| Literature DB >> 35456092 |
Gebremeskel Mamu Werid1, Yassein M Ibrahim1, Hongyan Chen1, Lizhi Fu2, Yue Wang1,2,3.
Abstract
Despite significant economic and public health implications, swine enteric viruses that do not manifest clinical symptoms are often overlooked, and data on their epidemiology and pathogenesis are still scarce. Here, an epidemiological study was carried out by using reverse transcription-polymerase chain reaction (RT-PCR) and sequence analysis in order to better understand the distribution and genetic diversity of porcine astrovirus (PAstV), porcine encephalomyocarditis virus (EMCV), porcine kobuvirus (PKV), and porcine sapovirus (PSaV) in healthy pigs reared under specific pathogen-free (SPF) or conventional farms. PKV was the most prevalent virus (51.1%, 247/483), followed by PAstV (35.4%, 171/483), then PSaV (18.4%, 89/483), and EMCV (8.7%, 42/483). Overall, at least one viral agent was detected in 300 out of 483 samples. Out of the 300 samples, 54.0% (162/300), 13.0% (39/300), or 1.0% (3/300) were found coinfected by two, three, or four viruses, respectively. To our knowledge, this is the first report of EMCV detection from porcine fecal samples in China. Phylogenetic analysis revealed genetically diverse strains of PAstV, PKV, and PSaV circulating in conventional and SPF farms. Detection of swine enteric viruses with a high coinfection rate in healthy pigs highlights the importance of continuous viral surveillance to minimize future economic and public health risks.Entities:
Keywords: astrovirus; coinfection; encephalomyocarditis virus; epidemiology; kobuvirus; sapovirus
Year: 2022 PMID: 35456092 PMCID: PMC9031704 DOI: 10.3390/pathogens11040417
Source DB: PubMed Journal: Pathogens ISSN: 2076-0817
Summary of the prevalence of PAstV, EMCV, PKV, and PSaV.
| Variable | Number of Pigs ( | % (Positive/ | Coinfection Rate | |||
|---|---|---|---|---|---|---|
| PAstV | EMCV | PKV | PSaV | |||
| Conventional farms | 173 | 56.1 (97/173) | 19.1 (33/173) | 72.8 (126/173) | 29.5 (51/173) | 83.2 (124/149) |
| SPF Farms | 310 | 23.9 (74/310) | 2.9 (9/310) | 39 (121/310) | 12 (38/310) | 53.0 (80/151) |
| Piglet | 158 | 32.9 (52/158) | 9.5 (15/158) | 71.5 (113/158) | 24.1 (38/158) | 61.7 (71/115) |
| Weaner | 161 | 45.3 (73/161) | 10.6 (17/161) | 38.5 (62/161) | 25.5 (41/161) | 84.8 (84/99) |
| Fattening pig | 114 | 31.6 (36/114) | 7.9 (9/114) | 45.6 (52/114) | 7 (8/114) | 59.7 (37/62) |
| Sow | 50 | 20 (10/50) | 2 (1/50) | 40 (20/50) | 4 (2/50) | 50.0 (12/24) |
| Overall prevalence | 35 (171/483) | 8.7 (42/483) | 51 (247/483) | 18 (89/483) | 68.0 (204/300) | |
Figure 1Coinfection of PAstV, EMCV, PKV, and PSaV in pigs of different age groups and farm management conditions. The coinfection status of pigs kept under SPF (A) and conventional (B) farms are visualized across the y axis. Each point represents a single virus, whereas points with the same shape aligned vertically at a specified y coordinate represent a single animal.
Figure 2Coinfection rate of PAstV, EMCV, PKV and PSaV.
Figure 3Phylogenetic analysis of PAstV, EMCV, PKV, and PSaV. The GenBank accession numbers, host, and country of origin of the reference sequence are indicated at the leaves of each phylogenetic tree. Strains detected in this study are marked with (◆), and samples from SPF farms are marked with ‘SPF’ in the leaf (tip). Scales indicate units of the number of base substitutions per site. (A) phylogenetic tree of PAstV, (B) phylogenetic tree of EMCV, (C) phylogenetic tree of PKV, and (D) phylogenetic tree of PSaV.
List of primers used for RT-PCR and sequencing.
| Virus | Primer Name | Primer Sequence (5′ → 3′) | Target Gene | Amplicon Size | Ref. |
|---|---|---|---|---|---|
| PAstV | PAstV-F | TGACATTTTGTGGATTTACAGTT | ORF1b/ORF2 | 799 | [ |
| PAstV-R | CACCCAGGGCTGACCA | ||||
| EMCV | ECMV F | GGTGAGAGCAAGCCTCGCAAAGACAG | 3D polymerase gene | 286 | [ |
| ECMV R | CCCTACCTCACGGAATGG GGCAAAG | ||||
| PKV | PKoV F | TGGATTACAAGTGTTTTGATGC | 3D Polyprotein gene | 351 | [ |
| PKoV R | TGTCGTAGAACTCCTTGATGAA | ||||
| PSaV | PSaV F | CTCATCAACCCTTTTGAAAC | Capsid protein | 757 | [ |
| PSaV R | AAAGCATGATGTTGTTAGGC |