dots indicate differentially expressed genes that are bound by ß-catenin (both). The few purple dots indicate that ß-catenin binding is not causally associated with significant changes in gene expression after RNAi knockdown. Genes with MafB/WDR77/ß-catenin binding near paused Pol II have dramatically higher levels of expression than observed in the overall population of genes (Fig 5C). In addition, the level of MafB/WDR77/ß-catenin binding at such sites is correlated with the level of paused Pol II (R = 0.56 for MafB, 0.61 for WDR77, and 0.21 for ß-catenin). However, there is no significant correlation between MafB/WDR77/ß-catenin binding near paused Pol II and differential transcription in cells depleted of any of these factors (Fig 5D).

Discussion

ß-catenin [16-19], MafB [9-11], and WDR77 [13,14] have all been linked to cancer, and they are important for breast cellular transformation in our Src-inducible model. These three proteins, previously unrelated by any functional criterion, interact directly with each other, and they have similar genomic binding profiles. Unexpectedly, most common target sites map downstream of the TSS between paused Pol II and the +1 nucleosome, a location not previously associated with any other protein. How are ß-catenin, MafB, and WDR77 recruited to the region between paused Pol II and the +1 nucleosome? It seems unlikely that they are recruited by Pol II or the +1 nucleosome (with its modifications such as H3-K4me3) because their peak summits do not co-localize, unlike other situations in which co-activators and co-repressors are recruited by DNA-binding proteins [25]. In addition, these three proteins are not associated with other genomic regions bound by Pol II or nucleosomes, and the ChIP-seq signals are not observed by formaldehyde crosslinking alone. However, occupancy levels of the three proteins are strongly correlated with the level of Pol II association at the pause site. This observation suggests that recruitment of ß-catenin, MafB, and WDR77 involves some component related to Pol II pause release. This component could be a protein(s) that is part of the pause release mechanism or a DNA or RNA structure that occurs at this position upon pause release. A more speculative possibility is that the region between paused Pol II and the +1 nucleosome is involved in the formation of a biomolecular condensate [26,27] that attracts the three proteins through interactions (possibly fortuitous) with intrinsically disordered regions [26-28]. The functional significance of ß-catenin, MafB, and WDR77 association with the region between paused Pol II and the +1 nucleosome is unclear. Depletion of any one of these proteins reduces transformation and affects the transcriptional profile in a similar manner as that observed upon depletion of other transcription factors that affect transformation. However, there is no significant correlation between differential transcription in cells depleted of any of these factors and MafB/WDR77/ß-catenin binding. As mentioned above, the association of these three proteins between paused Pol II and the +1 nucleosome may be fortuitous and hence functionally irrelevant. However, it is also possible that MafB/WDR77/ß-catenin does directly affect the transcription of some genes and/or affects a post-transcriptional process that occurs after Pol II pausing.

Materials and methods

Cell lines

MCF-10A-ER-Src cells were grown in DMEM/F12 without phenol red (Thermo Fisher Scientific, 11039–047) + 5% charcoal stripped FBS (Sigma, F6765) containing 1% pen/strep (Thermo Fisher Scientific, 15140122), 20 ng/ml EGF (Peprotech, AF-100-15), 0.5 μg/ml Hydrocortisone (Sigma, H-0888), 0.1 μg/ml cholera toxin (Sigma, C-8052), 10 μg/ml insulin (Sigma, 10516), 2–4 μM AZD0530 (Selleck Chemicals, S1006) as described previously [1,4-6,20]. 1 μM 4 hydroxy tamoxifen (Sigma, H7904) was used to induce the transformation. MDA-MB-231 cells were grown in DMEM (Thermo Fisher Scientific, 11995–073) + 10% FBS (Sigma, TMS-013-B) + 1% pen/strep (Thermo Fisher Scientific, 15140122).

CRISPR knockout and oligo siRNAs knockdown

We used a CRISPR-blasticidin lentiviral based platform to knockout the genes encoding β-catenin, MafB and WDR77 as described previously [6]. The oligo sequences carried were β-catenin—AAACAGCTCGTTGTACCGCTGGG, WDR77—CCCAAATGCGCCCGCCTGCATGG, and MafB—GCTCAAGTTCGACGTGAAGAAGG. For siRNA knockdowns, the following oligo siRNAs were purchased from Dharmacon, negative control, Cat# D-001810-10-20; β-catenin Cat# L-003482-00; MafB, Cat# L-009018-00; STAT3, Cat# L-003544-00; JUNB, Cat# L-003269-00. These oligo siRNAs were transfected into cells using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778050) as described previously [6]. Cells were split 24 hours after oligo siRNA transfection to perform the various assays described below.

Growth in low attachment conditions assay (GILA)

Cellular transformation was evaluated by growth in low attachment [22]. CRISPR knockout cells were seeded into ultra-low attachment surface 96-well plates (Costar, 3474) for four days, and the amount of ATP was measured by the CellTiter-Glo luminescent cell viability assay (Promega, G7571). As a control for cell proliferation, ATP was measured for the same cells left to grow in regular (high attachment) plates for the same four days.

Luciferase reporter assay

After siRNA depletion for 24 hours, luciferase reporter plasmids were transfected into cells by TransIT 2020 transfection reagent (Mirus Bio, MIR5400). 24 hours after transfection, cells were split and treated with either 0.4 μM Tamoxifen (Sigma, H7904) for cell transformation or ethanol as a non-transformed control for 24 h. Firefly and Renilla luciferase activities were determined by Dual-luciferase Reporter Assay kit (Promega, E1910). The STAT3 luciferase reporter plasmid was purchased from Affymetrix, Cat# LR0077. A pGL-AP-1 plasmid containing 6 consensus AP-1 binding sites was used for the evaluation of AP-1 activity and a pRL-CMV plasmid used as an internal control as described previously [6].

Cell fractionation, co-immunoprecipitation (co-IP), mass spectrometry, and recombinant proteins

Co-IP experiments were performed on separated nuclear and cytoplasmic compartments as described previously [6] using antibodies against β-catenin (BD Bioscience, Cat # 610154), WDR77 (Cell Signaling, Cat# 2018), and MafB (Cell Signaling, Cat# 41019). Western blots were performed as described previously (Ji et al., 2019; He et al. 2021) using antibodies against β-catenin (Cell Signaling, Cat#9581), WDR77 (SCBT, Cat# sc-100899), MafB (SCBT, Cat# sc-10022), MEK1/2 (Bethyl Laboratories, Cat# A302-140A-T), U1 SnRNP70 (SCBT, Cat# sc-9571), and H3 (Abcam, Cat# AB1791). Samples for mass spectrometric analysis were prepared by immunoprecipitating nuclear extracts with an antibody against ß-catenin (Cell Signaling Cat# 8480) and Dynabeads Protein G (ThermoFisher Cat # 10003D). Binding proteins on the Dynabeads were eluted with buffer containing 1.5% SDS, 100 mM Tris pH 7.5, and 10 mM DTT, then precipitated with trichloro acetic acid. Proteins were identified by mass spectrometry performed at the Taplin Mass Spectrometry Facility at Harvard Medical School. For assessing direct interactions, recombinant β-catenin, WDR77, and MafB proteins (expressed from pET plasmids in BL21 E. coli cells) were produced as described previously [6] and analyzed by co-IP.

ChIP-seq and RNA-seq

ChIP-seq were performed as described in previously [4,6]. Briefly, cells were dual cross-linked with 2 mM ethylene glycol bis (succinimidyl succinate) (EGS) and disuccinimidyl glutarate (DSG) and 1% formaldehyde. Chromatin was isolated and then fragmented with 60 units MNase (New England Biolabs, M0247S) at 37 0C for 10 minutes. For β-catenin ChIP-seq, cells were first fractionated by Subcellular Protein Fractionation Kit for Cultured Cells (ThermoFisher, Cat# 78840) to obtain a nuclear fraction that was diluted 1:5 with MNase digestion buffer (50 mM HEPES pH 7.9, 140 mM NaCl, 1% Triton X-100, 1 mM CaCl2, 1 mM DTT), and then digested with MNase as above. Antibodies used in the ChIP-seq experiments were against β-catenin (Cell Signaling, Cat#9581), WDR77 (SCBT, Cat# sc-100899), and MafB (SCBT, Cat# sc-10022). For RNA-seq experiments, mRNeasy Mini Kit (Qiagen, No. 217004) was used for RNA extraction. 0.4 μg total RNA was used for RNA-seq library construction by a TruSeq RNA Library Prep Kit V2 (Illumina, RS-122-2001). Both ChIP-seq and RNA-seq libraries were sequenced at the Bauer Core Facility, Harvard.

ChIP-seq data analysis

FASTQ reads were aligned to the human reference genome (GRCh38) using Bowtie2 [29]. samtools-1.9 with MAPQ threshold 30 was used to remove low quality reads and picard-tools-2.18 was used to remove PCR duplicates. SPP was used with—cap-num-peak 300000 to call peaks and IDR-2.0.4 [30] with—soft-idr-threshold 0.05 was used to identify peaks conserved across replicates. Correlation coefficients among replicates were for MafB and WDR77 ranged between 0.8 and 0.95. For ß-catenin, where only one replicate passed quality control, pseudo-replicates were generated by randomly splitting the data in half for further processing. The number of peaks in ethanol (non-transformed) and tamoxifen (transformed) cells were as follows: ß-catenin, 1103 and 3173; MafB, 18091 and 28,503; WDR77, 22,664 and 25,158). Peaks within 2 kb of a GENCODE TSS are considered TSS-proximal; others are considered TSS-distal.

RNA-seq data analysis

We trimmed adapter sequences, ambiguous ‘N’ nucleotides (the ratio of “N” > 5%), and low-quality tags (quality score < 20), then aligned trimmed reads against the GENCODE v30 reference transcriptome [31] using STAR [32] with the following parameters: —outFilterMultimapNmax 20 —alignSJoverhangMin 8 —alignSJDBoverhangMin 1 —outFilterMismatchNmax 999 —outFilterMismatchNoverReadLmax 0.04 —alignIntronMin 20 —alignIntronMax 1000000 —alignMatesGapMax 1000000 —sjdbScore 1 Counts were normalized to TPM (transcripts per million RNA molecules) using RSEM [33] with the following parameters: “—estimate-rspd—calc-ci.” Differential expression analysis was performed with DESeq2 [34] with default parameters. Separate DESeq2 runs were performed for siRNA against each factor, comparing replicates treated with the siRNA against the given factor versus replicates treated with the control siRNA. DESeq2 was performed independently for tamoxifen- and ethanol-treated cells for each siRNA. Genes with a multiple-testing adjusted p-value <0.01 were considered to be differentially expressed.

Histone and Pol-II signal aggregation

We downloaded Pol-II ChIP-seq signal in tamoxifen-treated MCF-10A cells from the ENCODE Portal (accession ENCFF114YIB). We then identified all protein-coding GENCODE v30 TSSs within 2 kb of a ß-catenin peak using bedtools intersect. We aligned these TSSs, oriented them according to strand, and computed the average ChIP-seq signals for ß-catenin, MafB, WDR77, H3K4me3, H3K27ac, and Pol-II from our datasets and the ENCODE dataset around these TSSs using the pyBigWig function in the deepTools2 package [35].

Data deposition

All sequencing data were deposited on National Cancer for Biotechnology Information Gene Expression Omnibus (GEO). GSE195740 is the accession number for all the data, with GSE1957437 being the subset for the ChIP-seq data and GSE195739 for the RNA-seq data. (PDF) Click here for additional data file. 15 Feb 2022 Submitted filename: 122668_1_rebuttal_2283878_r6qwn4.doc Click here for additional data file. 18 Mar 2022
PONE-D-22-04674
MafB, WDR77, and ß-catenin interact with each other and have similar genome association profiles
PLOS ONE Dear Dr. Struhl, thank you for submitting your manuscript to PLOS ONE. After careful consideration, and having read the manuscript myself, I concur with the Reviewer that it has many merits but does not fully meet PLOS ONE’s publication criteria as it currently stands. Specifically, I would focus on point 1 raised by the Reviewer. Point 2 would be a plus, but I don't think it is mandatory, as the data currently stands. Thereafter, I invite you to resubmit a revised version of the manuscript.
Please submit your revised manuscript by May 02 2022 11:59PM. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Roberto Mantovani Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. 2. Thank you for stating the following in the Acknowledgments Section of your manuscript: [This work was supported by grants from the National Institutes of Health to KS (CA 107486) and ZW (HG009446).] We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: [HHS | National Institutes of Health (NIH):Lizhi He,Kevin Struhl CA107486; HHS | National Institutes of Health (NIH):Mingshi Gao,Henry Pratt,Zhiping Weng HG009446] Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 5. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: The manuscript by He et al. describes the physical and genomic association between MafB, WDR77 and β-catenin, three proteins belonging to different families that have been previously reported to be involved in cellular transformation processes. This is a descriptive work by an excellent team with a solid expertise in genomic studies. It is not clear to me whether this a resubmission to Plos One journal or a transfer from another journal, as a Rebuttal letter has been attached by the Authors. Anyway, I have read the answers to Referees’ comments and I agree with the Authors that these results could be useful for the research activity of other scientists studying the role of MafB, WDR77 and β-catenin proteins. In the absence of functional data that would allow to submit the manuscript to higher impact journals, Plos One is the appropriate journal. 1. I respect the frankness of the Authors that stated that the rationale of the work rose from unrelated observations on β-catenin interactors and MafB. Despite this, I believe that the first paragraph of the Results section does not give the reader a clear idea about the research. The Authors reported the reference to their previous works on YAP/TAZ and S100A8/A9, but, as they stated in their Rebuttal, these works are not linked to the present one. I believe that the first paragraph should be differently elaborated to give the reader a better understanding of the work. In the first and third paragraphs, the Authors refer to mass spectrometry experiment that allows to identify WDR77 as β-catenin interactor. Are these results published or can the Author provide some details? 2. I believe that the results would be of great interest to other scientists if the Authors could identify transcription factor binding sites within MafB, WDR77 and β-catenin ChIP-Seq data. Moreover, it would be useful if the Authors could add GO/KEGG analysis of RNA seq profiles. In particular, which are gene categories of differentially expressed genes overlapping between the three transcriptional profiles from RNAi cells showed in Figure 5A-B? Minor: -The MCF10A-ER-SRC cellular model has been previously used and described by the Authors, but I suggest to add at least that tamoxifen treatment is used to induce Src-mediated transformation (second paragraph of the results section:” …in the presence of tamoxifen”) to help readers that did not read previous works. - Statistical analysis should be added for the histograms showed in Fig. 1D-E. - Page 7: the Authors described H3K4me3 and H3K27ac as markers of +1 nucleosome position but they show only H3K4me3 Fig.4C; I suggest to remove H3K27ac from the description. - Please, edit “CRIPSR” in Figure 1A, and “ß-catenin siRN” in Fig. 1D, “noramlized ChIP-seq signal” Fig. 3A. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.
6 Apr 2022 Dear Editors, Attached is a revised version of our paper still entitled “MafB, WDR77, and ß-catenin interact with each other and have similar genome association profiles” (RC2021-01184) for publication in PLOS ONE. I should clarify that the original manuscript was sent to Review Commons and was then transferred to PLOS ONE. The original response was to the reviewers of the manuscript submitted to Review Commons. Here, the response is to the single reviewer of the transferred PLOS ONE manuscript, who suggested a few very minor changes, which we have heeded. Point-by-point responses below. Reviewer 1 1. We agree that readers should not have to go to our previous papers to understand technical aspects of our model. As requested, we added several sentences at the beginning of the results section (first paragraph) that described the key features of the model. The mass spectrometry experiments are now described in the methods, and a table of interacting proteins is now presented (this was an unintended omission for the previous version). 2. Most of the binding sites are those described in detail in the paper. We don’t think it is particularly useful to discuss the other sites as we haven’t learned much. As for the GO/KEGG analysis of regulated genes, we pointed out in our previous response that the expression profiles in the ß-catenin, WDR77, MafB, and TCF4 depletion experiments are similar to each other and to expression profiles in depletions of other proteins important for transformation in our model. This is because anything that affects the positive feedback loop involved in transformation gives very similar gene expression profiles. This has been extensively discussed in our previous papers (cited in the present paper), and indeed GO/KEGG analysis has been done before. In terms of transcriptional and functional pathways, the results in this paper do not add anything beyond the fact that ß-catenin, WDR77, MafB, and TCF4 are part of the transformation pathway. Minor points: All as requested. We added details about tamoxifen in both the results and methods section. I don’t know what statistical analysis is desired in Fig. 1D,E; we show error bars and ±SD of 3 replicates. We deleted H3K27ac from the description of Fig. 4C. We fixed the typographical errors in the Figures (I’m impressed the Reviewer noticed them; we didn’t). Submitted filename: renamed_fd269.doc Click here for additional data file. 18 Apr 2022 MafB, WDR77, and ß-catenin interact with each other and have similar genome association profiles PONE-D-22-04674R1 Dear Dr. Prof. Struhl, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Roberto Mantovani Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 20 Apr 2022 PONE-D-22-04674R1 MafB, WDR77, and ß-catenin interact with each other and have similar genome association profiles Dear Dr. Struhl: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Prof. Roberto Mantovani Academic Editor PLOS ONE
  35 in total

Review 1.  Intrinsically unstructured proteins: re-assessing the protein structure-function paradigm.

Authors:  P E Wright; H J Dyson
Journal:  J Mol Biol       Date:  1999-10-22       Impact factor: 5.469

2.  Fast gapped-read alignment with Bowtie 2.

Authors:  Ben Langmead; Steven L Salzberg
Journal:  Nat Methods       Date:  2012-03-04       Impact factor: 28.547

Review 3.  Biomolecular Condensates in the Nucleus.

Authors:  Benjamin R Sabari; Alessandra Dall'Agnese; Richard A Young
Journal:  Trends Biochem Sci       Date:  2020-07-17       Impact factor: 13.807

4.  Metformin selectively targets cancer stem cells, and acts together with chemotherapy to block tumor growth and prolong remission.

Authors:  Heather A Hirsch; Dimitrios Iliopoulos; Philip N Tsichlis; Kevin Struhl
Journal:  Cancer Res       Date:  2009-09-14       Impact factor: 12.701

5.  RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome.

Authors:  Bo Li; Colin N Dewey
Journal:  BMC Bioinformatics       Date:  2011-08-04       Impact factor: 3.307

6.  STAT3 acts through pre-existing nucleosome-depleted regions bound by FOS during an epigenetic switch linking inflammation to cancer.

Authors:  Joseph D Fleming; Paul G Giresi; Marianne Lindahl-Allen; Elsa B Krall; Jason D Lieb; Kevin Struhl
Journal:  Epigenetics Chromatin       Date:  2015-02-14       Impact factor: 4.954

Review 7.  Wnt some lose some: transcriptional governance of stem cells by Wnt/β-catenin signaling.

Authors:  Wen-Hui Lien; Elaine Fuchs
Journal:  Genes Dev       Date:  2014-07-15       Impact factor: 11.361

8.  S100A8/S100A9 cytokine acts as a transcriptional coactivator during breast cellular transformation.

Authors:  Ruisheng Song; Kevin Struhl
Journal:  Sci Adv       Date:  2021-01-01       Impact factor: 14.136

9.  YAP and TAZ are transcriptional co-activators of AP-1 proteins and STAT3 during breast cellular transformation.

Authors:  Lizhi He; Henry Pratt; Mingshi Gao; Fengxiang Wei; Zhiping Weng; Kevin Struhl
Journal:  Elife       Date:  2021-08-31       Impact factor: 8.140

10.  SUMOylated MAFB promotes colorectal cancer tumorigenesis.

Authors:  Lin-Sen Yang; Xiao-Jian Zhang; Yin-Yin Xie; Xiao-Jian Sun; Ren Zhao; Qiu-Hua Huang
Journal:  Oncotarget       Date:  2016-12-13
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.