Literature DB >> 35463062

Bu Shen Yi Sui Capsules Promote Remyelination by Regulating MicroRNA-219 and MicroRNA-338 in Exosomes to Promote Oligodendrocyte Precursor Cell Differentiation.

Jing Ji1, Ya-Qin Sun1,2, Zheng Zha1, Bing Xue3, Jun-Ling Li1, Liang-Yun Jin3, Fang Qi1, Nan Zhang1, Hui Zhao1, Yong-Ping Fan4, Lei Wang1.   

Abstract

Remyelination is a refractory feature of demyelinating diseases such as multiple sclerosis (MS). Studies have shown that promoting oligodendrocyte precursor cell (OPC) differentiation, which cannot be achieved by currently available therapeutic agents, is the key to enhancing remyelination. Bu Shen Yi Sui capsule (BSYSC) is a traditional Chinese herbal medicine over many years of clinical practice. We have found that BSYSC can effectively treat MS. In this study, the effects of BSYSC in promoting OPCs differentiation and remyelination were assessed using an experimental autoimmune encephalomyelitis (EAE) model in vivo and cultured OPCs in vitro. The results showed that BSYSC reduced clinical function scores and increased neuroprotection. The expression of platelet-derived growth factor receptor α (PDGFR-α) was decreased and the level of 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase) was increased in the brains and spinal cords of mice as well as in OPCs after treatment with BSYSC. We further found that BSYSC elevated the expression of miR-219 or miR-338 in the serum exosomes of mice with EAE, thereby suppressing the expression of Sox6, Lingo1, and Hes5, which negatively regulate OPCs differentiation. Therefore, serum exosomes of BSYSC-treated mice (exos-BSYSC) were extracted and administered to OPCs in which miR-219 or miR-338 expression was knocked down by adenovirus, and the results showed that Sox6, Lingo1, and Hes5 expression was downregulated, MBP expression was upregulated, OPCs differentiation was increased, and the ability of OPCs to wrap around neuronal axons was improved. In conclusion, BSYSC may exert clinically relevant effects by regulating microRNA (miR) levels in exosomes and thus promoting the differentiation and maturation of OPCs.
Copyright © 2022 Jing Ji et al.

Entities:  

Year:  2022        PMID: 35463062      PMCID: PMC9020954          DOI: 10.1155/2022/3341481

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.650


1. Introduction

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system (CNS) that is characterized by chronic inflammatory demyelination. MS is one of the most common neurodegenerative diseases in young individuals who are in the prime of their lives; MS involves myelin rupture [1] and subsequent inflammation, myelin sheath demyelination, and axonal and neuronal damage, which result in multisite neurological dysfunction and clinical manifestations, such as limb weakness, numbness, pain, vision loss, and abnormal urination. In the early stages of the disease, most patients present with relapsing-remitting features, and 75% of patients develop secondary progressive MS, which eventually causes blindness, paralysis, and even death, after 30 years [2]. Due to its high relapse and disability rates, MS causes great distress and heavy burdens for patients' families and society. MS was discovered in humans almost 200 years ago, and its etiology and underlying mechanisms, which may be related to genetics, immune responses, viral infection, and the environment, remain unclear [3]. The disease can lead to neurological deficits [4]; therefore, promoting myelin regeneration is an important strategy for the neurological rehabilitation of patients with MS [5]. Immunomodulation (e.g., via hormone treatment) is a therapeutically effective approach that is currently used to attenuate neurological damage in MS patients; however, long-term use of immunomodulatory drugs at high concentrations clearly causes adverse effects, and there is no safe and effective method for alleviating pathological demyelination in patients with MS. In recent years, studies have found that traditional Chinese medicines have significant advantages and potential for the prevention and treatment of MS. Bu Shen Yi Sui is an established formula developed by Professor Fan Yongping of Tiantan Hospital for the treatment of MS. BSYSC has good clinical efficacy and has been developed as a capsule. BSYSC can significantly reduce the recurrence rate of MS and promote immune homeostasis restoration and neurological rehabilitation in patients with MS [6-8]. Previous studies have confirmed that BSYSC, which tonifies the kidney, eliminates phlegm, and activates blood circulation, can delay and prevent the occurrence of experimental autoimmune encephalomyelitis (EAE) in mice. BSYSC can alleviate the inflammatory response by mediating the regulation of Th17 and Treg cells and the related cytokines in the CNS [9]. BSYSC can also alleviate pathological damage in mice with EAE, alleviate neurological damage, and promote myelin regeneration and repair [10], but the underlying mechanism and regulatory relevant signaling pathways are not yet clear. Loss of oligodendrocyte (OL) function and failure of oligodendrocyte precursor cells (OPCs) to differentiate are usually observed in areas of myelin damage [11, 12]. Although a large number of OPCs are recruited to demyelinating lesions, remyelination does not occur, especially during the remission period, when demyelination is more severe [13]. The main reason for this is the high expression of various inhibitory factors such as Hes5, Sox6, and nogo receptor-interacting protein 1 (Lingo1), which exert negative regulatory effects on the differentiation maturation and myelination of OPCs, in the injury zone; inhibition of OPCs differentiation leads to failure of myelin regeneration, causing axonal degeneration and neuronal damage [14]. OPCs are responsible for myelin regeneration. After myelin injury, OPCs are recruited to the site of injury and differentiate into mature oligodendrocytes, which form myelin and wrap around axons to restore their neurological function. OPCs express specific molecules at different stages of differentiation; they express markers such as platelet-derived growth factor receptor (PDGFR) α early in differentiation, then gradually differentiate into naive oligodendrocytes that express O4 and cyclic nucleotide 3′-phosphodiesterase (2′,3′-cyclic nucleotide 3′-phosphodiesterase, CNPase) and eventually develop into mature oligodendrocytes that express myelin basic protein (MBP) [15]. Exosomes are a class of extracellular vesicles approximately 30–150 nm in diameter that contain substances such as proteins, lipids, and nucleic acids that are involved in multiple physiological and pathological processes. Exosomes can mediate cellular communication through their direct interaction with surface signaling molecules and their release of active components upon membrane fusion [16]. Interestingly, exosomes can travel to distant tissues or cells and can cross the blood-brain barrier (BBB) to enter the CNS [17, 18]. MicroRNAs (miRs) are endogenous, small, and single-stranded noncoding RNAs that are approximately 21–23 bases in length; miRs bind to the 3′ untranslated regions of target mRNAs and regulate target genes at the posttranscriptional level. miRs play important roles in the regulation of target gene expression, and the stability of miRs outside of cells is dependent on their associations with various vectors. Exosomes are important carriers of miRs [19]. The proportion of miRs in exosomes is higher than that in source cells due to the greater variations in miRs levels and the “miR sponge effect” [20]; thus, miR levels in exosomes can reflect changes in the overall levels of miRs. In the last decade, substantial research progress has been made in understanding the roles of miRs in exosomes in MS and EAE animal models [21]. Exosomes are involved in the pathological processes related to neurodegenerative diseases, such as MS. In addition, exosomes are involved in the process of myelin formation [22]. Recent studies have shown that high expression of certain miRs such as miR-219 and miR-338 in exosomes promotes myelin formation or oligodendrocyte regeneration [23-25]. These miRs act synergistically to promote the differentiation of OPCs, with miR-219 having the strongest and most persistent effect and miR-338 enhancing the effect of miR-219 [25, 26]. Exosomes that strongly overexpress miR-219-5p promote differentiation and cross the BBB more effectively than liposomes and polymeric nanoparticles; thus, they can effectively alleviate clinical symptoms in mice with EAE [27]. Moreover, delivery of miR-219 via exosomes has been shown to exert a potential therapeutic effect in inducing remyelination and improving cognitive function in MS patients [28]. There is evidence that miR-219 can repress the activity of multiple transcription factors and signaling molecules that negatively regulate OPCs differentiation, such as Sox6, Hes5 [29], and Lingo1 [30], to promote OPCs differentiation and remyelination. Overexpression of miR-338 in OPCs using lentivirus increases the expression levels of oligodendrocyte markers, such as MBP, in transduced cells [31]; additionally, overexpression of both miR-338 and miR-219 inhibits Sox6 and Hes5 expression, suggesting that miR-338 and miR-219 exert a synergistic effect in the treatment of demyelination-related diseases. Therefore, based on preliminary research, the effects of BSYSC on the miR-219 and miR-338 levels in serum exosomes from mice with EAE as well as its regulatory effects on their target genes, Hes5, Sox6, and Lingo1, were investigated in this study by using an internationally recognized mouse model of EAE. We also assessed whether serum exosomes of BSYSC-treated mice (exos-BSYSC) play a role in promoting the differentiation of OPCs after the knockdown of miR-219 or miR-338 expression in vitro. Therefore, in this study, we investigated the molecular mechanism by which BSYSC affects miRs levels in exosomes and their target genes to mediate OPCs differentiation and promote myelin regeneration. This study aimed to provide a scientific basis for the application of BSYSC to treat MS through the tonification of the kidneys, resolution of phlegm, and revitalization of blood.

2. Materials and Methods

2.1. Drug Preparation

BSYSC consists of the following Chinese herbal medicines: Rehmanniae Radix (Rehmannia root), Rehmanniae Radix Praeparata (processed Rehmannia root), Polygoni Multiflori Radix (fleeceflower root), Rhei Radix et Rhizoma (rhubarb), Leonuri Herba (motherwort herb), Fritillariae Thunbergii Bulbus (Thunberg fritillary bulb), Hirudo (leech), Scorpio (scorpion), Gastrodiae Rhizoma (tall Gastrodia tuber), and Forsythiae Fructus (weeping forsythia capsule) [32]. The ratio of these herbs is 10:10:10:2:10:6:3:2:3:6. BSYSC was prepared by Beijing Yadong Bio-Pharmaceutical Co. Ltd. Ultraperformance liquid chromatography-quadrupole time-of-flight mass spectrometry was used to qualitatively identify the components of Chinese medicine, and the chemical components PISTIL glycoside, forsythoside A, echinacoside, chrysophanol, and emodin were identified. The contents of digitonin and phillyrin were determined to be 0.79 mg/g and 0.63 mg/g [9], confirming the quality of the formula. Prednisone acetate (PA) was manufactured by Tianjin Lisheng Pharmaceutical Co.

2.2. Mouse Model and Treatments

Female-specific pathogen-free (SPF) grade C57BL/6 mice (n = 40; 16–18 g) were obtained from Beijing Vital River Laboratory Animal Technology Co. Ltd. (SCXK (Beijing) 2016-0006) and housed at the Experimental Animal Center of Capital Medical University (SYXK (Beijing) 2018-0003). All the mice were randomly divided into four groups: the normal control (NC) group, EAE group, EAE + PA group, and EAE + BSYSC group. The mouse model was established, and treatments were administered in manners consistent with our previous study [33]. The morbidity, body weight, and neurological function score of each mouse were recorded daily, and statistical analysis was performed. Mice with EAE were sacrificed at day 40 (the remission period) for analysis.

2.3. Clinical Scores

Clinical scores were assigned according to Weaver's 15-point scoring system [34]. The tail activity was assessed according to a 3-point scale, with 0 point indicating no symptoms, 1 point indicating reduced tail tension or distal tail paralysis, and 2 points indicating total tail paralysis. Limb activity was evaluated on a 4-point scale, with 0 point indicating no symptoms, 1 point indicating unsteady gait, 2 points indicating limb dragging while walking, and 3 points indicating total limb paralysis and limb turning while walking. The total score was obtained by adding each individual score, with 0 points indicating no symptoms and 15 points indicating death.

2.4. Histopathology

Mice were anesthetized with 3% pentobarbital sodium, followed by rapid cardiac lavage with normal saline and slow perfusion with 4% paraformaldehyde (PFA) for 30 min. Luxol fast blue (LFB) staining was performed as previously described [35]. The brain sections from the third ventricular area and the spinal lumbar enlargement area sections (10 μm) were rehydrated, immersed in 0.2% solvent blue 38, and incubated at 60°C overnight. The slides were subsequently processed to remove excess stain and distinguish myelin-specific colors. The sections were washed, dehydrated with anhydrous ethanol, cleared with xylene, fixed with resin medium, and observed under a microscope. Four-micron-thick sections were subjected to 0.1% LFB staining for pathological observation. Images of LFB-stained sections were obtained using Case Viewer software, and an integrated optical density (IOD) analysis of the blue signal was performed using ImageJ 8.0 [36].

2.5. Primary OPCs Culture

First, culture flasks were coated with poly-L-lysine (PLL), and then mixed glial cells were isolated from the cortices of neonatal (0–24 h old) SD rats. The cortical tissues were cut into small pieces and digested using 1% trypsin; then mixed glial cells were obtained by resuspending the cells in DMDM/F12 basal medium supplemented with 10% FBS followed by centrifugation. The culture medium of the mixed glial cells was changed every 2 days. After 4 days of culture, the cells were cultured for 5 days in a B104-conditioned medium and 1% N2 supplement (Invitrogen, USA), and they were isolated and purified when they reached confluence [36]. This process was repeated 2–3 times to obtain pure OPCs. The cells were cultured in exosome-free serum (abs993).

2.6. Primary Neurons Culture

Mixed glial and neuronal cells were obtained from the cortices and hippocampi of neonatal (0–24 h old) SD rats, and the mixed glial cells and neurons were extracted following the method of OPCs extraction. Four hours after inoculation, the medium was changed to a growth medium (neurobasal medium supplemented with 1% B27), and neurons were obtained by changing the medium every 3 days. Purified neurons were identified by fluorescence staining of microtubule-associated protein 2 (MAP-2, ab5392).

2.7. Cell Coculture

For coculture, rat neurons and OPCs were prepared separately, and after 10 days, OPCs were cocultured with neuronal cells in a coculture medium [37]. The medium was changed every other day to maintain cellular viability.

2.8. Adenovirus Infection

An adenovirus was designed and synthesized by Hanbio Biotechnology Co. Ltd. (Shanghai, China). After primary OPCs were isolated, they were transduced with either the Adeasy-U6-rno-miR-219a-5p-sponge-CMV-EGFP or Adeasy-U6-rno-miR-338-5p-sponge-CMV-EGFP vector at the optimal multiplicity of infection (MOI). Then, the cells were transduced at 37°C for 4 h, and the normal volume of medium was replenished by adding 0.25 mL culture medium. After 6–8 h of transduction, the medium was replaced with an equal volume of fresh medium, and the cells were further cultured in an incubator at 37°C. After 48 h of transduction, GFP expression was evaluated by fluorescence microscopy.

2.9. Immunofluorescence Staining

Four sections from each animal were selected for analysis, and the segments of the brain and spinal cord that were analyzed included the third ventricle and lumbar expansion. Then, the sections were dewaxed, hydrated, and subjected to antigen retrieval with citrate buffer at 95°C for 20 min. The sections were blocked with 10% goat serum at 37°C for 60 min. Antibodies specific for neurofilament heavy chain (NF-H, Cat# ab82259), neurofilament medium chain (NF-M, Cat# ab7794), neurofilament light chain (NF-L, Cat# ab223343), PDGFR-α (Cat# ab203491), CNPase (Cat# 13427-1-AP), and MBP (Cat# 254026) were purchased from Abcam (Cambridge Science Park, Cambridge, UK), and an antibody specific for oligodendrocyte lineage transcription factor 2 (Olig2, Cat# AF2418) was purchased from R & D Systems (Emeryville, CA, USA). Five visual fields per brain or spinal cord section were randomly selected for statistical analysis. To analyze primary OPCs morphology, 500 μl of a single-OPC suspension was plated in 24-well plates coated with PLL (1 × 104 cells/well) for 24 h. Then, exos-BSYSC were added. After 48 h, the cultured cells were fixed in 4% PFA and immunolabeled to assess MAP-2 (ab5392) and MBP (Cat# ab40390, 1:200, Abcam, Cambridge, UK) expression. The secondary antibodies were as follows: Alexa Fluor 488-conjugated goat anti-mouse IgG (Cat# ab150113), Alexa Fluor 488-conjugated goat anti-rabbit IgG (Cat# ab150077), Alexa Fluor 647-conjugated goat anti-mouse IgG (Cat# ab 150115), Alexa Fluor 594-conjugated donkey anti-rabbit IgG (Cat# ab150080), and Cy3-conjugated donkey anti-goat IgG (Cat# ab6949); antibodies were purchased from Abcam (Cambridge Science Park, Cambridge, UK).

2.10. Quantitative Real-Time Polymerase Chain Reaction (qRT–PCR)

mRNA was extracted from brains and spinal cords in an RNase-free environment. The gene expression levels were measured using qRT–PCR with the Toyobo one-step kit. Primers specific for Lingo1, Sox6, Sox4, Hes5, and β-actin were chosen according to a previous study [30, 38–40], and the sequences of the primers are listed in Table 1. Primers specific for the miRs were designed according to the poly-A method and provided by Applied Biological Materials Inc. The amplification curves were analyzed using Bio-Rad CFX manager software. The expression of the target genes was normalized to the expression of a housekeeping gene (β-actin or miR-103 [41, 42]) and normalized to the control group. The ∆∆CT method was used to determine the fold increase in gene expression in the experimental groups compared to gene expression in the control group. Statistical analysis was performed with unpaired t-tests using GraphPad Prism 9 (GraphPad Software, La Jolla, CA, USA). The experimental results were validated according to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines [43].
Table 1

The sequences of the primers used for qRT–PCR analysis.

GeneForwardReverse
Hes5AGTCCCAAGGAGAAAAACCGAGCTGTGTTTCAGGTAGCTGAC
Sox6AATGCACAACAAACCTCACTCTAGGTAGACGTATTTCGGAAGGA
Lingo1ATGCTGGCAGGGGGTATGATTCCTACCCCCAATGTGTC
β-actinTGCGTGACATCAAAGAGAAGAGAAGGAAGGCTGGAAAAG

2.11. Western Blotting (WB) Analysis

Protein was extracted from mouse tissues and OPCs in vitro. WB analysis of Lingo1, Sox6, Hes5, and MBP expression was performed. In our experiments, the densities of the target protein bands were normalized to that of β-actin as a loading control. After a final wash step in PBS, the blots were developed using the enhanced chemiluminescence (ECL) method via the Fusion FX6 XT system. ImageJ 8.0 was used for image processing and analysis. The density of the bands was measured, and the expression of each protein was semiquantitatively analyzed by calculating the ratio of the gray value of the target protein to that of β-actin.

2.12. Preparation of BSYSC-Containing Serum

Adult SD rats were randomly divided into the following two groups: (1) the normal control (NC) group, which was treated with distilled water, and (2) the BSYSC group. BSYSC powder was dissolved in distilled water (11.7 g raw herb/kg) and through gastric tubes twice per day for 7 days [10, 44], the rats were administered 11.7 g/kg BSYSC through gastric tubes twice per day for 7 days. Two hours after the BSYSC treatment on day 7, blood was collected from the abdominal aortas of the rats into polypropylene tubes and incubated at 4°C for 4 h. The subsequent steps were the same as in previous studies [9, 10].

2.13. Isolation and Characterization of Exosomes

Exosome isolation was performed by ultracentrifugation [45]. Exosomes were characterized by TEM, nanoparticle tracking analysis (NTA), and WB analysis. The exosomes samples were thawed in a water bath, diluted 1:50 with dd-H2O, and mixed well. The mixed samples were deposited on precoated formvar/carbon support film copper mesh electron microscopy grids (FCF200H-CU-TB; Aurion, the Netherlands) and allowed to stand for 10 min. The excess exosome solution at the edge of the copper mesh grids was absorbed by using filter paper. The samples were negatively stained with 2% phosphotungstic acid aqueous solution at room temperature for 30 s. The liquid was absorbed with filter paper, and the samples were washed gently with distilled water 3 times. After the copper mesh grids dried, the morphology of the exosomes was observed under a transmission electron microscope. For NTA, the water levels were measured, internal flushing was performed (Pump-Temp), and the samples were checked for air bubbles (scale). Next, after external flushing, the amount of standard liquid (flush) was measured, and the samples were diluted according to the concentration of each sample. The particle density was moderate, with 100–200 particles being appropriate. If the density was too small or too high, the original sample (or PS standard) was washed again, focused on, and assessed with the Particle Metrix ZetaView 120 device. To achieve optimal measurements, all the exosome samples were diluted with PBS to achieve a particle concentration within the optimal range (3 × 108 − 1 × 109) for the NTA software. For each individual sample, three 60 s videos were recorded, and all the videos were analyzed with NTA software version 3.2. WB analysis was performed as described previously. The membranes were incubated with the antibodies obtained from Abcam (Cambridge Science Park, Cambridge, UK) specific for the following proteins: CD63 (ab68418, 1:200), Alix (ab117600, 1:1000), CD9 (ab92726, 1:1000), TSG101 (ab133586, 1:1000), Hsp70 (ab2787, 1:2000), and the negative marker Calnexin (ab133615, 1:1000).

2.14. Extraction of Serum Exosomal miRs with an ExoEasy Maxi Kit

After serum exosomes were extracted by ultracentrifugation, an exo-miRs extraction kit (Qiagen, Germany) was used according to the manufacturer's instructions.

2.15. Statistics

The data are expressed as the mean ± standard error (SE) and were analyzed using SPSS 26.0 (SPSS Inc., Chicago, IL, USA) statistical software. All the data were first considered normally distributed for descriptive statistics, and data with normal distributions and equal variances were compared between groups using one-way ANOVA followed by the Bonferroni post hoc test. The rank-sum test was used to analyze data that were not normally distributed. For all tests, differences were considered statistically significant at p < 0.05.

3. Results

3.1. Effect of BSYSC on Clinical Scores, LFB Staining, and Neurofilament (NF) 68, NF 160, and NF 200 Expression in the Brains and Spinal Cords of Mice with EAE

The clinical scores of the mice in each model group were elevated beginning on day 17, indicating the onset of disease, and the scores of the mice in the EAE group peaked on day 20 when the average score was 5 and subsequently steadily declined (p < 0.05 or p < 0.01) until day 34. The overall trend of these changes was similar between the treatment group and the EAE group; however, the clinical scores of the PA and BSYSC groups were significantly lower than those of the EAE group on days 18–40 after the model was established (p < 0.05 or p < 0.01), and symptoms were significantly milder in the BSYSC treatment group, which had a peak score of 1.5 than the EAE group (p < 0.01). The peak average and cumulative clinical scores were also significantly lower in the treated groups than in the EAE group (p < 0.05 or p < 0.01; Figure 1(a)).
Figure 1

BSYSC improved the clinical scores, ameliorated demyelinating lesions, and relieved axonal injury in mice with EAE. (a) The clinical score, the highest average clinical score, and the cumulative clinical score for each group of mice. (b) Fluorescence staining for MBP and Olig2 was performed in the brains and spinal cords of mice. Semiquantitative analysis of MBP fluorescence in the brains and spinal cords of mice was performed with ImageJ. Cell nuclei were stained with DAPI. (c) Fluorescence staining of NF68, NF160, and NF200 was performed in the brains and spinal cords of mice. Semiquantitative analysis of NF68, NF160, and NF200 fluorescence in the brains and spinal cords of mice was performed with ImageJ. Cell nuclei were stained with DAPI, The data are expressed as the mean ± SE (n = 4 in each group at each time point, and each sample was repeated three times). NC: normal control group, EAE: model group, EAE + PA: PA-treated group, and EAE + BSYSC: BSYSC-treated group. p < 0.05 or p < 0.01 versus the NC group and #p < 0.05 or ##p < 0.01 versus the EAE group.

MBP is expressed at the late stage of differentiation of OPCs and is a marker of oligodendrocyte maturation [46]. The expression of MBP in the brains and spinal cords of mice in each group was detected by immunofluorescence. The results showed that the expression of MBP of mice with EAE was significantly decreased (p < 0.01), and the expression of MBP in the brains and spinal cords of PA- and BSYSC-treated mice was significantly increased compared with mice with EAE (p < 0.01; Figure 1(b)). In addition, LFB staining results showed a significant loss of myelin sheath in the EAE group compared to the NC group (p < 0.01). The area of the myelin sheath in the brain and spinal cord increased after BSYSC treatment, and demyelination was improved in the BSYSC group compared with the EAE group (p < 0.01; Figure S1). There was no statistically significant difference in Olig2+ expression in the brain and spinal cord of each group of mice, and the statistics are presented in Supplementary Figure 2. Reduced expression of NF is a common response to axonal injury, and the expression of NF68, NF160, and NF200 in the brains and spinal cords of mice was assessed by immunofluorescence. The results showed that the expression of NF68, NF160, and NF200 in the brains and spinal cords of mice with EAE was significantly decreased, indicating that the regeneration of nerve fibers was significantly reduced in the EAE group compared with the NC group (p < 0.01). However, the expression of NF68, NF160, and NF200 in the brains and spinal cords of PA- and BSYSC-treated mice was significantly increased compared with that in the brains and spinal cords of mice with EAE (p < 0.05 or p < 0.01; Figure 1(c)), indicating that the axonal damage in the brains and spinal cords of mice was repaired after treatment with PA and BSYSC.

3.2. Effect of BSYSC on PDGFR-α/KI67 and CNPase/Olig2 Expression in the Brains and Spinal Cords of Mice

PDGFR-α is a marker of OPCs and is expressed by immature oligodendrocytes. As OPCs mature into oligodendrocytes, PDGFR-03B1 expression rapidly decreases [47]. KI67 is a well-established marker of cell proliferation. Double labeling of PDGFR-α and KI67 by immunofluorescence allowed a comparison of the number of newly proliferating immature OPCs between different groups. The expression of two proteins in the third ventricles and spinal cords of mice was assessed by immunofluorescence. The results showed that the expression of PDGFR-α was significantly increased in the EAE group. This result may have been due to the migration of OPCs to the site of the lesion after demyelination. In contrast, PDGFR-α expression was significantly lower in the treated mice than in the mice with EAE. This result may have occurred because when demyelination occurred, many number of OPCs migrated to the demyelination area; then the administration of BSYSC promoted some of these OPCs to differentiate, leading to a significant reduction in the number of OPCs in this group compared with that in the EAE group. This indicates that after myelin damage, the number of OPCs were not decreased, but the effective differentiation rate was decreased (Figure 2(a)). This finding further indicates that the reason for the failure of remyelination in MS is the inadequate differentiation of OPCs rather than a lack of OPCs.
Figure 2

Elevated PDGFR-α and KI67, CNPase, and Olig2 expression in the brains and spinal cords of mice with EAE. Fluorescence staining for PDGFR-α, KI67, CNPase, and Olig2 was performed in the brains and spinal cords of mice. Statistical analysis of PDGFR-α and KI67 protein expression in the brain and spinal cord was performed in different groups of mice by cell counting with ImageJ. Semiquantitative analysis of CNPase and Olig2 fluorescence in the brains and spinal cords of mice was performed with ImageJ. Cell nuclei were stained with DAPI. Pictures were taken at 50x and 200x magnification. The data are expressed as the mean ± SE (n = 4 in each group at each time point, and each sample was repeated three times). p < 0.01 versus the NC group and #p < 0.05 or ##p < 0.01 versus the EAE group.

CNPase is expressed in the middle and later stages of OPCs differentiation and is a marker of oligodendrocyte maturation. Olig2, a key transcription factor required for oligodendrocytogenesis [48], is expressed in all stages of OPCs differentiation. CNPase in the brains and spinal cords of mice was labeled by immunofluorescence. The results showed that the expression of CNPase in mice with EAE was significantly decreased (p < 0.01) compared with that in NC mice and that the maturation of oligodendrocytes was significantly reduced. OPCs numbers were relatively preserved in mice with EAE, but mature oligodendrocytes were lacking, suggesting that differentiation was blocked, leading to remyelination failure. The expression of CNPase in mice treated with BSYSC was significantly increased (p < 0.05; Figure 2(b)) compared with that in mice with EAE. In addition, we found no statistically significant difference in Olig2 expression, which, together with the PDGFR-α with KI67 staining results, suggests that the lack of remyelination in MS is likely due to a failure of OPCs differentiation rather than a lack of OPCs. These results indicate that axonal injury in the brains and spinal cords of mice was significantly alleviated after BSYSC treatment, and the treatment increased the ability of OPCs to differentiate and thus promoted the repair of axonal damage in the brains and spinal cords of mice.

3.3. Characterization of Exosomes from Mouse Serum and the Effect of BSYSC on the Expression of miR-219 and miR-338 in Exosomes

Exosomes were extracted from serum by ultracentrifugation. Exosomes play an indispensable role in communication between different cells [45]. They not only play an irreplaceable role in normal physiological processes such as the immune response [49], inflammation [50, 51], and neuronal function [52] but are also associated with neurodegenerative diseases [53, 54]. Consistent with the general characteristics of exosomes, TEM revealed that the particles obtained from mouse serum and serum from BSYSC-treated mice were spherical structures with a diameter of approximately 100 nm (Figure 3(a)). NTA was performed to assess dynamic nanoparticle morphology and size, and the results revealed that these particles were homogeneous circular vesicles with diameters of 50–150 nm (Figure 3(b)). WB analysis was performed to measure the expression levels of the exosome marker proteins CD9, TSG101, Hsp70, and Alix (https://exocarta.org/exosome_markers), and the results confirmed that the isolated particles expressed these four proteins but not the negative control endoplasmic reticulum-specific protein calnexin (Figure 3(c)). The above results indicate that the components of the pellet obtained from mouse serum using ultracentrifugation exhibit the main features of exosomes and that subsequent experiments could be performed using this method.
Figure 3

BSYSC promoted miR-219 and miR-338 expression in mouse serum exosomes. (a) The spherical morphology and bilayer membrane structure of isolated exosomes were observed by TEM. (b) The size and distribution of exosomes, as determined by NTA. (c) WB analysis of the expression of Hsp70, Alix, and calnexin in exosomes isolated from mouse sera; Hsp70, and Alix are marker proteins of exosomes, and calnexin is an endoplasmic reticulum-specific protein that was used as a negative control to identify components of mouse serum other than exosomes and used in combination with exosome marker proteins to identify exosomes. (d) Expression of miR-219 and miR-338 between different groups of mice. NC, normal group; EAE, model group; EAE + PA, PA-treated group; EAE + BSYSC, BSYSC-treated group. The data are expressed as the mean ± SE (n = 3 in each group at each time point, and each sample was repeated three times). p < 0.01 versus the NC group and #p < 0.05 versus the EAE group.

miRs are considered promising tools for inducing OPCs differentiation and thus remyelination, and miR-219 and miR-338 derived from exosomes play roles in promoting remyelination in EAE animal models [28]. In this experiment, the exoEasy kit was used to extract miRs from serum exosomes with a membrane affinity centrifugation column. The results showed that the expression levels of miR-219 and miR-338 in the serum exosomes of mice with EAE were significantly decreased compared with those in the serum exosomes of NC mice (p < 0.01) and that the expression of miR-219 and miR-338 in the serum exosomes of BSYSC-treated mice was significantly increased compared with that in the serum exosomes of mice with EAE (p < 0.05; Figure 3(d)).

3.4. Effect of BSYSC on Sox6, Hes5, and Lingo1 Gene and Protein Expression in the Brains and Spinal Cords of Mice

Sox6, Hes5, and Lingo1 mRNA and protein expression levels were measured in the hippocampal, subventricular, and corpus callosum regions of the brain, and mRNA and protein expression levels were measured in the lumbar expansion region to assess the levels in the spinal cord. The expression levels were measured using qRT–PCR and WB analysis. The expression levels of target genes and proteins were significantly increased in mice with EAE compared with NC mice (p < 0.05 or p < 0.01), proving that OPCs differentiation was inhibited and that the degree of remyelination was low. Compared with those in the EAE group, the gene protein expression levels in the mice in the PA and BSYSC-treated groups were significantly reduced (p < 0.05 or p < 0.01; Figure 4). The experimental results show that BSYSC promotes myelin regeneration in mice.
Figure 4

BSYSC inhibits the mRNA and protein expression of Sox6, Hes5, and Lingo1 in the brains and spinal cord of mice with EAE. Gene and protein levels in the brains and spinal cords of mice in each group were measured by qRT-PCR and WB analysis, and the data were statistically analyzed by SPSS. The data are expressed as the mean ± SE (n = 4 in each group at each time point, and each sample was repeated three times). p < 0.01 versus the NC group and #p < 0.05 or ##p < 0.01 versus the EAE group.

3.5. Characterization of Serum Exosomes from BSYSC Treated Mice and the Effect of Exos-BSYSC on OPCs Proliferation

The serum exosomes from BSYSC-treated mice were characterized (Figures 5(a)–5(c)). miR-219 or miR-338 expression promotes the differentiation and maturation of OPCs into oligodendrocytes, which may promote the remyelination of axons after nerve injury in the CNS 54. We found that in vivo the expression of miR-219 or miR-338 in serum exosomes was significantly reduced in the model group, while the expression of miR-219 or miR-338 could be promoted by treatment with BSYSC. Therefore, in an in vitro experiment, we further extracted exos-BSYSC to observe whether the miRs in exos-BSYSC promote the differentiation of OPCs. We observed cellular phagocytosis of exosomes (Figure 5(d)). The protein content of the purified serum exosomes derived from BSYSC-treated mice was determined by the BCA assay, and the proteins were diluted to an appropriate concentration to assess OPCs activity. The CCK-8 assay was performed with exosomal protein concentrations of 10, 20, and 30 μg/mL (Figure 5(e)).
Figure 5

Exos-BSYSC were phagocytosed by OPCs. (a) The spherical morphology and bilayer membrane structure of isolated exosomes were observed by TEM. (b) The size and distribution of exosomes, as determined by NTA. (c) WB analysis of the expression of Hsp70, Alix, and calnexin in serum exosomes isolated from BSYSC-treated mice. (d) Dynamic observation of OPCs phagocytosing exosomes. The numbers in the figure represent the time in min from when a cell began to be scanned to the time that the image was taken. The arrow indicates the entry of exosomes on the cell membrane into the cell. The scale bar is 20 μm. (e) The OPCs proliferation rate was measured by the CCK-8 assay after incubation with different concentrations (5, 10, and 20 μg/mL) of exosomes for 24 h.

Exosomes on the cell membrane were gradually phagocytosed by the cells and the number of exosomes phagocytosed by OPCs increased with time. The highest cell proliferation efficiency was achieved when the exos-BSYSC protein concentration was 20 μg/mL.

3.6. Effect of Exos-BSYSC on Sox6, Hes5, and Lingo1 Protein Expression in OPCs

First, OPCs were transduced with an empty adenovirus at four different MOIs (0.4, 0.8, 1.0, and 1.2) for 72 h. The number of fluorescent cells was counted, and it was found that transfection of OPCs with the virus was the most efficient at an MOI of 1.0 (Figure 6(a)).
Figure 6

Exos-BSYSC inhibited the protein expression of Sox6, Hes5, and Lingo1 in OPCs. (a) Assessment of virus infection efficiency. (b) Protein levels in the different groups of OPCs were measured by WB analysis, and the data were statistically analyzed by SPSS. The data are expressed as the mean ± SE (n = 4 in each group at each time point, and each sample was repeated three times). p < 0.01 versus the NC group and #p < 0.05 or ##p < 0.01 versus the Ad. miR-219a-5p sponge group. Effect of exos-BSYSC on OPCs differentiation after knockdown of miR-219 or miR-338 expression.

In vivo, the expression of miR-219 and miR-338 in the serum exosomes of the mice in the EAE group was significantly lower than that in the serum exosomes of the mice in the NC group, while miR-219 and miR-338 expression increased significantly after BSYSC treatment. Therefore, we specifically knocked down miR-219 or miR-338 expression in OPCs in vitro, added exos-BSYSC, and observed the expression of miR-specific target genes that inhibit the differentiation of OPCs in the different groups. The experimental results showed that after the knockdown of miR-219 or miR-338 expression, the cells showed significantly higher expression levels of target proteins (p < 0.05 or p < 0.01), demonstrating that OPCs differentiation was inhibited. Protein expression levels were reduced in the exos-BSYSC group compared to the knockdown group, and the difference was somewhat statistically significant (p < 0.05 or p < 0.01; Figure 6(b)). The results showed that exos-BSYSC can reduce the expression of factors that inhibit OPCs differentiation after the knockdown of miR-219 or miR-338 expression. The expression of miR-219 or miR-338 was knocked down in OPCs to determine whether exos-BSYSC can promote the differentiation of OPCs and their ability to wrap around neuronal axons. The addition of exos-BSYSC resulted in a higher number of OPCs and a higher degree of OPCs differentiation, as determined by fluorescence staining of MBP; these results suggest that exos-BSYSC promoted the differentiation of OPCs and rescued the impairment of OPCs differentiation after miRs knockdown (Figures 7(a) and 7(b)). The MBP protein expression results further confirmed the effect of exos-BSYSC in promoting the differentiation of OPCs (Figure 7(c)). Coculture of the OPCs with neuronal cells further revealed that OPCs could better wrap around neuronal axons after treatment with exos-BSYSC (Figure 7(d)). We did not perform a quantitative analysis but chose the direct observation method, which is our limitation. Further quantitative analysis of myelin sheath wrapping will be performed in subsequent experiments.
Figure 7

Exos-BSYSC promoted the differentiation of OPCs after knockdown of miR-219 or miR-338 expression. (a) and (b) OPCs were treated with exos-BSYSC (20 μg/mL). Fluorescence staining of MBP expression was performed in vitro. The expression of MBP was assessed by manual counting. The cell nuclei were stained with DAPI. Pictures were taken at 200x magnification. (c) Changes in MBP protein expression in vitro. (d) Fluorescence staining of MBP and MAP-2 expression was performed in vitro. The cell nuclei were stained with DAPI. The scale bars are 75 μm and 25 μm. The data are expressed as the mean ± SE (n = 4 in each group at each time point). p < 0.05 or p < 0.01 versus the NC group and #p < 0.05 or ##p < 0.01 versus the Ad. miR-219a-5p sponge group.

4. Discussion

4.1. BSYSC Exerts Neuroprotective Effects on Mice with EAE

Although substantial progress has been made in studying therapeutic targets to promote myelin regeneration in patients with MS in recent years, effective drugs still need to be developed. By analyzing clinical scores, we found that BSYSC exerts neuroprotective effects in both MS patients and EAE model animals. After treatment with BSYSC, the clinical scores were significantly decreased, which indicated that BSYSC can significantly improve the neurological symptoms of mice with EAE. MBP results show that BSYSC can effectively promote the differentiation of OPCs and combined with LFB staining show that BSYSC significantly increases the myelin sheath density in the corpus callosum area. These results indicate that BSYSC exerts a neuroprotective effect in EAE mice, which is consistent with our previous experimental results [10, 33, 44] and provides a basis for the clinical application of this formula.

4.2. BSYSC Protects Axons in Mice with EAE

It has been found that a reduction in NF expression is a common response to axonal injury in the CNS and that the levels of NFs during demyelination in MS are associated with severe impairment of BBB integrity, immune cell extravasation, and brain injury-related activity on MRI [55]. The expression levels of NFs in the spinal cords of rats with EAE that were treated with gonadotropin-releasing hormone (gonadotropin-releasing hormone, GnRH) [56] or leuprolide acetate [57] are higher than those in the spinal cords of untreated rats. In our previous experiments, the expression of Ki67 and Nestin [58] in the brains and spinal cords of mice was significantly increased after BSYSC treatment, as determined by immunofluorescence, revealing the potential role of BSYSC in enhancing neural stem cell proliferation. In this study, immunofluorescence was used to determine the localization of NF68, NF160, and NF200 in the brains and spinal cords of mice with EAE after treatment with BSYSC. There is sufficient evidence that BSYSC protects axons.

4.3. BSYSC Promotes Myelin Regeneration in Mice with EAE

It has been found that inhibition of OPCs differentiation is the main cause of demyelinating lesions in MS, that OPCs are recruited to the lesion site, and that OPCs differentiate into mature oligodendrocytes to achieve myelin regeneration. PDGFR-α and CNPase are expressed by OPCs at different stages of differentiation [59]. PDGFR-α is one of the earliest OPCs markers expressed in the mouse spinal cord and brain [60], OPCs expressing PDGFR-α proliferate and migrate throughout the CNS [61, 62]. In EAE animal models, increased PDGFR-α expression indicates an increase in the number of OPCs that can proliferate [63], migrate to the demyelinating lesion, and subsequently differentiate into oligodendrocytes [64]. CNPase is a marker of predifferentiated oligodendrocytes, and CNPase expression is reduced in mice with EAE with myelin injury [65]. MBP, the second most abundant protein in the CNS, is important in myelination, is expressed at the end of the oligodendrocyte differentiation process, and has been used as an indicator of demyelination [66]. Reduction in the number of myelin fiber and their destruction in mice with EAE results in decreased expression of CNPase and MBP [67]. Olig2 is a key transcription factor in oligodendrocyte development and remyelination. Olig2 is involved in different stages of the proliferation, migration, and differentiation of OPCs [68]. Increased expression of Olig2 can promote the formation of oligodendrocytes [69], which play an important role in the pathogenesis and progression of MS/EAE. Our experimental results showed that Olig2 was expressed by OPCs at all stages because OPCs continuously proliferated and differentiated in the animal model, and OPCs are recruited from other regions and migrate to the lesion [70, 71]. Olig2 was expressed in all groups. The expression of the markers PDGFR-α, CNPase, and MBP at different stages of OPCs differentiation was compared to assess the differentiation of OPCs in mice with EAE after BSYSC treatment. In our study, BSYSC decreased the expression of Ki67/PDGFR-α in mice with EAE and significantly increased the expression of CNPase. This finding indicates that BSYSC can promote the differentiation of OPCs into mature oligodendrocytes with myelinogenic ability. In vitro, MBP expression in OPCs showed an increasing trend after the addition of exos-BSYSC. Combined with the immunofluorescence results in the present experiment, these results indicate that OPCs proliferation is activated during demyelination, but dysfunction of OPCs differentiation leads to deficits in myelin regeneration, indicating that BSYSC can promote myelin regeneration by promoting OPCs differentiation.

4.4. BSYSC Regulates miRs Levels in Exosomes, Thereby Suppressing the Expression of Their Target Genes Sox6, Lingo1, and Hes5

Growing evidence indicates that miRs in exosomes [72] are involved in the regulation of neuroinflammatory and demyelinating responses in MS and EAE mouse models. miR-219 and miR-338 regulate the expression of a variety of molecules, such as the proteins Sox6, Hes5, and Lingo1, and the activation of signaling pathways that affect OPCs differentiation and myelin formation. Experiments using transgenic mice with targeted deletion of Dicer1 have revealed that miR-219 and miR-338 expression is upregulated 10- to 100-fold during the differentiation of OPCs into mature oligodendrocytes [73], in which miR-219 plays a critical role [74]. miR-219 is enriched in exosomes, and enrichment of miR-219 is necessary and sufficient for the differentiation of OPCs into myelin-producing cells [75]. The function of OPCs is retained in mice with EAE in the absence of miR-219, and studies of developmentally regulated mutations have demonstrated that miR-219 is a key miR for myelination and regeneration after CNS injury. Additionally, miR-219 expression is significantly reduced in MS patient tissues compared with control tissues [74, 76]. In-depth studies have revealed that miR-219 promotes OPCs differentiation and remyelination by inhibiting the transcription factors Hes5 and Lingo1 [77], which negatively regulate OPCs differentiation [78] The transcription factor Hes5 negatively regulates OPCs differentiation in EAE models [79] and is highly expressed in acute lesions in MS [80], suggesting that it plays a role in inhibiting oligodendrocyte differentiation and remyelination. Lingo1 negatively regulates OPCs differentiation and remyelination through Rho A-GTP signaling [81], and a clinical trial showed that remyelination and axonal repair were achieved in MS patients treated with an anti-Lingo1 drug (opicinumab) [82]; these results suggest that inhibition of Lingo1 can effectively promote myelin regeneration. Lingo1 is highly expressed in neurons and astrocytes in the late stages of differentiation; it is involved in inhibiting OPCs differentiation and is a key protein in the negative regulation of myelin regeneration [83]. miR-338 expression doubles during OPCs differentiation [84], and its overexpression can facilitate the differentiation of OPCs derived from human induced pluripotent stem cells (hiPSCs) into oligodendrocytes [31]. miR-338 suppresses Sox6 expression via a feedback loop [85]. Loss of Sox6 expression causes premature differentiation of OPCs, and in the absence of Sox6 expression, the specification of OPCs and their differentiation into oligodendrocytes is enhanced [86]. In animals with EAE, miR-338 regulates myelin maturation in coordination with miR-219 [29, 87], and these two miRs jointly target the degradation of Sox6.

5. Conclusion

Certainly, BSYSC may also promote the differentiation of OPCs through other mechanisms of action. However, in this study, BSYSC was found to promote the expression of miRs in exosomes and reduce the expression of target negative regulators. The expression of negative regulators in OPCs was also reduced after treatment with exos-BSYSC. Combined with the in vivo and in vitro results, these findings suggest that BSYSC plays a key role in regulating the expression of important miRs that participate in exosome communication. Specifically, we found that BSYSC may promote remyelination by promoting miR-219 or miR-338 expression in exosomes and recruit OPCs by inhibiting Sox6, Hes5, and Lingo1 expression, thus promoting OPCs differentiation and improving the ability of OPCs to wrap around axons to ultimately ameliorate MS. In conclusion, BSYSC exerts neuroprotective effects in mice with EAE and promotes remyelination and axonal repair. The mechanism may be related to the upregulation of miR-219 or miR-338 expression in exosomes and the inhibition of the expression of their target genes Sox6, Hes5, Sox4, and Lingo1. And how exactly to increase miR-219/338 expression by BSYSC will be further investigated in future experiments.
  83 in total

1.  Low frequency pulsed electromagnetic field promotes differentiation of oligodendrocyte precursor cells through upregulation of miR-219-5p in vitro.

Authors:  Fei Yao; Ziyu Li; Li Cheng; Liqian Zhang; Xiaowei Zha; Juehua Jing
Journal:  Life Sci       Date:  2019-03-15       Impact factor: 5.037

Review 2.  A gene regulatory architecture that controls region-independent dynamics of oligodendrocyte differentiation.

Authors:  Martina Cantone; Melanie Küspert; Simone Reiprich; Xin Lai; Martin Eberhardt; Peter Göttle; Felix Beyer; Kasum Azim; Patrick Küry; Michael Wegner; Julio Vera
Journal:  Glia       Date:  2019-02-07       Impact factor: 7.452

Review 3.  New insights into the biological impacts of immune cell-derived exosomes within the tumor environment.

Authors:  Meng Shen; Xiubao Ren
Journal:  Cancer Lett       Date:  2018-05-30       Impact factor: 8.679

4.  An elevated matrix metalloproteinase (MMP) in an animal model of multiple sclerosis is protective by affecting Th1/Th2 polarization.

Authors:  Andrew Weaver; Angelika Goncalves da Silva; Robert K Nuttall; Dylan R Edwards; Steven D Shapiro; Serge Rivest; V Wee Yong
Journal:  FASEB J       Date:  2005-08-04       Impact factor: 5.191

5.  So many progenitors, so little myelin.

Authors:  Steven A Goldman; Joana Osorio
Journal:  Nat Neurosci       Date:  2014-04       Impact factor: 24.884

6.  MicroRNA-mediated control of oligodendrocyte differentiation.

Authors:  Xianghui Zhao; Xuelian He; Xiaolei Han; Yang Yu; Feng Ye; Ying Chen; ThaoNguyen Hoang; Xiaomei Xu; Qing-Sheng Mi; Mei Xin; Fan Wang; Bruce Appel; Q Richard Lu
Journal:  Neuron       Date:  2010-03-11       Impact factor: 17.173

7.  Mesenchymal Stem Cell-Derived Exosomes Improve the Microenvironment of Infarcted Myocardium Contributing to Angiogenesis and Anti-Inflammation.

Authors:  Xiaomei Teng; Lei Chen; Weiqian Chen; Junjie Yang; Ziying Yang; Zhenya Shen
Journal:  Cell Physiol Biochem       Date:  2015-12-09

8.  Oligodendroglia in cortical multiple sclerosis lesions decrease with disease progression, but regenerate after repeated experimental demyelination.

Authors:  Enrique Garea Rodriguez; Christiane Wegner; Mario Kreutzfeldt; Katharina Neid; Dietmar R Thal; Tanja Jürgens; Wolfgang Brück; Christine Stadelmann; Doron Merkler
Journal:  Acta Neuropathol       Date:  2014-02-25       Impact factor: 17.088

9.  Regulator of oligodendrocyte maturation, miR-219, a potential biomarker for MS.

Authors:  Ilona B Bruinsma; Marie van Dijk; Claire Bridel; Timothy van de Lisdonk; Sanne Q Haverkort; Tessel F Runia; Lawrence Steinman; Rogier Q Hintzen; Joep Killestein; Marcel M Verbeek; Charlotte E Teunissen; Brigit A de Jong
Journal:  J Neuroinflammation       Date:  2017-12-04       Impact factor: 8.322

Review 10.  Exosomes as mediators of neuroinflammation.

Authors:  Archana Gupta; Lynn Pulliam
Journal:  J Neuroinflammation       Date:  2014-04-03       Impact factor: 8.322

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.