| Literature DB >> 35453281 |
Joanna Pławińska-Czarnak1, Karolina Wódz2, Lidia Piechowicz3, Ewa Tokarska-Pietrzak3, Zbigniew Bełkot4, Janusz Bogdan1, Jan Wiśniewski1, Piotr Kwieciński2, Adam Kwieciński2, Krzysztof Anusz1.
Abstract
The "One Health" approach increasingly demonstrates the global spread of pathogenic microorganisms and their antimicrobial resistance in the environment, both in animals and humans. Salmonella enterica subsp. diarizonae is nowadays very often isolated from cold-blooded reptiles to a lesser extent from sheep, but unfortunately more and more often from humans. However, there are a few studies describing the isolation of Salmonella enterica subsp. diarizonae from migratory wild birds. The mallard duck (Anas platyrhynchos), a wild animal that traverses the continent of Eurasia, can be an excellent indicator of the spread of intestinal microbes as well as their resistance to antibiotics. This is the first report of the Salmonella enterica subsp. diarizonae detection in Poland in a migrating mallard duck. This research presented the identification difficulties associated with the isolation of Salmonella enterica subsp. diarizonae using three different biochemical tests and advanced serology tests. At the same time, we detected very high antimicrobial resistance in the isolated strain. By using the minimum inhibitory concentration (MIC) method, it was found that the isolated strain of S. enterica subsp. diarizonae has high antibiotic resistance against 14 of the 33 tested antimicrobials agents. The resistance genes that have been identified in S. enterica subsp. diarizonae include aadA, strA/strB, and blaTEM.Entities:
Keywords: Salmonella enterica subsp. diarizonae; antibiotic-resistant Salmonella; wild duck
Year: 2022 PMID: 35453281 PMCID: PMC9024997 DOI: 10.3390/antibiotics11040530
Source DB: PubMed Journal: Antibiotics (Basel) ISSN: 2079-6382
Antimicrobial resistance of the Salmonella enterica subsp. diarizonae O:58 isolate from mallard ducks.
| Antibiotic | Minimal Inhibitory Concentration, μg/mL | Sensitivity |
|---|---|---|
| ampicillin | ≤2 | S |
| amoxicillin | 2 | S |
| amoxicillin and clavulanic acid | ≤2 | S |
| cefalexin | ≥8 | R |
| cefalotin | ≤2 | S |
| cefapirin | ≥8 | R |
| cefoperazone | ≤4 | S |
| ceftiofur | ≤2 | S |
| cefquinome | ≤2 | S |
| cloxacillin | >2 | R |
| penicillin G | 8 | R |
| nafcillin | >2 | R |
| imipenem | ≤0.25 | S |
| gentamicin | ≥16 | R |
| neomycin | ≥8 | R |
| streptomycin | ≥32 | R |
| colistin | ≤2 | S |
| polymixin B | ≤2 | S |
| enrofloxacin | ≤0.5 | S |
| flumequine | ≥32 | R |
| marbofloxacin | ≤0.25 | S |
| norfloxacin | ≤1 | S |
| doxycycline | ≤2 | S |
| oxytetracycline | ≤2 | S |
| tetracycline | ≤1 | S |
| erythromycin | >0.5 | R |
| tylosin | > 1 | R |
| florfenicol | 4 | I |
| lincomycin | ≥8 | R |
| lincomycin/spectinomycin | ≤8 | S |
| trimethoprim–sulfamethoxazole | ≤2 | S |
| tiamulin | >16 | R |
| tylvalosin | >4 | R |
Labelling as resistant (R), intermediate (I) or susceptible (S) for a specific antimicrobial is indicated in the rows.
Figure 1Agarose gel (2%) electrophoresis showing the amplification of multiplex PCR line 1 strA/strB (893 bp) and aadA (525 bp), multiplex PCR line 2 bla (247 bp) of Salmonella enterica subsp. diarizonae O58. Notes: line M DNA marker, line K1+ bla (247 bp), and line K2+ positive control genes sul2 (721 bp), aadA (525 bp), as positive controls were Klebsiella pneumoniae and E. coli strains isolated from poultry and cattle. Lane K—no template (negative control). Abbreviations: M—DNA marker (DNA Marker 2+, (50–1000 bp, A&A Biotechnology Gdańsk, Poland); bp—base pairs.
Primers sequences for detection of antimicrobial resistance genes in the Salmonella spp. isolate and multiplex PCR annealing temperature [29,30].
| Multiplex PCR | Gene | Primer Sequences 5′–3′ | Annealing Temperature | Product Size (bp) |
|---|---|---|---|---|
| 1 |
| F: GTG GAT GGC GGC CTG AAG CC | 63 °C | 525 bp |
| 1 |
| F: ATGGTG GAC CCT AAA ACT CT | 63 °C | 893 bp |
| 2 |
| F: ATG GGC TCG CGA TAA TGT C | 55 °C | 634 bp |
| 2 |
| F: GAT TGA ACA AGA TGG ATT GC | 55 °C | 347 bp |
| 2 |
| F: GAG GAG TTG GAC TAT GGA TT | 55 °C | 208 bp |
| 3 |
| F: GGC GGT CTT CTT CAT CAT GC | 63 °C | 502 bp |
| 3 |
| F: CGC CCA GTG CTG TTG TTG TC | 63 °C | 173 bp |
| 4 |
| F: CGG CGT GGG CTA CCT GAA CG | 66 °C | 433 bp |
| 4 |
| F: CGG CAT CGT CAA CAT AAC CT | 66 °C | 721 bp |
| 5 |
| F: TTAACTGGCGAACTACTTAC | 55 °C | 247 bp |
| 5 |
| F: AGGATTGACTGCCTTTTTG | 55 °C | 393 bp |
| 5 |
| F: GACAGCCTCTTTCTCCACA | 55 °C | 1000 bp |
Abbreviations: bp—base pairs.