Literature DB >> 35465114

Dennettia tripetala Relieves Chronic Hepatorenal Injuries in Rats by Altering fas, sod-1, and tnf-α Expression.

Sylvia Oghogho Omage1, Noghayin E J Orhue1, Kingsley Omage2,3.   

Abstract

The effectiveness of Dennettia tripetala extracts was compared to that of the standard drug, silymarin, in reducing chronic liver and kidney anomalies. Male albino Wistar rats were grouped in tens. Carbon tetrachloride was dissolved in olive oil (1:4) and administered to specific groups at a dose of 3 mL/kg body weight (bw) twice a week for six weeks. From week five, the extracts and silymarin were administered in distilled water daily for two weeks at doses of 250 mg/kg bw and 6 mg/kg bw, respectively, to specific groups. All administrations were carried out using a gavage, with appropriate controls. These results showed that the plant extracts decreased the serum activity of liver marker enzymes, restored the liver and serum lipid profiles as well as serum protein profile, reduced serum, urea, and creatinine, and restored superoxide dismutase and catalase activities in the liver and kidneys, which carbon tetrachloride had altered. The extracts also decreased steatosis and centriole congestion in the liver as well as necrosis and structural damage in the kidneys, which carbon tetrachloride caused, and the extracts proved to be as potent as silymarin. The extracts also decreased the expression of fas (P<0.05), sod-1 (P<0.05), and tnf-α (P>0.05) in the liver, which carbon tetrachloride had increased. Conclusively, D. tripetala reduced chronic liver and kidney damage induced by carbon tetrachloride; it reduced the expression of fas, sod-1, and tnf-α in the liver to levels similar to that of the control group, and it was as effective as silymarin.
Copyright © 2022 by The Korean Society of Food Science and Nutrition. All rights Reserved.

Entities:  

Keywords:  Dennettia tripetala; antioxidant; dose-response; hormesis; liver disease

Year:  2022        PMID: 35465114      PMCID: PMC9007709          DOI: 10.3746/pnf.2022.27.1.89

Source DB:  PubMed          Journal:  Prev Nutr Food Sci        ISSN: 2287-1098


INTRODUCTION

The liver and kidneys are responsible for many important metabolic processes that support life. One of such vital function of the liver is drug detoxification (Al-Yahya et al., 2013). Interestingly, the detoxification of toxic substances can cause the liver to be susceptible to injury. Cytochrome P-450 (CYP450) enzymes are also present in the kidneys, and they help to further break down toxic substances, thereby predisposing the kidneys to injury (Al-Yahya et al., 2013). Diseases of the liver and kidneys can be life-threatening, and the options for managing these diseases are currently very expensive. There is, therefore, a need to find medicines that effectively heal these organs and are highly affordable. Several researchers are now turning to plants, in the search for active medicinal substances. This is because plants contain powerful chemicals that elicit medicinal actions in humans and animals. Also, numerous drugs currently used for treating patients have their starting compounds from medicinal plants. Silymarin, for example, is a standard drug for managing liver injury, and it is an extract of the milk thistle plant, also known as Silybum marianum (Karimi et al., 2011). Dennettia tripetala is a spicy plant native to West Africa. It is also known as “Mmimi”, “Ata Igbere”, and “Ako” in Igbo, Yoruba, and Edo languages, respectively. It is consumed as a fruit as well as for medicinal purposes, including the management of cough, diabetes, fever, diarrhea, sore throat, and nausea (Iseghohi, 2015). It possesses analgesic and anti-inflammatory properties (Oyemitan et al., 2008) as well as anti-diabetic properties (Anaga and Asuzu, 2010). Carbon tetrachloride was previously used as a refrigerant, an industrial solvent, and in fire extinguishers until it was found to be hepatotoxic and carcinogenic. The mechanisms by which it exerts its toxicity are well-known. Cytochrome P450 enzymes in the liver and kidneys break down carbon tetrachloride into its free radical metabolites: trichloromethyl and trichloromethyl peroxy radicals, causing adduct formation and lipid peroxidation, respectively, to macromolecular constituents of the cell (Weber et al., 2003). This causes injury to the cells of the liver and kidney. The injury is usually in the form of lipid accumulation in hepatocytes, loss of calcium sequestration, oxidative stress, scar tissue formation (in hepatocytes), increased membrane permeability, and necrosis, among others (Weber et al., 2003). A previous finding by a Spanish group (López-Martín et al., 2002) noting that the essential oil of D. tripetala contains uvariopsine (an alkaloid that aids bile secretion and improves liver health), prompted the evaluation of the potential of the extracts of this plant to ease hepatorenal injuries in vivo. In this study, carbon tetrachloride was used to cause chronic liver and kidney injury in rats, and the aqueous and ethanolic extracts of D. tripetala were tested for their potency in alleviating such chronic damage. The effectiveness of the plant extracts was compared to a standard drug for managing liver damage (silymarin) and observed differences in the selected genes’ expression in the liver to identify some mechanisms by which the plant extracts work.

MATERIALS AND METHODS

Plant extracts

Ripe D. tripetala fruits were harvested on a farm in the Ikpoba-okha area of Benin City, Nigeria. The plant name was checked with http://www.theplantlist.org. A Botanist identified the fruits in the Department of Plant Biology and Biotechnology, University of Benin, Nigeria, and a voucher specimen number (UBHD360) was allocated. The fruits were diced, sun dried, and pulverized to a fine powdery form. For the aqueous extract, four liters of distilled water was used to soak 500 g of the powder, while for the ethanolic extract, four liters of ethanol was used to soak 500 g of the powder. The soaking lasted for two days with regular stirring, followed by sieving using a clean cloth and concentration using a freeze dryer. Finally, the freeze-dried extracts were reconstituted in distilled water for administration to animals.

Experimental design

Eighty healthy male albino rats of Wistar strain were purchased from the animal house of the Department of Anatomy, University of Benin. The animals were acclimatized for two weeks and then distributed randomly into eight groups of ten rats each. Table 1 shows the groups and what they were administered. The experimental substances were orally administered using a gavage. CCl4 was dissolved in olive oil in a ratio of 1:4 and administered at a dose of 3 mL/kg body weight (bw). The plant extracts were administered at 250 mg/kg bw dose, and silymarin was dissolved in distilled water and administered at a dose of 6 mg/kg bw. The administration period of each experimental substance is described in Fig. 1. The safety and comfort of the animals were taken into special consideration throughout the experiment, and the Animal Ethics Committee of the Faculty of Life Sciences, University of Benin approved all experimental protocols (approval number: LS16106). The experiments were conducted following the NIH guidelines for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978).
Table 1

Groups of animals and treatments administered

GroupTreatment
1Control
2CCl4
3CCl4+AQDT
4CCl4+ETDT
5CCl4+silymarin
6AQDT
7ETDT
8Silymarin

AQDT, aqueous extract of Dennettia tripetala; ETDT, ethanolic extract of D. tripetala.

Fig. 1

Duration of administration of CCl4 and Dennettia tripetala.

CCl4 was administered twice a week for six weeks. From week five until week six, D. tripetala was administered daily to the respective groups. Silymarin was also administered to the respective groups of rats daily from week five until week six. The rats in the control group were given feed and water only. After an overnight fast, the experiment was terminated by sacrificing the animals using chloroform anesthesia. The blood, liver, and kidney were collected for biochemical, molecular, and histopathological analyses. The blood was centrifuged at 3,500 rpm for ten minutes after clotting, and serum was retrieved and stored at 4°C. Weighed portions of the liver and kidney were also homogenized in normal saline and centrifuged at 4,000 rpm for 15 min, and the supernatant was stored at −20°C.

Biochemical assays

All reagent kits used in this study were purchased from Randox Laboratories Ltd. (Crumlin, UK). The manufacturer’s protocols were strictly followed. For malodialdehyde, superoxide dismutase (SOD), and catalase assays, the methods used are those of Buege and Aust (1978), Misra and Fridovich (1972), and Góth (1991), in the respective order. The chemicals used for these three assays were purchased from Pyrex chemicals, Benin City, Nigeria. They were pure and of analytical grade. The sera were assayed for the activities of aspartate transaminase (AST), alanine transaminase (ALT), and alkaline phosphatase (ALP), as well as the concentrations of total cholesterol, triglyceride, total protein, and albumin. The liver and kidney homogenates were assayed for the activities of the antioxidant enzymes SOD and catalase as well as the lipid peroxidation product, malondialdehyde.

Molecular assays

A weighed portion of liver was cut from rats in each group and stored in an Invitrogen RNA stabilization solution before RNA extraction. RNA was extracted from the liver samples using ISOLATE II RNA mini kit (Meridian Bioscience, Memphis, TN, USA), and the manufacturer’s protocols were adhered to strictly. A Nanodrop (NanoDrop ND-1000, Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the purity and quantity of the isolated RNA. The integrity of the isolated RNA was also confirmed using agarose gel electrophoresis. The isolated RNA was converted to complementary DNA (cDNA) using SensiFAST cDNA synthesis kit (Bioline, London, UK), and the manufacturer’s protocols were adhered to strictly. Real time-polymerase chain reaction (PCR) was conducted on the cDNA obtained to observe the differences in the expression of some selected genes (fas, sod-1, and tnf-α; β-actin was used as an internal PCR control). The primers were synthesized by Inqaba Biotechnical Industries (Pty) Ltd. (Pretoria, South Africa), and their sequences are shown in Table 2.
Table 2

Primers used for polymerase chain reaction

GenePrimer (5’→3’)
β-actin
ForwardCGTGACATCAAAGAGAAGCTGTGC
ReverseGCTCAGGAGGAGCAATGATCTTGAT
fas
ForwardCTCCAGACATTGTTC
ReverseCGCCTATGGTTGTTGACC
sod-1
ForwardGCAGGACCTCATTTTAATCCTCACT
ReverseAGGTCTCCAACATGCCTCTCTTC
tnf-α
ForwardACAGAAAGCATGATCCGC
ReverseCTCGGACCCCTGGACGTA
The thermocycler used was a Labnet MultiGene mini thermocycler (Sigma-Aldrich Co., St. Louis, MO, USA), and a UV transilluminator from Biologix (Camarillo, CA, USA) was also used. Images were captured using an Accuris Smart Doc imaging system and camera. Image J (U.S. National Institutes of Health, Bethesda, MD, USA) was used to quantify the light intensity from the bands, and GraphPad Prism version 7.0 (GraphPad Software, San Diego, CA, USA) was used to analyze the data.

Histopathology

Portions of the liver and kidney were fixed in 10% neutral buffered formalin for histopathological analysis. A Leica TP2010 automatic tissue processor (Leica Biosystems, Wetzlar, Germany) was used to process the tissues stained with hematoxylin and eosin and viewed under a light microscope using 40× magnification.

Statistical analysis

GraphPad Prism version 7.0 (GraphPad Software, San Diego, CA, USA) was used to analyze the data. The data were subjected to a one-way ANOVA, and the results were presented as mean±standard error of mean.

RESULTS

The results show that chronic exposure to carbon tetrachloride, increased the serum activities of AST, ALT, and ALP, and both plant extracts dampened this elevation significantly, but they were not as potent as the standard drug, silymarin (Table 3). Chronic exposure to carbon tetrachloride also increased the serum concentration of cholesterol and decreased the serum triglyceride concentration. Both plant extracts significantly dampened these distortions just as effectively as silymarin (Table 4). Chronic exposure to carbon tetrachloride increased liver cholesterol and triglyceride concentrations, and both plant extracts significantly dampened the increases but not as effectively as silymarin (Table 5).
Table 3

Effect of Dennettia tripetala extracts on liver marker enzymes in the serum of rats chronically exposed to carbon tetrachloride (unit: U/L)

GroupAspartate transaminaseAlanine transaminaseAlkaline phosphatase
Control236.42±6.21a59.61±4.71a37.60±2.71a
CCl4812.73±4.17d462.90±14.22d48.59±2.03b
AQDT 250 mg/kg bw+CCl4520.62±12.23c245.80±8.62c46.24±5.12b
ETDT 250 mg/kg bw+CCl4546.50±18.64c257.30±7.73c48.61±1.62b
Silymarin+CCl4340.40±16.91b101.50±16.12b39.12±4.59a
AQDT 250 mg/kg bw236.60±2.38a62.23±15.19a36.12±2.88a
ETDT 250 mg/kg bw237.14±1.12a65.72±13.12a36.44±7.45a
Silymarin242.71±3.27a61.60±6.74a37.84±4.50a

The values are presented as mean±SEM (n=10).

Different letters (a-d) in the same column are significantly different at P<0.05.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Table 4

Effect of Dennettia tripetala extracts on serum lipid profile of rats chronically exposed to carbon tetrachloride (unit: mg/dL)

GroupTotal cholesterolTriglyceride
Control39.41±1.12a129.51±3.64c
CCl450.24±3.59c85.96±2.81a
AQDT 250 mg/kg bw+CCl444.52±1.15b117.42±3.72b
ETDT 250 mg/kg bw+CCl443.12±1.68b119.38±1.19b
Silymarin+CCl443.68±1.24b116.54±4.43b
AQDT 250 mg/kg bw39.82±2.76a130.12±3.91c
ETDT 250 mg/kg bw40.24±0.32a127.64±2.24c
Silymarin40.10±2.54a128.67±2.42c

The values are presented as mean±SEM (n=10).

Different letters (a-c) in the same column are significantly different at P<0.05.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Table 5

Effect of Dennettia tripetala extracts on liver lipid profile of rats chronically exposed to carbon tetrachloride (unit: mg/dL)

GroupTotal cholesterolTriglyceride
Control45.64±1.64a15.45±0.54a
CCl456.28±0.38c31.64±2.13c
AQDT 250 mg/kg bw+CCl449.83±1.91b21.20±3.18b
ETDT 250 mg/kg bw+CCl450.21±0.69b20.98±0.69b
Silymarin+CCl447.22±0.24a18.69±5.02a
AQDT 250 mg/kg bw44.23±3.62a14.78±1.71a
ETDT 250 mg/kg bw44.98±1.02a16.21±1.24a
Silymarin46.12±2.12a15.21±1.13a

The values are presented as mean±SEM (n=10).

Different letters (a-c) in the same column are significantly different at P<0.05.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Table 6 shows that chronic exposure to carbon tetrachloride significantly increased the total protein concentration and globulin concentration in the serum with a concomitant decrease in serum albumin concentration. Both plant extracts significantly dampened these distortions just as effectively as silymarin. Table 7 shows that chronic exposure to carbon tetrachloride increased the activities of SOD and catalase in the liver. The increase in the lipid peroxidation marker (malondialdehyde) was not significant under the conditions of this experiment. The plant extracts worked as effectively as silymarin to bring the activities of the antioxidant enzymes and the malondialdehyde concentration in the liver to normal levels. Table 8 shows that chronic exposure to carbon tetrachloride increased serum urea and creatinine concentrations. Both plant extracts restored these metabolites to normal levels. Table 9 shows that chronic exposure to carbon tetrachloride increased the activities of SOD and catalase in the kidney. The increase in the lipid peroxidation marker (malondialdehyde) was not significant under the conditions of this experiment. The plant extracts significantly dampened the changes in the activities of the antioxidant enzymes and the malondialdehyde concentration in the kidney.
Table 6

Effect of Dennettia tripetala extracts on serum protein profile of rats exposed chronically to carbon tetrachloride (unit: g/dL)

GroupTotal proteinAlbuminGlobulin
Control7.92±0.43a3.72±0.03c4.42±0.19a
CCl423.45±0.91c2.10±0.09a20.61±0.24c
AQDT 250 mg/kg bw+CCl412.75±3.02b3.10±0.08b8.71±0.49b
ETDT 250 mg/kg bw+CCl414.12±1.61b3.23±0.13b10.92±0.61b
Silymarin+CCl410.64±0.74b3.24±0.04b7.42±0.13b
AQDT 250 mg/kg bw8.69±0.84a3.79±0.14c4.53±0.30a
ETDT 250 mg/kg bw7.93±0.50a3.82±0.06c4.22±0.12a
Silymarin8.32±0.33a3.61±0.02c4.41±0.61a

The values are presented as mean±SEM (n=10).

Different letters (a-c) in the same column are significantly different at P<0.05.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Table 7

Effect of Dennettia tripetala extracts on antioxidant enzyme activity, and lipid peroxidation status in liver of rats exposed chronically to carbon tetrachloride (unit: unit/g wet tissue)

GroupSuperoxide dismutaseCatalaseMalodialdehyde
Control1,540.1±5.2a4,120.1±34.2a0.09±0.01ns
CCl41,991.2±17.5b4,549.0±16.2b0.11±0.02
AQDT 250 mg/kg bw+CCl41,521.1±13.9a4,144.4±8.9a0.10±0.01
ETDT 250 mg/kg bw+CCl41,570.3±6.2a4,178.2±10.4a0.10±0.02
Silymarin+CCl41,566.3±8.9a4,171.3±7.7a0.09±0.01
AQDT 250 mg/kg bw1,573.2±12.2a4,186.1±15.7a0.09±0.02
ETDT 250 mg/kg bw1,776.4±22.5ab4,205.0±67.2a0.08±0.01
Silymarin1,599.2±5.4a4,197.3±9.9a0.08±0.01

The values are presented as mean±SEM (n=10).

Different letters (a,b) in the same column are significantly different at P<0.05.

nsNot significant.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Table 8

Effect of Dennettia tripetala extracts on urea and creatinine concentration in the serum of rats exposed chronically to carbon tetrachloride (unit: mg/dL)

GroupUreaCreatinine
Control7.74±0.50a1.32±0.12a
CCl412.69±0.46b3.19±0.45b
AQDT 250 mg/kg bw+CCl48.26±0.62a1.92±0.62a
ETDT 250 mg/kg bw+CCl47.97±0.41a1.68±0.35a
Silymarin+CCl48.13±0.57a1.40±0.06a
AQDT 250 mg/kg bw7.85±0.19a1.41±0.10a
ETDT 250 mg/kg bw7.20±0.72a1.39±0.08a
Silymarin7.82±0.21a1.34±0.04a

The values are presented as mean±SEM (n=10).

Different letters (a,b) in the same column are significantly different at P<0.05.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Table 9

Effect of Dennettia tripetala extracts on antioxidant enzyme activity, and lipid peroxidation status in the kidney of rats exposed chronically to carbon tetrachloride

GroupSuperoxide dismutase [units/g wet tissue (×10−2)]Catalase (unit/g wet tissue)Malodialdehyde (unit/g wet tissue)
Control552.1±15.2a4,118.1±9.2a0.24±0.02ns
CCl4974.0±12.6c5,023.4±14.3c0.26±0.01
AQDT 250 mg/kg bw+CCl4865.4±6.7b4,465.2±1.4b0.25±0.01
ETDT 250 mg/kg bw+CCl4834.2±8.7b4,421.1±12.6b0.25±0.02
Silymarin+CCl4582.0±25.3a4,294.0±22.7a0.24±0.01
AQDT 250 mg/kg bw563.4±4.5a4,154.0±4.3a0.24±0.02
ETDT 250 mg/kg bw570.3±3.8a4,139.2±5.1a0.23±0.01
Silymarin581.0±12.2a4,172.3±13.2a0.23±0.01

The values are presented as mean±SEM (n=10).

Different letters (a-c) in the same column are significantly different at P<0.05.

nsNot significant.

AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala; bw, body weight.

Fig. 2 shows that chronic exposure to carbon tetrachloride severely distorted the liver architecture, including but not limited to: fatty accumulation, severe congestion of the centrioles, dilated sinusoidal spaces, and inflammatory changes. Both extracts reduced the severity of the distortions to similar extents as silymarin could. Fig. 3 shows that chronic exposure to CCl4 distorted the kidney architecture, including severe disruption in the microanatomy of the renal cortex and edema. Both extracts reduced the severity of the distortions to similar extents as silymarin did.
Fig. 2

Effect of Dennettia tripetala extracts on liver morphology. (A) Liver section from control rat. (B) Liver section from rat treated with CCl4 showing highly congested centriole, fatty accumulation, hydropic changes, dilated sinusoidal spaces, focal inflammatory changes. (C) Liver section from rats treated with 250 mg/kg body weight (bw) AQDT and CCl4 showing remarkable recovery from steatosis and centriole congestion with scanty inflammatory cells surrounding the centriole and mild sinusoidal space dilation. (D) Liver section from rats treated with 250 mg/kg bw ETDT and CCl4, showing remarkable recovery from centriole congestion although with fatty accumulation. (E) Liver section from rats treated with silymarin and CCl4, showing remarkable recovery from centriole congestion with fatty accumulation, dilated sinusoidal spaces and inflammatory changes. (F) Liver section from rats treated with AQDT, showing normal liver histology. (G) Liver section from rats treated with ETDT, showing congested centriole but otherwise normal liver histology. (H) Liver section from rats treated with silymarin, showing normal liver histology. The liver sections were stained with H&E and observed with a 40× magnification. AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala.

Fig. 3

Effect of Dennettia tripetala extracts on kidney morphology. (A) Kidney section from control rat. (B) Kidney section from rat treated with CCl4, severe distortion and disruption in microanatomy of the renal cortex, including queried edema, when compared to the control. (C) Kidney section from rats treated with 250 mg/kg body weight (bw) AQDT and CCl4, showing some varying degree of distortion and disruption in microanatomy of the renal cortex. (D) Kidney section from rats treated with 250 mg/kg bw ETDT and CCl4, showing some varying degree of distortion and disruption in microanatomy of the renal cortex. (E) Kidney section from rats treated with silymarin and CCl4, showing some varying degree of distortion and disruption in microanatomy of the renal cortex. (F) Kidney section from rats treated with AQDT, showing normal kidney histology. (G) Kidney section from rats treated with ETDT, showing normal kidney histology. (H) Kidney section from rats treated with silymarin, showing normal kidney histology. The kidney sections were stained with H/E and observed with a 40× magnification. AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala.

Fig. 4 shows that chronic exposure to CCl4 significantly increased the expression of fas in the liver. Both extracts of D. tripetala significantly reduced fas expression to levels similar to control. The aqueous extract was slightly more potent than silymarin, while the ethanolic extract was just as effective as silymarin. The administration of either extract alone did not significantly change fas expression compared to the control group.
Fig. 4

Effect of Dennettia tripetala extracts on fas RNA expression in the liver of rats exposed chronically to CCl4. Significantly different from the control group at #P<0.05 and the CCl4 group at *P<0.01. The results depicted were normalized to β-actin. AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala.

Fig. 5 shows that a six-week CCl4 administration significantly increased the expression of sod-1 in the liver of rats. The administration of both extracts of D. tripetala for two weeks significantly reduced sod-1 expression to levels not significantly different from the control group. The aqueous extract was slightly more potent than silymarin, while the ethanolic extract was as potent as silymarin. Administration of the aqueous extract alone did not significantly alter sod-1 expression compared to the control group. Conversely, the ethanolic extract seemed to increase the level of sod-1 slightly compared to the control group, although this was not statistically significant.
Fig. 5

Effect of Dennettia tripetala extracts on sod-1 RNA expression in the liver of rats exposed chronically to CCl4. Signifi-cantly different from the control group at #P<0.0001 and the CCl4 group at *P<0.01. The results depicted were normalized to β-actin. AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala.

Fig. 6 shows that a six-week carbon tetrachloride administration slightly increased tnf-α expression, although this was not statistically significant. A two-week administration of D. tripetala aqueous extract tended to return the level to normal, just as silymarin did, while the ethanolic extract did not seem to offer any remedy. In all cases however, the observed differences were not statistically significant.
Fig. 6

Effect of Dennettia tripetala extracts on tnf-α RNA expression in the liver of rats exposed chronically to CCl4. The results depicted were normalized to β-actin. AQDT, aqueous extract of D. tripetala; ETDT, ethanolic extract of D. tripetala.

DISCUSSION

Carbon tetrachloride, a well-known hepatorenal toxicant, was used to induce experimental damage to the liver and kidneys of rats. Its metabolism leads to the formation of trichloromethyl radicals that reacts with oxygen to form trichloromethyl peroxy radicals that cause peroxidation of the lipid components of membranes, thus increasing the permeability of the cell (Weber et al., 2003). Therefore, it becomes easy for enzymes to leak out of their cells, thus resulting in an increased serum activity of liver marker enzymes, such as ALT and AST during CCl4 poisoning. The mechanism by which the extracts of D. tripetala caused this relief, may revolve around stabilizing the cell membranes, preventing CCl4 metabolism into radicals by inhibiting the CYP450 activity, or preventing peroxidation of the lipids of the membranes by itself acting as an antioxidant. The first hypothesis is highly possible as D. tripetala contains tannins (Iseghohi, 2015; Omage et al., 2018) that can “coat” and protect membranes, increasing the resistance to stress and limiting its labilization (de Jesus et al., 2012). The second hypothesis is also possible, as numerous plants inhibit CYP450 (Ashour et al., 2017), and the last hypothesis is also very likely as D. tripetala has several antioxidant components and elicits in vitro antioxidant properties (Iseghohi, 2015; Omage et al., 2018). Carbon tetrachloride also alters the metabolism of lipids (Weber et al., 2003), and in this study, it caused an accumulation of cholesterol and triglycerides in the liver. It also elevated serum cholesterol but a drop in serum triglyceride. A previous work has revealed some mechanisms by which the concentration of lipids in the liver and serum may be distorted; these mechanisms include the increased synthesis of lipids in the liver which leads to the accumulation of these lipids (Boll et al., 2001), inhibition of the β-oxidation of fatty acids in the liver which leads to the accumulation of triglycerides (Fromenty and Pessayre, 1995), reduction of the liver’s ability to secrete lipids which leads to the accumulation of these lipids (Fromenty and Pessayre, 1995), inhibition of the activity of lysosomal acid triglyceride lipase which causes the accumulation of triglycerides in the liver (Kato and Nakazawa, 1987; Khalaf et al., 2009), reduction in the ability of the liver to remove cholesterol from the blood which causes cholesterol to accumulate in the blood (Owen, 1990), and reduction in the activity of peripheral lipase which causes triglycerides to accumulate in the blood (Jahn et al., 1985). In this study, some mechanisms stated above may have worked singly or in concert to distort lipid concentration in the liver and serum, and in the case of serum triglyceride, the concentration may have reduced because the liver may have had difficulty secreting triglycerides into the blood. This hypothesis is supported by the histological images (Fig. 2), which showed lipid accumulation in the hepatocytes, and the results of biochemical assays (Table 5), which showed triglyceride accumulation in the liver. The mechanisms by which D. tripetala alleviated the lipid dyshomeostasis induced by carbon tetrachloride probably revolved around preventing more sporadic damage caused by CCl4 to the types of machinery involved in maintaining lipid homeostasis. More specifically the plant may have prevented the formation of more adducts formed from the trichloromethyl radical breakdown product of CCl4. In this study, carbon tetrachloride also increased the serum total protein and globulin concentration. The proteins that leaked out of the liver likely contributed to the increased protein concentrations measured in the serum. It is also important to note that most of the proteins measured in the serum were globulins since the globulin level increased and the albumin level reduced drastically. Albumin is usually used to study the synthetic capacity of the liver since it is the most abundant protein synthesized by the liver. Therefore, carbon tetrachloride must have affected the liver so badly that the capacity for albumin synthesis dropped drastically in this study. The extracts of D. tripetala may have worked by preventing the destruction carbon tetrachloride caused to the liver, including necrosis, and this hypothesis is backed up by the gene expression results (Fig. 4), which showed that D. tripetala extracts reduced the expression of the pro-apoptotic gene fas, in the liver. In this study, carbon tetrachloride caused the activity of the antioxidant enzymes: SOD and catalase to increase in the liver. This means that prolonged exposure to carbon tetrachloride may have caused a form of “adaptation” in which the expression of antioxidant enzymes increased to combat the free radical damage that was caused by CCl4. This result is supported by the gene expression results (Fig. 5) in which CCl4 increased the expression of sod-1 in the liver. D. tripetala intervention helped to restore the activity of SOD and catalase in the liver and kidneys as well as the expression of sod-1 in the liver to normal. In our opinion, the response of rat organs to carbon tetrachloride likely varies with the duration of exposure. Results from other labs and previous experiments in our lab, showed that fewer exposures to CCl4 reduces antioxidant enzyme activity (Zhang et al., 2013; Hafez et al., 2014; Adewale and Orhue, 2015; Iseghohi et al., 2017; Iseghohi and Orhue, 2017; Omage et al., 2021) but in this study, a longer exposure caused the opposite phenomenon. This could mean that a few encounters with carbon tetrachloride may at the onset start to overpower the antioxidant systems that ensure homeostasis (leading to a reduced antioxidant enzyme activity), but if the exposure continues for a longer period, it may start to sensitize the organ to subsequent carbon tetrachloride exposure (a form of adaptative response, increasing the antioxidant enzyme expression and activity). A time eventually arises after a very prolonged exposure to carbon tetrachloride, when the system eventually becomes overwhelmed once more, reducing the antioxidant enzyme activity, with a resulting sinusoidal dose-response curve. Therefore, termination of an experiment before the onset of adaptation is likely to lower the antioxidant enzyme activity. Suppose an experiment is allowed to continue till after adaptation has kicked in, then there is the possibility of observing an increase in antioxidant enzyme activity, and if the experiment is prolonged for several months, a reduction in antioxidant enzymes will not be out of place. Interestingly, our observation from this study, was similar to that of other researchers such as Ozturk et al. (2003) and Uzma et al. (2011), who have observed significant increases in antioxidant enzyme expression and activity following exposure to an external source of free radicals. In this study, CCl4 significantly increased the concentration of urea and creatinine in the serum. This is not surprising, as CCl4 altered the normal architecture of the glomeruli of the kidneys which are normally responsible for filtering waste substances from the blood into the urine. This alteration in their structures very likely altered their functional capacity to filter the blood properly, and this resulted in accumulation of waste substances such as urea and creatinine in the blood. D. tripetala protected the kidneys from structural and functional damage caused by carbon tetrachloride and hence the waste substance urea and creatinine did not accumulate in the blood of the rats that received the plant intervention. From the results of this experiment (Fig. 4), one can infer that the induction of apoptosis is a mechanism by which CCl4 causes liver injury. Zhang et al. (2013) and Hafez et al. (2014) made similar observations. fas is a gene that triggers apoptosis in cells. Under conditions of poisoning, such as is the case with CCl4, the consequences may increase fas expression, triggering the cell to die by suicide. It is reasonable to find that D. tripetala worked by reducing fas expression in the liver, thereby preventing apoptosis, hence buying more time for the hepatocytes to recover rather than dying by suicide. Another piece of evidence backing up the apoptosis we that was concluded on the basis of fas expression, is the fact that as CCl4 was triggering apoptosis, or more specifically “necrosis”, these triggered immune cells to migrate to the site of the necrotic hepatocytes. This is why in the histology images (Fig. 2), there were many immune cells surrounding the centrioles in the liver of the rats poisoned with CCl4. From the results of this study (Fig. 5), it is obvious that a six-week exposure to CCl4 increased in the expression of sod-1 (which encodes the antioxidant enzyme, SOD) in the liver. This means that prolonged CCl4 administration caused an adaptation, perhaps a form of “hormetic” effect, as explained earlier, making the liver to start synthesizing more antioxidant enzymes to combat the harmful effects of CCl4. Perhaps a longer exposure to CCl4 (longer than six weeks) may have ultimately resulted in a situation where the free radicals produced from CCl4, eventually overpowers the antioxidant defense system of the body, causing more destruction to antioxidant enzymes that have already been produced, and sporadically reducing the expression of more antioxidant genes. In this experiment, the D. tripetala extracts restored homeostasis by reducing sod-1 expression, which CCl4 had increased. Perhaps, the plant itself acted as a supply of antioxidants, reducing the “pressure” on the liver to cause the expression of more antioxidants as a way of adapting to, and combating the effects of CCl4. Finally, under these experimental conditions, CCl4 barely increased the tnf-α expression in the liver (Fig. 6). tnf-α is a gene involved in the immune response (Parameswaran and Patial, 2010; Zimmermann et al., 2012). It triggers apoptosis or cell recovery depending on the scenario at that body site (Weber et al., 2003). It is upstream of several genes that cause the recruitment of immune cells to a site of damage. In this experiment, the plant extracts barely returned the tnf-α expression to normal. The non-significant results recorded was unexpected since the histology results showed that CCl4 massively recruited immune cells to the site of damaged necrotic liver tissue; but perhaps under these experimental conditions, CCl4 worked through other genes either downstream of tnf-α or genes that function in pathways that do not directly involve tnf-α but are highly involved in the immune response. In subsequent experiments, it will be interesting to determine what other genes of the immune system, CCl4, and D. tripetala extracts, may have been working through. Conclusively, a six-week CCl4 administration induced chronic liver and kidney damage at the biochemical and histological level. CCl4 also increased the expression of the pro-apoptotic gene fas (P<0.05), the antioxidant gene sod-1 (P<0.05), and a gene involved in the immune response tnf-α (P>0.05) in the liver. A two-week intervention using extracts of the medicinal plant, D. tripetala, reduced liver and kidney damage and restored the expression of these genes to normal. Also, the plant extracts proved to be as potent as the standard drug, silymarin. In the future, perhaps D. tripetala may serve as a starting material for the synthesis/semi-synthesis or, at the very least, the extraction of drugs to manage hepatorenal diseases.
  24 in total

Review 1.  Tumor necrosis factor-α signaling in macrophages.

Authors:  Narayanan Parameswaran; Sonika Patial
Journal:  Crit Rev Eukaryot Gene Expr       Date:  2010       Impact factor: 1.807

Review 2.  Inhibition of mitochondrial beta-oxidation as a mechanism of hepatotoxicity.

Authors:  B Fromenty; D Pessayre
Journal:  Pharmacol Ther       Date:  1995       Impact factor: 12.310

3.  Microsomal lipid peroxidation.

Authors:  J A Buege; S D Aust
Journal:  Methods Enzymol       Date:  1978       Impact factor: 1.600

4.  The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase.

Authors:  H P Misra; I Fridovich
Journal:  J Biol Chem       Date:  1972-05-25       Impact factor: 5.157

5.  Protection of the flavonoid fraction from Rosa laevigata Michx fruit against carbon tetrachloride-induced acute liver injury in mice.

Authors:  Shuai Zhang; Binan Lu; Xu Han; Lina Xu; Yan Qi; Lianhong Yin; Youwei Xu; Yanyan Zhao; Kexin Liu; Jinyong Peng
Journal:  Food Chem Toxicol       Date:  2012-12-29       Impact factor: 6.023

6.  Carbon tetrachloride-induced nephrotoxicity and protective effect of betaine in Sprague-Dawley rats.

Authors:  Feral Ozturk; Muharrem Ucar; I Cetin Ozturk; Nigar Vardi; Kadir Batcioglu
Journal:  Urology       Date:  2003-08       Impact factor: 2.649

7.  Antinociceptive and antiinflammatory effects of essential oil of Dennettia tripetala G.Baker (Annonaceae) in rodents.

Authors:  I A Oyemitan; E O Iwalewa; M A Akanmu; T A Olugbade
Journal:  Afr J Tradit Complement Altern Med       Date:  2008-06-18

Review 8.  Tannins, peptic ulcers and related mechanisms.

Authors:  Neyres Zinia Taveira De Jesus; Heloina de Souza Falcão; Isis Fernandes Gomes; Thiago Jose de Almeida Leite; Gedson Rodrigues de Morais Lima; Jose Maria Barbosa-Filho; Josean Fechine Tavares; Marcelo Sobral da Silva; Petrônio Filgueiras de Athayde-Filho; Leonia Maria Batista
Journal:  Int J Mol Sci       Date:  2012-03-08       Impact factor: 6.208

9.  Association between paraoxonases gene expression and oxidative stress in hepatotoxicity induced by CCl4.

Authors:  Mohamed M Hafez; Othman A Al-Shabanah; Naif O Al-Harbi; Mohamed M Al-Harbi; Salim S Al-Rejaie; Saad M Alsurayea; Mohamed M Sayed-Ahmed
Journal:  Oxid Med Cell Longev       Date:  2014-11-17       Impact factor: 6.543

10.  Inhibition of Cytochrome P450 (CYP3A4) Activity by Extracts from 57 Plants Used in Traditional Chinese Medicine (TCM).

Authors:  Mohamed L Ashour; Fadia S Youssef; Haidy A Gad; Michael Wink
Journal:  Pharmacogn Mag       Date:  2017-04-18       Impact factor: 1.085

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.