The Effect of Long-Term External Counterpulsation Combined with Exercise Therapy on the Establishment of Collateral Circulation in Patients with Coronary Artery Occlusive Disease.

Objective: By detecting the levels of external counterpulsation combined with exercise therapy on the levels of moesin, angiopoietin-like protein2 (Angptl 2), angiopoietin-like protein (Angptl 3), hypoxia inducible factor-1α (HIF-1α), and RNA-34a (miR-34a) in patients with coronary artery occlusive disease, the effect of external counterpulsation combined with exercise therapy on the establishment of occluded coronary collateral circulation was studied.
Methods: A retrospective analysis of 166 patients with coronary heart disease was confirmed by coronary angiography results that at least one coronary artery (anterior descending branch, circumflex branch, and right coronary artery) was completely occluded and was classified into the control group (routine medication) and the treatment group (routine drug therapy plus exercise therapy and external counterpulsation) according to the treatment plan of the patient. The serum levels of moesin, Angptl 2, Angptl 3, and HIF-1α were detected by enzyme-linked immunosorbent assay (ELISA) test. The index of microcirculatory resistance (IMR) and coronary flow reserve (CFR) of the two groups of patients were measured before and after 2 weeks of treatment. The formation of collateral circulation was analyzed according to the Rentrop classification method.
Results: After treatment, the IMR levels of the two groups were significantly decreased, and the CFR levels were significantly increased. The decrease of IMR level and the increase of CFR level in the experimental group were better than those in the control group (P < 0.05). There was no significant difference in the positive detection rate of moesin antibody between the two groups, but the OD detection value of the treatment group decreased significantly (P < 0.05). The levels of Angptl 2, Angptl 3, and miR-34a in the treatment group were lower than those in the control group, while the relative expression of HIF-1α was higher than that in the control group. The difference was statistically significant (P < 0.05). External counterpulsation combined with exercise therapy improved the formation rate of collateral circulation (P < 0.05). Conclusions: External counterpulsation combined with exercise therapy can reduce moesin antibody, Angptl 2, Angptl 3, and miR-34a levels increase HIF-1α levels, and promote the establishment of occluded coronary collateral circulation.

1. Background

External counterpulsation, (ECP) is a treatment method to relieve the symptoms of angina pectoris and improve the hypoxia-ischemia state of the body by noninvasively pressing the lower body in vitro. It is widely used in the treatment or adjuvant treatment of patients with angina pectoris and coronary heart disease [1, 2]. A large number of studies have confirmed that [3, 4] moderate and standardized exercise therapy can significantly improve exercise tolerance, cardiac function, and quality of life of patients with coronary heart disease, so exercise therapy plays an important role in cardiac rehabilitation. However, up to now, the evidence of the influence of external counterpulsation combined with exercise therapy on the establishment of collateral circulation after occlusion of one or more coronary arteries is still insufficient. Membranin (moesin), angiopoietin-like protein (Angptl 2), Angptl 3, hypoxia inducible factor-1α (HIF-1α), and microRNA-34a (Mir-34a) are involved in the regulation of many biological functions of cells [5-7]. Among them, moesin antibody has a high positive detection rate in patients with vascular endothelial injury-related diseases such as coronary heart disease and hypertension and is positively correlated with the degree of coronary artery stenosis [1, 2]. In this retrospective study, it observed the expression of moesin antibody and the levels of Angptl2, Angptl 3, HIF-1α level, and Mir-34a and studied the effect of ECP combined with exercise therapy on the formation of collateral circulation in patients with coronary artery occlusion.

2. Material and Methods

2.1. Material

A retrospective study was conducted on 166 elderly patients with coronary heart disease with total coronary artery occlusion who were admitted to the Cardiac Rehabilitation Center of Guiyang First People's Hospital from February 1, 2017, to January 31, 2020. All patients underwent diagnostic coronary angiography. Inclusion criteria are as follows: (1) At least one coronary artery (anterior descending branch, circumflex branch, and right coronary artery) is completely occluded and (2) no interventional therapy and/or surgical coronary artery bypass grafting was performed. Exclusion criteria was as follows: patients with chronic cardiac insufficiency, severe hepatic and renal insufficiency, nervous system diseases, rheumatic immune diseases, gout, blood system diseases, malignant tumors, severe infections, or thyroid diseases.

2.2. Methods

2.2.1. Material Collection

Use double entry, the age, sex, body mass index (BMI), smoking history, family history, coronary artery occlusion, hypertension, diabetes, and medication were collected. Blood samples were collected on an empty stomach the next day after admission to detect the levels of blood glucose, triglyceride, and cholesterol (including total cholesterol, high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol).

2.2.2. Research Group

Of the 166 elderly patients in the group, 89 did not receive ECP and exercise therapy and were included in the control group, including 48 males and 41 females. The remaining 77 patients who received ECP and exercise therapy were included in the treatment group, including 40 males and 37 females. The control group was given routine secondary preventive drug therapy for coronary heart disease, while the treatment group was given exercise therapy and ECP therapy on the basis of routine secondary preventive drug therapy. ECP was done one hour a day, five days a week for seven weeks continuously. The exercise therapy made an individualized exercise plan according to its anaerobic threshold, and the target rate was set to the heart rate level corresponding to the anaerobic threshold and adjusted according to the Borg score of the patient. Exercise was performed once every other day for 36 times, with 60 minutes each time. Among them, 10 minutes of warm-up exercise, 10 minutes of pedaling, 10 minutes of upper limb fluid resistance training, 10 minutes of running on treadmill, 10 minutes of elastic belt impedance training, and 10 minutes of flexibility training [3] are carried out on the premise that patients can tolerate them.

2.2.3. Clinical Specimen Detection

Take 5 mL of fasting blood samples from patients on the next day of admission, and use indirect enzyme-linked immunosorbent assay (ELISA) method to detect anti-moesin antibody in peripheral blood of all patients with recombinant moesin as antigen (Shanghai Kexin Biotechnology Co., Ltd., China), and the detection wavelength is 630 nm. The positive judgment value OD ≥0.25 was positive [6]. In addition, the serum levels of Angptl 2, Angptl 3, and HIF-1α were detected by ELISA, and the OD values of each well were detected by using the enzyme-linked immunosorbent kits of Angptl 2, Angptl 3 (the enzyme-linked immunosorbent kits of Angptl 2 and Angptl 3 were provided by Nanjing Jiancheng Bioengineering Research Institute, China), and HIF-1α (Jianglai Biotechnology Co., Ltd., China). The relative expression of miR-34a in serum samples of patients after 2 weeks of treatment was detected by qRT-PCR. Total RNA in serum was extracted strictly according to the instructions of the kit, and RNA was reverse transcribed into cDNA. The expression level of serum miR-34a was detected by qRT-PCR (program setting: preheating 30s at 95 °C, 15 s at 95 °C, 15 s at 60 °C, and 15 s at 72 °C) [7]. The internal reference gene is U6, and the sequence of primers (Shanghai Shenggong Bioengineering Co, Ltd., CHN) is shown in Table 1. The relative expression was calculated by 2-ΔΔCt algorithm [8].

Table 1

The qRT-PCR primer sequence design.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	Sequence length (bp)
U6	ATTGGAACGATACAGAGAAGATT	GGAACGCTTCACGAATTTG	212
miR-34a	ACGCTCAGTTAATGCTAATCGTGATA	ATTCCATGTCCACTGTGTCTG	241

2.2.4. Evaluation of Coronary Collateral Circulation

The levels of coronary circulation resistance index (IMR) and coronary flow reserve index (CFR) were detected by high-resolution cardiac magnetic resonance (CMR) before and after two weeks of treatment. Rentrop standard was used to evaluate the establishment of coronary collateral circulation: 0 point, there was no epicardial perfusion or collateral perfusion; 1 point, partial development of epicardial vessels or weak development of collateral vessels (contrast agent did not reach the epicardial part of the perfused artery); 2 points, almost all epicardial development or collateral development (occlusion of distal blood vessels); and 3 points, all epicardium was developed until the stenosis (the development density of occluded distal blood vessels is connected with the blood supply vessels) [9]. If there are two or more severe coronary artery stenosis in patients, the collateral circulation is the best in the scoring results [10, 11].

2.3. Statistical Analysis

All data were collected by SPSS 19.0 for statistical analysis. The two groups of data were compared by single sample t-test. The results were expressed in mean ± standard deviation (x ± s), and the counting data were expressed in frequency (n) and percentage (%). The statistical results showed that the difference was statistically significant (P < 0.05).

3. Result

3.1. Comparison of General Material

Among the 166 patients enrolled in this study, there were 88 males and 78 females, with an average age of 70.10 ± 15.2 years. There were 77 cases in the treatment group and 89 cases in the control group. There was no significant difference in gender, age, BMI, systolic blood pressure, triglyceride, low density lipoprotein cholesterol, heart rate, creatinine clearance, fasting plasma glucose, duration of angina pectoris, CCS grade of angina pectoris, cardiovascular risk factors, and previous medication history between the treatment group and the control group (P > 0.05) (see Table 2).

Table 2

Comparison of general material between the two patient groups (± s) (%).

Project	Control group(n = 89)	Treatment group(n = 77)	P value
Sex (n/%)
Male	48 (53.9)	40 (51.9)	0.797
Female	41 (46.1)	37 (48.1)	0.991
Age(years)	69.38 ± 9.15	70.81 ± 9.68	0.281
BMI (kg/m2)	27.4 ± 6.2	26.9 ± 5.4	0.460
Systolic pressure (mmHg)	146 ± 11	149 ± 13	0.114
TC (mmol/L)	6.08 ± 0.15	6.12 ± 0.13	0.270
LDL-C(mmol/L)	3.58 ± 0.12	3.56 ± 0.11	0.450
HR (bpm)	73.89 ± 13.39	73.60 ± 16.24	0.333
Cr (umol/L)	69.6 ± 8.2	68.7 ± 9.1	0.160
FPG (mmol/L)	5.41 ± 0.21	5.38 ± 0.26	0.390
Location of occlusive lesions (n/%)
Left anterior descending branch	34 (38.2)	31 (40.3)	0.070
Arteriae coronaria dextra	32 (35.9)	31 (40.3)	0.096
Left cyclotron branch	18 (20.2)	11 (14.3)	0.163
Other locations	5 (5.6)	4 (5.2)	0.058
The number of lateral branches of the lesion (n/%)
Single branch	39 (43.8)	26 (33.8)	0.083
Double branch	34 (38.2)	31 (40.3)	0.070
Three branch	16 (18.0)	20 (26.0)	0.370
Duration of angina pectoris (month)	8.9 ± 6.8	7.1 ± 6.2	0.552
Angina CCS grade (n/%)
0	0 (0)	0 (0)	0.901
I	50 (56.2)	34 (44.2)	0.470
II	39 (43.8)	43 (55.8)	0.525
III	0	0 (0)
Coronary risk factor (n/%)
Smoke	23 (59.0)	46 (59.7)	0.092
Hypercholesterolemia	78 (87.6)	68 (88.3)	0.530
Family history of coronary heart disease	71 (79.8)	57 (74.0)	0.382
Obesity with BMI >28 kg/m2 (n/%)	43 (48.3)	43 (55.8)	0.510
Drugs (n/%)
Clopidogrel	34 (38.2)	31 (40.3)	0.071
Nitrates	53 (59.6)	46 (59.7)	0.062
Adventitia receptor blocker	55 (61.8)	40 (51.9)	0.182
Ca2+ channel blocker	46 (51.7)	37 (48.1)	0.207
ACEI class drugs	59 (66.3)	49 (63.6)	0.371
Statins	48 (53.9)	40 (51.9)	0.210

Notes: TC: triglycerides; LDL-C: low-density lipoprotein cholesterol; HR: heart rate; Cr: creatinine clearance; FPG: fasting plasma glucose; CCS: Canadian Cardiovascular Society.

3.2. Comparison of the IMR and CFR Levels between the Treatment and Control Groups

There was no significant difference in IMR and CFR levels between the two groups before treatment (P > 0.05). After treatment, IMR level decreased, and CFR level increased in both groups. The IMR level of the treatment group was lower than that of the control group, and the CFR level was higher than that of the control group, and the differences were statistically significant (P < 0.05). The results are shown in Table 3.

Table 3

Comparison of the IMR and CFR levels between the treatment and control groups.

Groups	n	IMR		CFR
		Prior treatment	Post-treatment	Prior treatment	Post-treatment
Control group	89	52.37 ± 1.43	28.241 ± 5.87▲	1.97 ± 0.25	2.72 ± 0.17▲
Experimental group	77	41.25 ± 5.01	23.19 ± 3.64▲	1.99 ± 0.27	3.08 ± 0.23▲
P		>0.05	<0.05	>0.05	<0.05

▲P was <0.05.

3.3. Comparison of Good Rate of Collateral Circulation Formation between Treatment Group and Control Group

Comparing the good rate of collateral circulation between the two groups, the treatment group (92.2%) was significantly higher than the control group (69.7%) (P < 0.05). Exercise combined with ECP can promote the establishment of coronary collateral circulation in patients with coronary artery occlusion. The results are shown in Figure 1 and Table 4.

Figure 1

Comparison of CFR levels between the control and treated groups.

Table 4

The Rentrop scores were compared between the two patient groups.

Project	Control group (n = 89)	Treatment group (n = 77)	P value
Rentrop score ≧2 (example/%)	62 (69.7)	71 (92.2)	0.014
Rentrop score <2 (example/%)	27 (30.3)	6 (7.8)	0.029

3.4. Comparison of Moesin Antibody Positive Rate and OD Value

The results showed that there was no significant difference in the positive rate of moesin protein antibody between the treatment group (88.3%) and the control group (89.9%) (P > 0.05), but the comparison of ln(OD) between the two groups showed that the ln(OD) value of the treatment group was significantly lower than that of the control group (P < 0.05). The results are shown in Table 5.

Table 5

The moesin antibody positive rate was (%) in both groups.

Project	Control group (n = 89)	Treatment group(n = 77)	P value
Positive (example/%)	80 (89.9)	68 (88.3)	0.907
Negative: (example:/%)	9 (10.1)	9 (11.7)	0.838
Ln(OD)	-1.532 ± 0.312	-1.961 ± 0.318	0.012

3.5. Detection of Serum Angptl 2, Angptl 3, HIF-1, and miR-34a

The levels of Angptl 2, Angptl 3, and miR-34a in the treatment group were significantly lower than those in the control group (P < 0.05). The relative expression of HIF-1α in treatment group was higher than that in control group, and the difference was statistically significant (P < 0.05). The results are shown in Table 6.

Table 6

Detection of serum Angptl 2, Angptl 3, HIF-1, and miR-34a ().

Project	Control group (n = 89)	Treatment group (n = 77)	P value
Angptl 2 (ng/mL)	7.19 ± 1.24	5.62 ± 1.04	0.072
Angptl 3 (ng/mL)	4.31 ± 2.01	3.01 ± 1.21	0.031
HIF-1α (pg/mL)	20.62 ± 4.53	27.41 ± 6.01	0.016
miR-34a	0.94 ± 0.11	0.52 ± 0.11	0.021

Compared with that before treatment, the ▲P was <0.05.

4. Discussion

Coronary collateral circulation refers to the circulation channel formed between the same or different coronary arteries, which is the main compensatory mechanism of coronary artery insufficiency, also known as natural bypass system [12, 13]. It is the impact of ECP combined with exercise therapy on the establishment of collateral circulation in patients with coronary artery occlusion. Through the retrospective analysis of the patients admitted to the Heart Rehabilitation Center of our hospital, we found that 57 of 89 patients in the control group who received basic drug therapy had established good collateral circulation and the good rate of collateral circulation formation was 64.04%. On the other hand, among 77 patients who received both ECP and exercise therapy on the basis of drug therapy, 73 patients established good collateral circulation, and the good rate of collateral circulation formation reached 94.81%. The above results show that full course of ECP and standardized exercise therapy can significantly improve the collateral circulation establishment of patients with coronary artery occlusion. This is similar to the research results [14-16]. However, the authors mentioned above only used one method to observe the establishment of coronary collateral circulation, and did not make quantitative analysis. In addition, the patients they observed included patients with coronary heart disease whose coronary arteries were not completely occluded.

In this study, we compared and analyzed the influence of ECP combined with exercise therapy on the formation of coronary collateral circulation through IMR, CFR, Rentrop score, and moesin antibody. IMR is not affected by hemodynamics, and it can quantitatively evaluate myocardial microcirculation. The increase of IMR may indicate that microvascular occlusion exists. CFR is the ratio of coronary blood flow in the state of maximal coronary artery dilation to that in the rest state. When the CFR decreases, it may indicate myocardial ischemia. The results of this study showed that IMR of patients in both the treatment group and the experimental group decreased significantly after treatment, while CFR increased significantly, suggesting that standardized secondary preventive drugs for coronary heart disease can promote the formation of collateral circulation after coronary artery occlusion. However, comparing the generation of collateral circulation between the two groups, we can see that after two weeks of ECP combined with exercise therapy, the generation of collateral circulation in the treatment group is more significant and the increase of CFR is larger than that in the control group. The above results highlight the clinical significance of this study, that is, external counterpulsation combined with exercise therapy can reduce myocardial oxygen consumption in patients with coronary artery occlusion, relieve coronary spasm, increase myocardial blood flow perfusion, and thus improve coronary microcirculation.

Moesin exists in many kinds of cells, including vascular endothelial cells, and plays an important role in the pathogenesis of coronary heart disease. Moesin, as a connecting cell in the endothelial cytoskeleton, plays an important role in vascular endothelial injury [2]. Our previous studies [6, 17] found that the positive detection rate of moesin antibody in patients with coronary artery occlusion was significantly higher than that in patients with mild coronary artery stenosis (P < 0.01) and the severity of coronary artery lesions increased when the positive rate of Moesin antibody and OD value increased (P < 0.05). In this study, there was no statistical difference in the positive detection rate of moesin antibody between the two groups, but the OD value of the treatment group was significantly lower than that of the control group. The analysis reason was that both groups were patients with occlusive disease and had severe vascular endothelial injury. However, from the quantitative analysis of OD value, the OD value of ECP combined with exercise treatment group was significantly lower than that of the control group, and the difference was statistically significant. Therefore, it is speculated that ECP combined with exercise therapy may have the effect of reducing vascular endothelial injury. In the future, we can further explore the influence of this treatment scheme on the OD value of moesin antibody and the expression of vascular endothelial injury factor and the correlation between them.

Angptl 2 and Angptl 3 are members of angiopoietin family and inflammatory mediators related to fat metabolism, which are involved in regulating lipid metabolism and angiogenesis [18]. Serum physiological level of Angptl 2 can promote angiogenesis, while excessive Angptl 2 can cause vascular inflammation and atherosclerosis [19]. The increase of serum Angptl 3 level can hinder the clearance of blood triglyceride, promote platelet aggregation, secrete plasminogen activator inhibitor-1, increase the number of foam cells, induce neovascularization, and accelerate the formation of coronary artery stenosis [20, 21]. The results of this study showed that the average levels of Angptl 2 and Angptl 3 in treatment group were lower than those in control group (P < 0.05). Therefore, ECP combined with exercise therapy may be related to the decrease of serum levels of Angptl 2 and Angptl 3, which can promote angiogenesis and the formation of coronary collateral circulation.

It has been found that the level of miR-34a in blood endothelial progenitor cells of patients with coronary heart disease is significantly higher than that of patients without coronary heart disease and the level of miR-34a is negatively correlated with the number of endothelial progenitor cells [22]. MiR-34a can inhibit neovascularization in patients with coronary heart disease. This study found that the level of miR-34a in ECP combined with exercise therapy group was lower than that in conventional drug prevention control group, suggesting that ECP combined with exercise played a significant role in the formation of coronary collateral circulation. In addition, research shows that HIF-1α is the target gene of miR-34a and HIF-1α is related to angiogenesis [23]. The expression of HIF-1α increases under hypoxia, and when transferred to the nucleus, it can start the expression of genes related to angiogenesis and induce the formation of new blood vessels [23]. In this study, the expression of HIF-1α in treatment group was significantly higher than that in control group (P < 0.05). Therefore, the expression of HIF-1α increased, which induced the angiogenesis of coronary collateral and promoted the establishment of collateral circulation.

External counterpulsation combined with exercise therapy can promote the establishment of collateral circulation of occluded coronary artery. A large number of studies have confirmed [24]. Standardized exercise therapy can significantly improve exercise tolerance, cardiac function and quality of life of patients with coronary heart disease, so exercise therapy plays an important role in cardiac rehabilitation. Therefore, standardized exercise therapy combined with full course of ECP therapy can well promote the establishment of collateral circulation in patients with coronary artery occlusion, and to a certain extent, it also has the effect of reducing vascular endothelial injury in patients. In the future work, we can make a prospective study on patients with occluded coronary artery disease and compare the differences between exercise therapy alone or ECP alone and the combination of two treatment methods in establishing coronary collateral circulation.