| Literature DB >> 35464728 |
Keyu Kong1, Yongyun Chang1, Yi Hu1, Hua Qiao1, Chen Zhao1, Kewei Rong1, Pu Zhang1, Jingwei Zhang1, Zanjing Zhai1, Huiwu Li1.
Abstract
Surface modification of titanium has been a hot topic to promote bone integration between implants and bone tissue. Titanium dioxide nanotubes fabricated on the surface of titanium by anodic oxidation have been a mature scheme that has shown to promote osteogenesis in vitro. However, mechanisms behind such a phenomenon remain elusive. In this study, we verified the enhanced osteogenesis of BMSCs on nanotopographic titanium in vitro and proved its effect in vivo by constructing a bone defect model in rats. In addition, the role of the mechanosensitive molecule Yap is studied in this research by the application of the Yap inhibitor verteporfin and knockdown/overexpression of Yap in MC3T3-E1 cells. Piezo1 is a mechanosensitive ion channel discovered in recent years and found to be elemental in bone metabolism. In our study, we preliminarily figured out the regulatory relationship between Yap and Piezo1 and proved Piezo1 as a downstream effector of Yap and nanotube-stimulated osteogenesis. In conclusion, this research proved that nanotopography promoted osteogenesis by increasing nuclear localization of Yap and activating the expression of Piezo1 downstream.Entities:
Keywords: Piezo1; hippo pathway; mesenchymal stem cells; osteogenic differentiation; titanium nanotubes
Year: 2022 PMID: 35464728 PMCID: PMC9023332 DOI: 10.3389/fbioe.2022.872088
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
Primers used in the qRT-PCR assay.
| Gene | Organism | Forward (5–3′) | Reverse (5–3′) |
|---|---|---|---|
|
|
| GGCAAGTTCAACGGCACAG | CGCCAGTAGACTCCACGACAT |
|
|
| TGATGGACCTGCTGGCTCTC | GACCACGTTCACCACTTGCT |
|
|
| CCAATGACTACCCACCCTTTCC | ATGGATGCCCGCCTTGTA |
|
|
| GGACCCTCTCTCTGCTCACTCTG | ACCTTACTGCCCTCCTGCTTGG |
|
|
| TGATGACGACGACGATGACGAC | TGTGCTGGCAGTGAAGGACTC |
|
|
| GACAATGAGATGCCGCCAGAG | CATCCAGTTCATATTCCACATCAGTTC |
|
|
| GGCAAGTTCAACGGCACAG | CGCCAGTAGACTCCACGACAT |
|
|
| AGACCAGCAGCACTCCATATCTCT | CGTCAGCGTCAACACCATCATTCT |
|
|
| AAGTTCACCTGCCTGCTCTGTTC | GGCGGCTGATTGGCTTCTTCTT |
|
|
| AAGCAGGAGGGCAATAAGGTAGTG | TCTTCAAGCCATACTGGTCTGATAGC |
|
|
| GACGATGATGATGACGATGGAGACC | CTGTAGGGACGATTGGAGTGAAAGTG |
|
|
| TCACGGCGTCCATGAGCAGAA | TACAGGCAAGGCAGATAGCGAACT |
|
|
| ACACCGCACAGAACCACCACTC | TAATGGCAGGCACAGGTCTTGATGAAC |
|
|
| ATACTGCGGCTCCTGCGTAG | CCTGAACTTGTGGATGTCATTGAATAG |
|
|
| CTTGTGTCCATTCAACTGTGCTACG | TTCCATCCTCTTGCCGCTCAG |
|
|
| GCCTACACTGGAGCAGGATGGA | GATAGGTGCCACTGTTAAGAAAGGGAT |
|
|
| AGTATCTGCTTCTTCTTCCTGCTCTTG | GACTTCTCCTCAATCTGGCGATGG |
FIGURE 1Nanotopography surface characteristics and biocompatibility. (A) Lumen structure of nanotubes observed by SEM with a diameter of approximately 100 nm. Scale bar: 200 nm. (B) EDS analysis of the chemical element composition of nanotubes. (C) Ti and O element ratio on nanotopography. (D) CCK8 test of BMSCs seeded on nanotubes and smooth titanium. *p < 0.05, **p < 0.01.
FIGURE 2Nanotopography promotes osteogenic differentiation of BMSCs both in vivo and in vitro. (A) ALP staining of BMSCs on different topographies. (B) Gene expression of osteogenic differentiation markers of BMSCs seeded on various topographies. (C) Micro-CT scans of the distal femur and presentative reconstruction of the new bone around implants from different views. (D) Analysis of BV/TV, Tb. N, Tb. Sp, and Tb. Th for new bones around implants with different topographies. (E) Immunohistochemistry staining and quantitative analysis of Ocn in new bones around implants. Scale bar: 10 μm *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
FIGURE 3Yap entering the nucleus plays an important role in nanotopography-related osteogenesis. (A) Immunofluorescence staining of Yap proved the accumulation of Yap in the nucleus under stimulation of nanotubes. Scale bar: 10 μm. (B) Western Blot of Yap in the nucleus and cytoplasm proved its accumulation in the nucleus when seeded on nanotubes.
FIGURE 4Yap inhibitor, verteporfin, inhibits osteogenic differentiation of MC3T3-E1 cells seeded on nanotubes or 24-well plates. (A) Gene expression of Yap downstream genes Ctgf, Cyr61, and Axl under different concentrations of verteporfin. (B) Expression of osteogenic genes of MC3T3-E1 cells seeded on nanotubes. OM: osteogenic induction medium. (C) Alizarin Red S staining and ALP staining of MC3T3-E1 cells seeded on 24-well plates and quantitative analysis of calcified nodules areas and relative ALP staining areas. (D) ALP staining of MC3T3-E1 cells seeded on nanotubes with verteporfin. (E) Relative ALP activities of MC3T3-E1 cells on nanotubes treated with verteporfin. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
FIGURE 5Knockdown/overexpression of Yap regulates osteogenesis. (A) Verification of knockdown and overexpression of Yap through rt-qPCR and Western Blot. oe, overexpression. (B) ALP staining of sh-Yap and oe-Yap and quantitative analysis of the relative staining area. (C) Expression of osteogenic genes of sh-Yap and oe-Yap on nanotopography. (D) ALP staining of sh-Yap cells on nanotubes. (E) Overexpression of Yap could rescue anti-osteogenic effect of verteporfin. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
FIGURE 6Yap could regulate the expression of Piezo1. (A) Verteporfin inhibits expression of Piezo1 in a dose-dependent manner. (B) Knockdown or overexpression of Yap could regulate the protein expression of Piezo1. oe, overexpression. (C) Knockdown or overexpression of Yap could regulate the mRNA expression of Piezo1. (D) Expression of Piezo1 was elevated in bones around defects by immunohistochemistry and quantitative analysis. Scale bar: 10 μm *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
FIGURE 7Schematic plot to illustrate the role of Yap and Piezo1 in promoting nanotube-related osteogenesis. Nanotopography is recognized by mechanosensors such as integrins residing in the cell membrane, which suppresses the Hippo pathway and promotes nuclear entry of Yap. Furthermore, Yap activates TEADs and enhances the expression of Piezo1, which has been proved to be significant in osteogenesis. Created in BioRender.com.