| Literature DB >> 35480036 |
Felix Kwame Amevor1, Zhifu Cui1, Xiaxia Du1, Zifan Ning1, Xun Deng1, Dan Xu1, Youhao Wu1, Xueqing Cao1, Shuo Wei1, Gang Shu2, Xue Han3, Yaofu Tian1, Diyan Li1, Yan Wang1, Yao Zhang1, Xiaohui Du1, Qing Zhu1, Xiaoling Zhao1.
Abstract
The current study aims to investigate the effects of the synergy between quercetin and vitamin E in aged hen's diet on hatchability and antioxidant levels of the embryo and newly hatched chicks from prolonged storage eggs. A total of 400 breeder laying hens of 65 weeks of age were selected and randomly divided into 4 groups. Birds were fed a basal diet alone (Control), and basal diets supplemented with quercetin (Q) (0.4 g/kg) and vitamin E (VE) (0.2 g/kg) alone and their combination (0.4 g/kg Q + 0.2 g/kg VE) for 14 weeks, respectively, to determine their effects on yolk antioxidant status, fertility, embryonic mortality, hatchability, antioxidant status of embryonic tissues, as well as the antioxidant status of the newly hatched chicks. The results showed that the hen's dietary Q + VE increased the yolk weight, as well as increased the antioxidant status of the egg yolk (p < 0.05). Compared with the control group, the supplementation of Q + VE significantly increased the hatchability of set-fertile eggs and decreased early embryonic mortality in eggs stored for 7 and 14 days, respectively (p < 0.05), and also improved the antioxidant capacity of the embryos obtained from eggs stored for 14 days (before incubation) (p < 0.05). Moreover, Q + VE increased the levels of SOD, GSH-Px, T-AOC, T-SOD, and CAT in the liver, heart, and pectoral muscle of the embryo, 1-day-old and 14-day-old chicks (p < 0.05), as well as upregulated the antioxidant related genes (GPx-1, GPx-2, GPx-4, DIO-1, and SOD-1) in the liver of the embryo, 1-day-old and 14-day-old chicks hatched from 14-days storage eggs (p < 0.05). Meanwhile, the MDA levels were decreased by the Q + VE in the embryo and post-hatched chicks (p < 0.05). In conclusion, these findings suggested that maternal dietary Q + VE exerts beneficial synergistic effects on the antioxidant capacity of the egg yolk, embryo, and chicks during prolong egg storage, therefore, Q + VE could be used as a dietary measure to enhance hatchability and chick quality in poultry production.Entities:
Keywords: antioxidant capacity; dietary quercetin; egg storage; offspring; vitamin E
Year: 2022 PMID: 35480036 PMCID: PMC9035936 DOI: 10.3389/fphys.2022.873551
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
Ingredient composition and calculated nutrient content of the basal diet (Offspring’s diet) (%, as fed-basis).
| Ingredient | Content (%) | Nutrient | Content |
|---|---|---|---|
| Corn | 50.86 | Metabolizable energy (kcal/kg) | 2,925.00 |
| Soybean meal, 43% | 30.42 | Available phosphorus | 0.45 |
| Wheat flour | 4.00 | Crude protein | 21.80 |
| Soybean oil | 2.36 | Digestible methionine | 0.57 |
| Rapeseed meal | 2.00 | Calcium | 0.95 |
| Gluten meal | 3.00 | Digestible threonine | 0.81 |
| Calcium hydrophosphate | 1.76 | Digestible lysine | 1.25 |
| Vitamin and mineral premix | 0.20 | Vitamin E (mg/kg) | 100.00 |
| Limestone | 1.10 | Digestible methionine + cystine | 0.89 |
| Corn distiller dried grains with solubles | 3.00 | ||
| Threonine, 98.5% | 0.14 | ||
| Sodium chloride | 0.32 | ||
| Choline chloride, 50% | 0.12 | ||
| DL-Methionine, 99% | 0.27 | ||
| L-Lysine hydrochloride, 98.5% | 0.45 | ||
| Total | 100 | ||
Supplied per kg feed: Chicks: VA, 10,000 IU; VD3, 4000 IU; VE, 100 mg; VK3, 3 mg; VB12, 0.02 mg; thiamin, 3.0 mg; pyridoxine, 4 mg; riboflavin, 10 mg; niacin, 65 mg; folic acid, 2 mg; biotin, 0.2 mg; pantothenic acid, 15 mg; copper, 10 mg; iron, 80 mg; manganese, 120 mg; selenium, 0.3 mg; zinc, 100 mg; iodine, 1.0 mg.
Primers used for quantitative real-time polymerase chain reaction (qRT-PCR).
| Gene | Sequence (5′-3′) | Product length (bp) | Annealing Temperature (°C) | Accession number |
|---|---|---|---|---|
|
| F: CTGCAACCAATTCGGGCAC R: CACCTCGCACTTCTCGAACA | 121 | 60.08 | NM_001277853.3 |
|
| F: AGAATGGCGGACGAGTGG R: CTGTACTGCTCCAGGGACAC | 92 | 59.42 | NM_001346448.2 |
|
| F: CACGCAGTAGATGGATGGG R: GCGCTGCGTATTTTGAGCTG | 163 | 60.88 | NM_001097614.2 |
|
| F: TGACCTCGGCAATGTGACTG R: CATGGTACGGCCAATGATGC | 103 | 60.32 | NM_205064.2 |
|
| F: CGCCAAGTCCTTCTACGACC R: GGTGTAATCCCTCACCGTGG | 133 | 60.46 | NM_001277854.3 |
|
| F: TCCTCCACCTTTGATGCG R: GTGCCTGGCTCACTCCTT | 144 | 60 | NM_204305.1 |
Effects of dietary Q, VE, and Q + VE on egg characteristics and yolk antioxidant status.
| Traits | Treatments | ||||
|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | |
| Feed intake (g/day/laying hen) | 93.75b | 95.79b | 103.37ab | 113.9a | 2.61 |
| Egg weight (g) | 44.4b | 54.2ab | 55.3a | 60.2a | 1.8 |
| Yolk weight (g) | 13.9c | 16.6b | 16.7b | 20.9a | 0.7 |
| Yolk ratio (%) | 31.7a | 30.8a | 30.3a | 35.2a | 1.2 |
a,b,c Means in the same row without a common superscript letter differed statistically (p < 0.05). SEM: standard error mean.
Effects of dietary Q, VE, and Q + VE on egg yolk antioxidant status.
| Parameters | Day 7 | Day 14 | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | C | Q | VE | Q + VE | SEM | |
| MDA (nmol/g prot.) | 150.0a | 108.2b | 102.7b | 89.3b | 6.4 | 142.7a | 109.9b | 105.4bc | 88.8c | 5.4 |
| GSH-Px (U/g prot.) | 21.1b | 28.4b | 29.2b | 40.0a | 2.0 | 16.4c | 30.5b | 30.0b | 42.2a | 2.5 |
| T-AOC (μmol/g prot.) | 5.0b | 6.6a | 6.1ab | 7.3a | 0.3 | 4.8c | 6.8ab | 6.4b | 7.74a | 0.3 |
| T-SOD (U/g prot.) | 188.7b | 220.1ab | 212.9ab | 258.7a | 9.0 | 199.7b | 237.6ab | 218.4ab | 266.1a | 8.3 |
| CAT (U/g prot.) | 15.5b | 15.9b | 17.0ab | 22.0a | 0.9 | 14.2b | 16.0b | 17.5b | 22.8a | 1.0 |
a,b,c Means in the same row within the same day without a common superscript letter differed statistically (p < 0.05). SEM: Standard Error Mean. Glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC), catalase (CAT), and total superoxide dismutase (T-SOD), malondialdehyde (MDA).
Impacts of Q, VE, and Q + VE on fertility, embryonic mortality and hatchability.
| Traits | Day 7 | Day 14 | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | C | Q | VE | Q + VE | SEM | |||||||
| Fertility, % | 89.78c | 95.02b | 95.30b | 97.81a | 0.79 | 84.11b | 92.59a | 92.56a | 96.76a | 1.27 | ||||||
| Hatchability of set eggs, % | 68.80b | 73.23ab | 72.47ab | 78.83a | 1.16 | 64.85c | 76.10b | 73.35bc | 87.02a | 2.34 | ||||||
| Hatchability of fertile eggs, % | 71.30b | 76.61ab | 75.80ab | 82.24a | 1.48 | 68.14b | 77.39ab | 75.21ab | 83.75a | 1.96 | ||||||
| First-grade chicks, % | 79.15b | 91.71a | 91.11a | 97.50a | 2.07 | 74.10b | 84.21ab | 86.11ab | 94.22a | 2.48 | ||||||
| Embryonic mortality, % | ||||||||||||||||
| Mid1 | 0.82a | 0.59b | 0.59b | 0.46b | 0.15 | 0.82a | 0.62ab | 0.67b | 0.46b | 0.04 | ||||||
| Late2 | 6.21a | 3.82b | 3.96b | 3.00b | 1.41 | 5.86a | 4.15b | 3.44b | 2.82b | 0.33 | ||||||
| Chick weight, g | 42.28b | 47.81a | 49.30a | 50.37a | 0.74 | 34.71b | 42.62ab | 42.87ab | 49.21a | 1.66 | ||||||
| Relative chick weight, % | 64.14b | 70.65a | 70.08ab | 71.27a | 3.91 | 61.55b | 71.42a | 69.92ab | 75.47a | 1.66 | ||||||
a,b,c Means in the same row within the same day without a common superscript letter differed statistically (p < 0.05). SEM: Standard Error Mean. Fertility (F) % = No. of fertile eggs/total No. of eggs set × 100. Hatchability (H) % = No. of hatched chicks/total No. of eggs set × 100. Fertile (HF) % = No. of hatched chicks/total No. of fertile eggs × 100. Embryonic mortality (EM) % = No. of dead embryos/total No. of hatched chicks x 100.
Dietary effects of Q, VE, and Q + VE on the antioxidant status of the embryo.
| Parameters | Day 7 | Day 14 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | C | Q | VE | Q + VE | SEM | ||
| Liver | |||||||||||
| MDA (nmol/g prot.) | 1.56a | 1.01ab | 0.82b | 0.58b | 0.12 | 2.09a | 1.14ab | 1.03b | 0.75b | 0.17 | |
| GSH-Px (U/g prot.) | 55.88b | 67.58ab | 68.86ab | 83.80a | 3.28 | 78.16b | 131.21b | 152.71b | 187.77a | 14.02 | |
| T-AOC (μmol/g prot.) | 5.54b | 7.38b | 7.47b | 10.59a | 0.52 | 4.86b | 7.65ab | 7.61ab | 10.96a | 0.67 | |
| T-SOD (U/g prot.) | 18.45b | 27.54ab | 24ab | 39.47a | 1.52 | 19.88b | 23.15b | 23.79b | 32.18a | 1.36 | |
| CAT (U/g prot.) | 51.55b | 67.25a | 65.57ab | 73.17a | 2.60 | 66.01b | 61.49b | 73.93ab | 90.25a | 3.55 | |
| Heart | |||||||||||
| MDA (nmol/g prot.) | 2.29a | 0.85b | 1.19ab | 0.90b | 0.20 | 2.10a | 0.83b | 1.27ab | 0.79b | 0.19 | |
| GSH-Px (U/g prot.) | 59.80b | 73.31ab | 68.61ab | 80.80a | 2.92 | 106.20b | 171.28a | 105.81b | 218.20a | 13.60 | |
| T-AOC (μmol/g prot.) | 6.31b | 10.18a | 7.78b | 10.99a | 0.53 | 5.31b | 8.92ab | 10.44a | 12.02a | 0.76 | |
| T-SOD (U/g prot.) | 21.00b | 26.46b | 26.55b | 37.06a | 1.65 | 21.75b | 26.46b | 23.49b | 36.54a | 1.62 | |
| CAT (U/g prot.) | 51.69c | 66.37ab | 65.79b | 78.49a | 2.77 | 60.94b | 66.37b | 59.73b | 94.21a | 4.33 | |
| Pectoral muscle | |||||||||||
| MDA (nmol/g prot.) | 2.43a | 1.14b | 1.33ab | 0.83b | 0.21 | 2.05a | 1.26b | 1.09b | 0.62b | 0.15 | |
| GSH-Px (U/g prot.) | 58.87b | 70.74ab | 73.27ab | 84.27a | 2.85 | 93.31b | 189.99a | 193.47a | 234.14a | 18.15 | |
| T-AOC (μmol/g prot.) | 4.82b | 6.34b | 5.70b | 10.07a | 0.58 | 6.62c | 8.43ac | 11.03a | 11.37a | 0.62 | |
| T-SOD (U/g prot.) | 20.06b | 23.89b | 23.15b | 29.44a | 1.05 | 26.78b | 31.71b | 30.41b | 53.25b | 2.85 | |
| CAT (U/g prot.) | 53.72c | 65.01bc | 71.50b | 82.39a | 2.94 | 45.82b | 71.40a | 68.77a | 81.61a | 3.88 | |
a,b,c Means in the same row within the same day without a common superscript letter differed statistically (p < 0.05). SEM: Standard Error Mean. Glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC), catalase (CAT), and total superoxide dismutase (T-SOD), malondialdehyde (MDA).
Dietary effects of Q, VE, and Q + VE on the antioxidant status of the 1-day-old chicks.
| Parameters | Day 7 | Day 14 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | C | Q | VE | Q + VE | SEM | ||
| Serum | |||||||||||
| MDA (nmol/ml) | 1.70a | 1.06ab | 0.88ab | 0.59b | 0.14 | 2.06a | 0.95b | 0.74b | 0.76b | 0.16 | |
| GSH-Px ((U/mL) | 94.47b | 169.04ab | 146.30b | 288.25b | 22.45 | 107.04c | 174.61bc | 226.80ab | 263.45a | 17.61 | |
| T-AOC (μmol/ml) | 6.23b | 8.68b | 9.44b | 14.50a | 0.94 | 7.04b | 9.94ab | 9.91ab | 13.82a | 0.82 | |
| T-SOD (U/mL) | 22.13c | 32.04b | 32.25b | 39.89a | 1.77 | 17.82b | 26.16b | 34.09ab | 50.19a | 3.72 | |
| CAT (U/mL) | 54.70b | 76.95b | 78.20ab | 111.49a | 6.37 | 63.37c | 88.02ab | 73.68bc | 93.17a | 3.47 | |
| Liver | |||||||||||
| MDA (nmol/g prot.) | 2.59a | 0.91b | 0.96b | 0.69c | 0.22 | 1.66a | 0.99a | 0.96a | 0.63b | 0.13 | |
| GSH-Px ((U/g prot.) | 126.16b | 131.21b | 193.47ab | 259.14a | 18.64 | 91.23b | 129.49ab | 161.59ab | 220.24a | 16.34 | |
| T-AOC (μmol/g prot.) | 6.20b | 8.92ab | 9.28ab | 14.16a | 0.95 | 7.94b | 8.67b | 8.43b | 15.11a | 0.90 | |
| T-SOD (U/g prot.) | 26.21b | 34.29ab | 31.50ab | 43.14a | 2.03 | 21.25b | 26.78b | 23.77b | 34.66a | 1.48 | |
| CAT (U/g prot.) | 54.24c | 62.54bc | 66.11b | 88.23a | 3.40 | 98.03b | 105.93b | 126.47ab | 221.70a | 16.58 | |
| Heart | |||||||||||
| MDA (nmol/g prot.) | 1.77a | 0.97ab | 0.89ab | 0.66b | 0.15 | 2.35a | 0.83b | 1.79ab | 0.83b | 0.22 | |
| GSH-Px ((U/g prot.) | 116.04b | 164.61ab | 183.55ab | 255.70a | 18.36 | 74.67b | 130.94ab | 141.88ab | 184.27a | 13.60 | |
| T-AOC (μmol/g prot.) | 7.90b | 11.65ab | 10.44b | 16.01a | 0.89 | 7.85b | 11.12ab | 10.20ab | 13.92a | 0.70 | |
| T-SOD (U/g prot.) | 23.10b | 26.49b | 23.49b | 36.28a | 1.67 | 23.82b | 25.66b | 29.00ab | 39.69a | 1.97 | |
| CAT (U/g prot.) | 62.30b | 66.01b | 77.20ab | 93.46a | 3.78 | 90.62c | 107.97bc | 115.48b | 218.51a | 13.14 | |
| Pectoral muscle | |||||||||||
| MDA (nmol/g prot.) | 1.76a | 0.88b | 0.84b | 0.72b | 0.14 | 2.00a | 1.25b | 0.98b | 0.67b | 0.15 | |
| GSH-Px ((U/g prot.) | 111.88b | 159.84ab | 168.31ab | 252.71a | 19.49 | 119.02b | 202.00a | 207.45a | 268.29a | 16.17 | |
| T-AOC (μmol/g prot.) | 6.88b | 8.43b | 9.44ab | 13.25a | 0.77 | 4.87b | 8.37ab | 10.87a | 11.37a | 0.84 | |
| T-SOD (U/g prot.) | 21.22b | 24.29ab | 24.36ab | 33.70a | 1.62 | 23.24b | 32.25ab | 28.34b | 38.37a | 1.72 | |
| CAT (U/g prot.) | 47.89b | 71.40a | 64.04ab | 82.50a | 3.86 | 38.32b | 85.06a | 66.21a | 78.54a | 5.56 | |
a,b,c Means in the same row within the same day without a common superscript letter differed statistically (p < 0.05). SEM: Standard Error Mean. Glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC), catalase (CAT), and total superoxide dismutase (T-SOD), malondialdehyde (MDA).
Dietary effects of Q, VE, and Q + VE on the antioxidant status of the 14-day-old chicks.
| Parameters | Day 7 | Day 14 | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | C | Q | VE | Q + VE | SEM | |
| Serum | ||||||||||
| MDA (nmol/g ml) | 1.69a | 0.88b | 0.79b | 0.52b | 0.13 | 2.13a | 0.75b | 0.82b | 0.57b | 0.69 |
| GSH-Px (U/g mL) | 78.67b | 143.44ab | 149.38ab | 224.27a | 17.18 | 98.56b | 203.25a | 173.31a | 234.33a | 16.06 |
| T-AOC (μmol/g ml) | 7.40b | 11.87b | 11.20b | 18.95a | 1.20 | 9.24c | 12.98b | 13.11b | 19.07a | 0.93 |
| T-SOD (U/g mL) | 22.52b | 33.20a | 33.05a | 41.35a | 2.01 | 23.40b | 30.94b | 29.36b | 49.03a | 2.65 |
| CAT (U/g mL) | 57.59b | 93.91a | 79.23ab | 94.98a | 4.80 | 43.38c | 80.18b | 74.46b | 102.41a | 5.92 |
| Liver | ||||||||||
| MDA (nmol/g prot.) | 2.45a | 1.38b | 0.96b | 0.59b | 0.21 | 2.18a | 0.61b | 1.03b | 0.58b | 0.20 |
| GSH-Px (U/g prot.) | 117.71b | 108.07b | 204.32a | 219.30a | 13.34 | 94.84b | 189.65a | 152.71ab | 213.45a | 14.52 |
| T-AOC (μmol/g prot.) | 4.78c | 7.80bc | 10.09b | 14.84a | 1.07 | 9.10c | 11.48bc | 12.36b | 17.62a | 0.87 |
| T-SOD (U/g prot.) | 23.20b | 30.42ab | 31.26ab | 37.19a | 1.59 | 23.65b | 29.44ab | 29.09ab | 38.53a | 1.76 |
| CAT (U/g prot.) | 60.62b | 83.77a | 73.93ab | 87.17a | 3.32 | 50.35b | 78.99a | 88.93a | 98.51a | 5.18 |
| Heart | ||||||||||
| MDA (nmol/g prot.) | 1.88a | 0.93b | 0.73b | 0.45b | 0.64 | 2.13a | 1.03b | 0.88b | 0.84b | 0.17 |
| GSH-Px (U/g prot.) | 102.52b | 171.28a | 105.81b | 218.20a | 14.04 | 96.11b | 193.25a | 140.81ab | 201.83a | 14.83 |
| T-AOC (μmol/g prot.) | 6.29b | 6.85b | 8.28b | 14.43a | 3.95 | 9.44c | 11.36b | 11.94bc | 15.51a | 0.28 |
| T-SOD (U/g prot.) | 25.59b | 28.96b | 29.97b | 37.44a | 1.29 | 22.88b | 31.46ab | 27.99ab | 35.54a | 1.61 |
| CAT (U/g prot.) | 58.87b | 89.16a | 77.23ab | 97.48a | 4.55 | 61.59b | 81.25ab | 69.37ab | 98.21b | 4.24 |
| Pectoral muscle | ||||||||||
| MDA (nmol/g prot.) | 2.23a | 1.31b | 0.82b | 0.72b | 0.17 | 1.97a | 0.77b | 0.84b | 0.51b | 0.16 |
| GSH-Px (U/g prot.) | 116.52b | 157.74ab | 162.97ab | 246.64a | 16.66 | 110.88b | 181.34ab | 193.47ab | 242.87a | 15.85 |
| T-AOC (μmol/g prot.) | 8.69b | 9.44b | 9.51b | 18.62a | 1.13 | 9.34b | 11.08b | 11.44b | 16.94a | 0.82 |
| T-SOD (U/g prot.) | 22.55c | 29.95b | 29.80b | 37.35a | 1.47 | 25.37b | 31.71ab | 30.41ab | 36.90a | 1.49 |
| CAT (U/g prot.) | 55.88b | 77.18b | 72.21b | 103.91a | 5.28 | 62.71b | 73.70b | 75.70b | 96.49a | 3.69 |
a,b,c Means in the same row within the same day without a common superscript letter differed statistically (p < 0.05). SEM: Standard Error Mean. Glutathione peroxidase (GSH-Px), total antioxidant capacity (T-AOC), catalase (CAT), and total superoxide dismutase (T-SOD), malondialdehyde (MDA).
Effects of dietary Q, VE, Q + VE on mRNA expression of liver antioxidant genes of the embryo, chicks at day-1 and day 14.
| Parameters | Day7 | Day 14 | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| C | Q | VE | Q + VE | SEM | C | Q | VE | Q + VE | SEM | |
| Embryo’s liver | ||||||||||
| GPx-1 | 1.05c | 1.94bc | 2.13b | 3.28a | 0.16 | 0.74b | 2.96a | 3.18a | 3.76a | 0.20 |
| GPx-4 | 1.09b | 2.93a | 3.34a | 3.56a | 0.19 | 0.91b | 2.70a | 2.67a | 3.33a | 0.19 |
| DIO-1 | 1.02b | 1.62b | 1.53b | 2.97a | 0.15 | 0.99b | 2.30a | 2.24a | 2.79a | 0.14 |
| SOD-1 | 1.00b | 3.04a | 2.54a | 3.36a | 0.22 | 1.02c | 3.18a | 2.26b | 3.23a | 0.16 |
| GPx-2 | 1.09c | 2.57b | 1.87bc | 3.60a | 0.16 | 0.98b | 2.40a | 2.44a | 3.09a | 0.17 |
| 1-Day old chick’s liver | ||||||||||
| GPx-1 | 1.05b | 2.31a | 2.58a | 3.00a | 0.16 | 1.03c | 3.60ab | 3.08b | 4.23a | 0.18 |
| GPx-4 | 1.01b | 2.29a | 2.58a | 3.31a | 0.17 | 1.05b | 3.26a | 3.05a | 3.50a | 0.18 |
| DIO-1 | 1.06b | 2.69a | 2.49ab | 3.38a | 0.22 | 1.01c | 3.03b | 3.31ab | 4.26a | 0.20 |
| SOD-1 | 1.00b | 2.88a | 3.46a | 3.93a | 0.21 | 1.03c | 2.95b | 3.24ab | 3.84a | 0.17 |
| GPx-2 | 1.04b | 2.69a | 2.49a | 3.38a | 0.22 | 1.09c | 2.02b | 2.95a | 3.05a | 0.15 |
| 14-Day old chick’s liver | ||||||||||
| GPx-1 | 1.06b | 2.63a | 2.74a | 3.13a | 0.14 | 1.00c | 2.11b | 2.26ab | 3.32a | 0.17 |
| GPx-4 | 1.09b | 3.01a | 3.06a | 3.32a | 0.15 | 1.09b | 1.87ab | 1.62b | 2.84a | 0.16 |
| DIO-1 | 1.08c | 3.07b | 2.99b | 3.84a | 0.13 | 1.03c | 2.03ab | 1.73bc | 2.68a | 0.14 |
| SOD-1 | 1.06c | 2.70b | 2.25bc | 4.03a | 0.20 | 1.00c | 2.32b | 1.62bc | 2.98a | 0.16 |
| GPx-1 | 1.02b | 1.57ab | 1.68ab | 3.34a | 0.14 | 1.05b | 3.15a | 3.08a | 3.45a | 0.19 |
a,b,c Means in the same row within the same day without a common superscript letter differed statistically (p < 0.05). SEM: standard error mean.