Literature DB >> 35463821

Direct multiplex recombinase polymerase amplification for rapid detection of S taphylococcus aureus and P seudomonas aeruginosa in food.

Diem Hong Tran1, Hau Thi Tran1, Trang Nguyen Minh Pham1, Huong Thi Thu Phung1.   

Abstract

Food and beverage poisoning is detrimental to people's health since it can lead to fever, stomachaches, and even death. To rapidly detect the presence of foodborne pathogens, conventional PCR assays are currently widely employed. Meanwhile, isothermal PCR methods, in which the amplification reactions take place at a low and constant temperature, have lately emerged as effective and alternative means for quickly identifying pathogens in low-resource settings. Staphylococcus aureus and Pseudomonas aeruginosa are two of the most concerning foodborne bacterial infections. In this work, an isothermal PCR assay based on the Recombinase Polymerase Amplification (RPA) method was developed to simultaneously detect S. aureus and P. aeruginosa with high sensitivity and specificity. The limit of detection for multiplex RPA was 10 and 30 fg/reaction of S. aureus and P. aeruginosa genomic DNA, respectively. Furthermore, the reaction time was reduced to only 25 minutes, with a low incubation temperature of 39°C. Multiplex RPA reactions, in particular, were successful in directly identifying as low as 1 and 5 CFU/reaction of S. aureus and P. aeruginosa cells, respectively, without the need for DNA genome extraction. Moreover, the multiplex RPA reliably detected the two foodborne bacteria in milk, fruit juice, and bottled water samples. In conclusion, the direct multiplex RPA reported in this work offers a quick, easy, sensitive, and effective alternative approach for detecting the presence of S. aureus and P. aeruginosa without the requirement of a pricey instrument or highly-trained personnel.

Entities:  

Keywords:  RPA; direct detection; foodborne pathogen; isothermal PCR

Year:  2022        PMID: 35463821      PMCID: PMC9012432          DOI: 10.22099/mbrc.2021.41503.1664

Source DB:  PubMed          Journal:  Mol Biol Res Commun        ISSN: 2322-181X


INTRODUCTION

Most foodborne diseases are caused by bacterial pathogens, such as Staphylococcus aureus, Pseudomonas aeruginosa, Salmonella enterica serovar Enteritidis, and Listeria monocytogenes [1]. Accordingly, foodborne bacterial infections occur when the bacteria-contaminated food is consumed and the bacteria continue to develop in the stomach and intestines, generating a disease-causing infection. S. aureus is an opportunistic pathogen that can cause a range of life-threatening illnesses in animals and humans. Also, S.aureus is a major cause of food poisoning resulting from enterotoxin-contaminated food and drinks [2]. Meanwhile, is designated by the World Health Organization as an indicator of drinking water quality [3]. P. aeruginosa can lead to long-term chronic diseases, particularly in patients admitted to the Intensive Care Unit [4]. Both S. aureus and P. aeruginosa can cause serious infections at extremely low concentrations [5]. Early detection with high sensitivity and specificity is therefore crucial to the treatment of P. aeruginosa- and S. aureus-derived diseases. Traditional culture-based techniques for the identification of bacterial pathogens typically require procedures of pre-enrichment, specific cultivation, and biochemical identification. Initial results thus need several days to verify a particular pathogenic microorganism, making those methods time-consuming and not practical for real-time application. Recently, novel pathogen-detecting molecular approaches have been intensively created, and PCR-based methods are widely recognized as the gold-standard for diagnosing foodborne pathogens, including S. aureus and P. aeruginosa [6-8]. These methods can detect a small number of bacterial cells. However, by virtue of requiring repeated thermal cycles with advanced equipment, complex processes and high costs, these techniques are limited in diagnosing food samples in the field with restricted resources. Therefore, new methods with elevated sensitivity and specificity that are quick, simple, easy to use, and independent of complicated instruments have urgently been necessary. Isothermal amplification is a current method for temperature-constant DNA amplification that provides an easy, rapid and economic approach to identify biological targets, particularly in less-equipped laboratories and in field applications [9, 10]. Among these methods, a novel isothermal DNA amplification, namely recombinase polymerase amplification (RPA), has been introduced by scientists from ASM Scientific (Cambridge, UK) in 2006 [11] and rapidly improved for the molecular diagnosis of many infectious diseases, including foodborne illnesses [12-15]. Later, ASM Scientific changed its name to TwistDx Ltd. and is still the only company that offers RPA kits on the market today. In 2017, Abbott acquired TwistDx and applied RPA to rapid diagnostic systems for infectious diseases. RPA uses a recombinase-primer complex, a strand-displacing polymerase, and single-stranded DNA binding proteins to replace the conventional thermal denaturation process of PCR, facilitating amplification of specific DNA products [16]. Compared with other isothermal amplification methods, RPA is the one whose operating principle and product are closest to PCR. Hence, its usage and applications also have many similarities and are easy to apply to laboratories that are familiar with PCR. Recently, combining with reverse-transcriptase (RT)-RPA, Xia et al. developed a one-pot, 30-min WEPEAR (whole-course encapsulated procedure for exponential amplification from RNA) protocol to diagnose SARS-CoV-2, showing a detection limit of 1 RNA copy/reaction [17]. Moreover, RT-RPA for SARS-CoV-2 detection was shown to possess comparable sensitivity, specificity, and limit of detection (LOD) to those of RT-PCR [18]. These together indicate that the value of RPA technology is still being paid special attention nowadays. Previously, RPA was successfully applied to rapidly detect S. aureus and P. aeruginosa [19, 20]. Nonetheless, because different bacterial pathogens can usually co-infect food, quickly and accurately diagnosing their presence at the same time will save time, labor, and money while also providing more useful testing information. Consequently, in this study, we developed the multiplex RPA assay to simultaneously detect S. aureus and P. aeruginosa infections in drinking food. This assay is fast and simple and exhibits extremely high sensitivity and specificity. In particular, the assay is able to directly detect the bacterial cells without the requirement for DNA extraction in contaminated water, fruit, and milk samples.

MATERIALS AND METHODS

Bacteria strains and reagents: A total of 7 common bacterial strains associated with dairy products and human health are listed in Table 1. The bacterial strains were cultured at 37°C overnight. An RPA basic amplification kit including dried reagents, a rehydration buffer, and magnesium acetate was purchased from TwistDx (Cambridge, UK) for isothermal amplification of target sequences. Milk, fruit, and bottled water were obtained from the local supermarket. Other chemicals and necessary reagents were acquired from Sigma-Aldrich (USA).
Table 1

Bacteria strains used in this study

Bacteria strain Source
S. aureus ATCC14028
P. aeruginosa ATCC15442
Escherichia coli ATCC25952
Bacillus cereus ATCC14579
Clostridium perfringens ATCC10543
Clostridium botulinum ATCC3502
S. enterica ATCC14028
L. monocytogenes Lab collection
Bacteria strains used in this study DNA extraction and bacterial cells counting: The cells were incubated overnight in Luria Broth and the genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) method [21]. The concentration and quality of extracted genomic-DNAs were assessed by the optical density of 260 nm and the ratio of 260/280 using a Genova Plus Spectrophotometer (Jenway, UK). DNA was kept at -20°C until needed. The standard plate count method, consisting of diluting a sample with sterile saline diluent until the bacteria are diluted enough to be counted accurately, was used to calculate the number of cells. The final plates in the serial dilution should have between 30 and 300 colonies. Primer design and screening: RPA primers were designed to specifically target the S. aureus Sau-02 and P. aeruginosa lasB sequence regions, respectively. The Primer3 program was used to design the RPA primers as recommended by TwistAmp (TwistDX, UK). In total, 2 primer sets were designed to target each of the S. aureus Sau-02 and P. aeruginosa lasB sequence regions, respectively. The singleplex RPA assay was used to evaluate the amplification efficiency of designed primer sets. The primers were screened based on the brightness and specificity of the amplified product as visualized by agarose gel electrophoresis. Finally, one primer set was selected for each target region (Table 2). All primers were synthesized by IDT (Singapore) and suspended in nuclease-free water to a concentration of 10 µM. The RPA reaction contained 0.24 μM each of forward and reverse primer, 29.5 μL of rehydration buffer, 10.7 μL of nuclease-free water, 2.5 μL of template and a dried enzyme pellet. The reaction was initiated by adding 14 mM magnesium acetate. Next, the tubes were briefly centrifuged to mix all the reagents and placed into the thermal incubator at the proper temperature for the indicated time. The RPA product was analyzed on a 2% agarose gel electrophoresis.
Table 2

Primers used in the RPA assay to detect S. aureus and P. aeruginosa

Name Gene Sequence 5’- 3’ Amplicon length (bp)
Pa-F lasB CCAGCGACACCAGCGGATAGAACATGGTGGC187
Pa-RAACGACGCGCATTTCTTCGGCGGCGTGGT
Sa-F Sau-02 GGCGACATGTTCCTGCATATCGTCTATTTATA239
Sa-RCCAAGTGCTAAAGTTAAATATAATATAGTGCC
Primers used in the RPA assay to detect S. aureus and P. aeruginosa Multiplex RPA assay: Multiplex RPA reactions capable of amplifying two different targets were assembled by rehydrating an RPA enzyme pellet with 41.5-45.5 μl of a master mix depending on the volume of the template. The master mix consisted of 29.5 μl of rehydration buffer, 7.2-11.2 μl of nuclease-free water, 0.24 μM each of S.aureus forward and reverse primers, and 0.24 μM each of P. aeruginosa forward and reverse primers. After rehydrating the enzyme pellet, the template and magnesium acetate (14 mM, final concentration) were added to initiate the reactions. For low copy-number templates, the tubes were taken out after 4 minutes (min), vortexed, spun briefly, and continued to be incubated in the heater until the time was up. Agarose gel electrophoresis was used to visualize the amplified products. Optimization of Multiplex RPA Assay: Incubation time optimization of the multiplex RPA assay was first conducted at different periods of time, including 5, 15, 25, 35 and 45 min at 39°C. The reactions were also incubated under isothermal conditions at a range of 35 to 42°C for 30 min to define the optimal incubation temperature. Afterwards, agarose gel electrophoresis was used to analyze the amplification products. Evaluation of specificity and limit of detection of multiplex RPA: The extracted genomic DNAs of several other bacteria relating to food poisoning were utilized as the template to evaluate the cross-reactivity of the RPA reactions. The in-silico PCR analysis using Genius Primer software (https://www.geneious.com/prime/) was also conducted for specificity evaluation of the multiplex RPA assay. The DNA levels of S. aureus and P.aeruginosa were brought to the same concentration, and a ten-fold serial dilution of genomic DNA was prepared to achieve a DNA concentration ranging from 5 to 104 fg per reaction. One µl of each DNA dilution of each strain was used as the template for multiplex RPA reactions to determine the LOD values. Evaluation of Direct Multiplex RPA Assay: To define the LOD of the direct multiplex RPA test, cell cultures of S. aureus and P. aeruginosa were harvested and resuspended in nuclease-free water in order to produce samples having the same cell concentration of each strain. The two cell solutions were then mixed with a ratio of 1:1 (v/v) and serially diluted in nuclease-free water to achieve the indicated cell concentration. To evaluate the effectiveness of the multiplex RPA assay for the direct detection of S. aureus and P. aeruginosa in drinking food, the cultured cells of S. aureus and P. aeruginosa collected were spiked into fresh milk, fruit juice or bottled water purchased from the local supermarket to produce drinking samples containing the indicated cell concentrations. One µl of each of the spiked samples was used as the template for the direct multiplex RPA tests.

RESULTS

The primer sets selected were utilized in the multiplex RPA reactions to detect both target sequences of S. aureus Sau-02 and P. aeruginosa lasB (Table 2). The results shown in Figure 1 indicate that the two primer sets successfully amplified both target sequences of S. aureus and P. aeruginosa simultaneously (Fig. 1, lane 3). On the other hand, no product was observed in the negative control reaction (Fig. 1, lane 4). Next, the multiplex RPA assay to simultaneously detect the DNA of S. aureus and P. aeruginosa was optimized regarding reaction time and incubation temperature. As shown in Figure 2A lane 4, after 15 min at 39°C, the RPA amplified products could be observed by gel electrophoresis analysis. With longer incubation time, the band intensity of amplicon increased and saturated after 25 min (Fig. 2A, lane 3). The reaction time was thus set for 25 min. Regarding incubation temperature, the optimal temperature of the multiplex RPA reaction was identified at 39°C (Fig. 2B, lane 4).
Figure 1

Multiplex RPA reactions to detect DNA of and . One ng of genomic DNA of S. aureus and P. aeruginosa was used as the template for the singleplex and multiplex RPA reactions. The reactions were incubated at 39 °C for 30 min. The RPA products were analyzed on a 2% agarose gel electrophoresis. Therein, ( ): nuclease-free water was used as the negative control sample (lane 4). Abbreviation, L: DNA ladder

Figure 2

Optimization of the multiplex RPA reactions. The reactions contain one ng of each genomic DNA of S. aureus and P. aeruginosa. (A) The reactions were incubated for 5 to 45 min at 39 °C.(B) The reactions were incubated for 30 min at 35 to 42°C. Abbreviation, L: DNA ladder

To determine the specificity of the multiplex RPA assay, extracted genomic DNAs of several other bacteria commonly associated with foodborne illness, including E.coli, L. monocytogenes, B. cereus, S. enterica, C.perfringens, and C. botulinum, were applied as templates for the multiplex RPA reactions. The results showed that only the DNA of S. aureus and P. aeruginosa strains generated amplified products, while no amplicon was observed with other strains (Table 3), indicating that there was no cross-reactivity among tested bacteria. The results of in silico PCR analysis shown in Table 4 further demonstrated that the designed primer sets would not amplify any non-specific sequences of the 20 different foodborne pathogens examined. Taken together, the obtained data supports that the chosen primer sets possess a high specificity for S. aureus and P. aeruginosa.
Table 3

Cross-reactivity analysis of the multiplex RPA assay detecting S. aureus and P. aeruginosa

No. Strain RPA amplicon
1 S.aureus +
2 P.aeruginosa +
3 S. aureus and P. aeruginosa++
4 E.coli -
5 L.monocytogenes -
6 B.cereus -
7 S.enterica -
8 C.perfringens -
9 C.botulinum -

One ng of genomic DNA of each strain was used for the multiplex RPA reaction. The reactions were incubated at 39°C for 25 min.

Table 4

In silico PCR result (0-3 mismatch allowed in 3'-end)

No. Strain In silico PCR products
S. aureus P. aeruginosa
primers Primers
1S. aureus+
2P. aeruginosa+
3S. enterica
4Salmonella typhi
5C. perfringens
6C. botulinum
7Campylobacter fetus
8Campylobacter jejuni
9Campylobacter coli
10Campylobacter upsaliensis
11Campylobacter lari
12Vibrio vulnificus
13Vibrio cholera
14Shigella dysenteriae
15Shigella sonnei
16Shigella flexneri
17Cryptosporidium oocysts
18Yersinia enterocolitica
19Yersinia pestis
20Yersinia pseudotuberculosis
21B.cereus
22 E.coli
Multiplex RPA reactions to detect DNA of and . One ng of genomic DNA of S. aureus and P. aeruginosa was used as the template for the singleplex and multiplex RPA reactions. The reactions were incubated at 39 °C for 30 min. The RPA products were analyzed on a 2% agarose gel electrophoresis. Therein, ( ): nuclease-free water was used as the negative control sample (lane 4). Abbreviation, L: DNA ladder Optimization of the multiplex RPA reactions. The reactions contain one ng of each genomic DNA of S. aureus and P. aeruginosa. (A) The reactions were incubated for 5 to 45 min at 39 °C.(B) The reactions were incubated for 30 min at 35 to 42°C. Abbreviation, L: DNA ladder Cross-reactivity analysis of the multiplex RPA assay detecting S. aureus and P. aeruginosa One ng of genomic DNA of each strain was used for the multiplex RPA reaction. The reactions were incubated at 39°C for 25 min. In silico PCR result (0-3 mismatch allowed in 3'-end) To identify the LOD value of the multiplex RPA assay, a serial dilution of purified genomic DNA of S. aureus and P. aeruginosa was used as templates for the RPA reactions. The results indicated that the corresponding product was not observed when the DNA template amount of S. aureus was lower than 10 fg/reaction (i.e., 3.56 genome copies) (Fig. 3, lane 6). Meanwhile, 30 fg/reaction (i.e., 3.97 genome copies) was the lowest number of P. aeruginosa genomic DNA that was required for the relevant RPA amplicon to be formed successfully (Fig. 3, lane 5). Thus, the LOD values of the multiplex RPA assay for simultaneous detection of S. aureus and P. aeruginosa were determined at 10 and 30 fg/reaction of S. aureus and P. aeruginosa genomic DNAs, respectively.
Figure 3

Evaluation of LOD of multiplex RPA assay simultaneously detecting S. aureus and P. aeruginosa. The LOD value of the multiplex RPA assay was evaluated using a serial dilution of S. aureus and P. aeruginosa genomic-DNA concentration ranging from 5 to 105 fg/reaction. The reactions were incubated at 39 °C for 25 min. Nuclease-free water was used as the negative control sample (lane 8). Abbreviation, L: DNA ladder

Evaluation of LOD of multiplex RPA assay simultaneously detecting S. aureus and P. aeruginosa. The LOD value of the multiplex RPA assay was evaluated using a serial dilution of S. aureus and P. aeruginosa genomic-DNA concentration ranging from 5 to 105 fg/reaction. The reactions were incubated at 39 °C for 25 min. Nuclease-free water was used as the negative control sample (lane 8). Abbreviation, L: DNA ladder It was previously shown that RPA could directly detect different bacteria cells without the need for DNA extraction [22]. The amplification efficiency depends on the properties of the bacterial cell membrane and the initial membrane treatment methods [22]. In this study, S. aureus and P. aeruginosa cells were also used directly as the template for multiplex RPA reactions under the optimized conditions for DNA-extracted templates. The results showed that the multiplex RPA assay developed was capable of identifying the targeted DNA sequences when a mixture of S. aureus and P. aeruginosa cells was added directly to the reaction (Fig. 4). Notably, the direct multiplex RPA assay was successful without the requirement of the cell-membrane treatment step. The LOD of the direct multiplex RPA assay was thus evaluated by a serial dilution of the mixture containing S. aureus and P. aeruginosa cells. Figure 4 indicates that the direct multiplex RPA can detect as low as 1 and 5 CFU/reaction of S. aureus and P. aeruginosa cells, respectively. There was no RPA amplicon generated at 0.5 CFU/reaction (Fig. 4, lane 6). So, the LOD values of the direct multiplex RPA are determined at 1 CFU/reaction of S. aureus cells and 5 CFU/reaction of P.aeruginosa cells. This finding well agrees with the LOD values identified with genomic DNAs obtained above.
Figure 4

Evaluation of the LOD of direct multiplex RPA detecting S. aureus and P. aeruginosa simultaneously. The cell mixture collected was diluted to concentrations ranging from 0.5 to 103 CFU/reaction. One µl of each concentration was used for multiplex RPA reactions. The reactions were incubated at 39°C for 25 min. Abbreviation, L: DNA ladder

Evaluation of the LOD of direct multiplex RPA detecting S. aureus and P. aeruginosa simultaneously. The cell mixture collected was diluted to concentrations ranging from 0.5 to 103 CFU/reaction. One µl of each concentration was used for multiplex RPA reactions. The reactions were incubated at 39°C for 25 min. Abbreviation, L: DNA ladder Fresh milk, fruit juice and bottled water were used to evaluate the multiplex RPA assay for S. aureus and P. aeruginosa detection in food samples. To this end, the artificially contaminated drinking specimens were prepared by spiking them with different concentrations of S. aureus and P. aeruginosa cells varying from 101 to 103 CFU/reaction. The simulated samples were then examined directly by the multiplex RPA reactions. Without the need for DNA extraction or cell-membrane treatment, the results revealed that S. aureus and P. aeruginosa cells could be successfully detected in food samples by the multiplex RPA assay developed (Fig. 5).
Figure 5

Performance of multiplex RPA assays for direct detection of S. aureus and P. aeruginosa cells in contaminated milk, fruit juice and bottled water. The RPA reactions were examined with simulated food samples spiked with different concentrations of S. aureus and P. aeruginosa cells, ranging from 101 to 103 CFU/reaction. One µl of each concentration was used for multiplex RPA reactions. The reactions were incubated at 39 °C for 25 min. Abbreviation, L: DNA ladder

Performance of multiplex RPA assays for direct detection of S. aureus and P. aeruginosa cells in contaminated milk, fruit juice and bottled water. The RPA reactions were examined with simulated food samples spiked with different concentrations of S. aureus and P. aeruginosa cells, ranging from 101 to 103 CFU/reaction. One µl of each concentration was used for multiplex RPA reactions. The reactions were incubated at 39 °C for 25 min. Abbreviation, L: DNA ladder

DISCUSSION

The common pathogens and have been linked to a variety of foodborne illnesses, including typhoid fever, septicemia, gastroenteritis, and even lethality [23]. Therefore, rapid, economic and reliable identification of S. aureus and P. aeruginosa has become particularly important. Numerous methods, such as real-time PCR, enzyme-linked immunosorbent assays, and electrochemical biosensors, have been developed to detect pathogenic bacteria in food [24-26]. However, because of the need for specialized equipment and time-consuming procedures, these methods are not ideal for the implementation of broad diagnosis in the field. Recently, a variety of isothermal amplification techniques, such as nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal DNA amplification (HDA), RPA, cross-priming isothermal amplification (CPA), polymerase spiral reaction (PSR), etc., have been established to replace PCR in detecting different infectious bacteria precisely and quickly on-site [27]. Nevertheless, multiple pathogens frequently coexist in food, so the conventional detection of a single targeted DNA sequence cannot fulfill the need for multiple detections of different pathogens simultaneously. In contrast, a multiplex amplification reaction can simultaneously and rapidly detect multiple pathogens. In this study, we developed the multiplex RPA assay for precise identification of two foodborne pathogens simultaneously, namely S. aureus and P. aeruginosa. The multiplex RPA assay can be operated at a low constant temperature without a specialized instrument. It is well established that one of the most significant factors that enables the RPA assay to achieve optimal efficiency and sensitivity is the reaction temperature. RPA reaction temperatures should be between 35 and 42°C [28]. Studies have shown that even at the ambient temperature, including body temperature, the RPA reaction can be conducted [29]. In our hands, the multiplex RPA amplicon could be produced at broad temperatures ranging from 37 to 42 °C. Accordingly, the optimal temperature for simultaneous detection of S. aureus and P. aeruginosa by the multiplex RPA assay was determined to be as low as 39°C. Besides, the required incubation time was defined as just 25 min, which is extremely short compared to a typical running time of a PCR reaction. The low temperature and short incubation time of the RPA reaction imply that the amplification efficiency is remarkable, pointing out that the RPA primers are well designed. In agreement, the designed primers also showed high selectivity for S. aureus and P. aeruginosa. The multiplex RPA assay can concomitantly detect 10 and 30 fg/reaction of genomic DNA of S. aureus and P. aeruginosa, respectively. The success of multiplex RPA for simultaneous diagnosis of S. aureus and P. aeruginosa not only maintains the accuracy and sensitivity of the RPA technique but also reduces the number of reagents and operating steps required. RPA was shown to possess a high impurity tolerance of the sample [30]. As expected, the direct addition of bacterial cells to the multiplex RPA reaction also induced the amplification process of the targeted sequences. It is worthwhile to mention that our direct multiplex RPA assay to identify S. aureus and P. aeruginosa cells does not require DNA extraction nor cell treatment prior to the amplification reaction. The remarkable LOD determined at 1 and 5 CFU/reaction of S. aureus and P. aeruginosa cells, respectively, further shows that the direct multiplex RPA developed is extremely sensitive and robust. Importantly, the direct multiplex RPA assay was successfully applied to food samples without the requirement of sample processing, demonstrating its high feasibility in real-world application. In general, this is the first study to successfully establish the direct multiplex RPA assay for simultaneous diagnosis of S. aureus and P. aeruginosa. The assay developed possesses the significant following advantages: (i) low incubation temperature (39°C) and short incubation time (less than 30 min), saving energy; (ii) multiple detection of two pathogens, reducing reagent amount and handling steps required; (iii) highly specific and sensitive; (iv) no need for DNA extraction and sample processing; and (v) simple to apply for high-throughput diagnosis if needed. Consequently, further studies should be performed to evaluate the clinical performance of the assay in realistic application.

Conflict of Interest:

The authors declare no conflict of interest.
  25 in total

1.  PCR-based procedures for detection and quantification of Staphylococcus aureus and their application in food.

Authors:  B Alarcón; B Vicedo; R Aznar
Journal:  J Appl Microbiol       Date:  2006-02       Impact factor: 3.772

Review 2.  Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management.

Authors:  Steven Y C Tong; Joshua S Davis; Emily Eichenberger; Thomas L Holland; Vance G Fowler
Journal:  Clin Microbiol Rev       Date:  2015-07       Impact factor: 26.132

3.  Single-Step Recombinase Polymerase Amplification Assay Based on a Paper Chip for Simultaneous Detection of Multiple Foodborne Pathogens.

Authors:  Heeseop Ahn; Bhagwan Sahebrao Batule; Youngung Seok; Min-Gon Kim
Journal:  Anal Chem       Date:  2018-08-17       Impact factor: 6.986

4.  Fast and specific detection of Pseudomonas Aeruginosa from other pseudomonas species by PCR.

Authors:  G Jami Al-Ahmadi; R Zahmatkesh Roodsari
Journal:  Ann Burns Fire Disasters       Date:  2016-12-31

5.  [Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

Authors:  X J Jin; Y L Gong; L Yang; B H Mo; Y Z Peng; P He; J N Zhao; X L Li
Journal:  Zhonghua Shao Shang Za Zhi       Date:  2018-04-20

6.  Equipment-free incubation of recombinase polymerase amplification reactions using body heat.

Authors:  Zachary Austin Crannell; Brittany Rohrman; Rebecca Richards-Kortum
Journal:  PLoS One       Date:  2014-11-05       Impact factor: 3.240

7.  Single-copy sensitive, field-deployable, and simultaneous dual-gene detection of SARS-CoV-2 RNA via modified RT-RPA.

Authors:  Simin Xia; Xi Chen
Journal:  Cell Discov       Date:  2020-05-28       Impact factor: 10.849

Review 8.  Current and Future Perspectives on Isothermal Nucleic Acid Amplification Technologies for Diagnosing Infections.

Authors:  Godwin Attah Obande; Kirnpal Kaur Banga Singh
Journal:  Infect Drug Resist       Date:  2020-02-12       Impact factor: 4.003

9.  Development of a reverse transcription recombinase polymerase amplification assay for rapid and direct visual detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2).

Authors:  Yee Ling Lau; Ilyiana Binti Ismail; Nur Izati Binti Mustapa; Meng Yee Lai; Tuan Suhaila Tuan Soh; Afifah Haji Hassan; Kalaiarasu M Peariasamy; Yee Leng Lee; Maria Kahar Bador Abdul Kahar; Jennifer Chong; Pik Pin Goh
Journal:  PLoS One       Date:  2021-01-06       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.