Literature DB >> 35449001

Profiling the lncRNA-miRNA-mRNA interaction network in the submandibular gland of diabetic mice.

Xi-Jin Shi1, Hui-Min Liu1, Li Li1, Yan Zhang1, Xin Cong1, Li-Mei Liu1, Li-Ling Wu1, Ruo-Lan Xiang2.   

Abstract

BACKGROUND: Hyposalivation is one of the common symptoms of diabetes. Although long non-coding RNAs (lncRNAs) have recently been reported to play important roles in the pathogenesis of diabetes, the role of lncRNAs in diabetes-induced hyposalivation remains unknown.
METHODS: The present study aimed to explore the function of lncRNA-microRNA-mRNA regulatory network in the submandibular gland (SMGs) under the context of diabetes. LncRNA expression profile of the SMGs was analyzed using microarray technology. Differentially expressed lncRNAs were confirmed using real-time quantitative PCR. Bioinformatics analyses were performed, and Coding-non-coding gene co-expression (CNC) and competing endogenous RNA (ceRNA) networks were constructed to explore the potential mechanisms of diabetes-induced hyposalivation.
RESULTS: A total of 1273 differentially expressed lncRNAs (536 up-regulated and 737 downregulated) were identified in the SMGs tissues of db/db mice. CNC and ceRNA network analyses were performed based on five differentially expressed lncRNAs validated by real-time quantitative PCR. Gene Ontology analysis of target genes of CNC network revealed that "calcium ion binding" was a highly enriched molecular function. Kyoto Encyclopedia of Genes and Genomes pathway analysis of target genes of ceRNA network revealed that the "mammalian target of rapamycin signaling pathway" was significantly enriched.
CONCLUSIONS: On the whole, the findings of the present study may provide insight into the possible mechanism of diabetes-induced hyposalivation.
© 2022. The Author(s).

Entities:  

Keywords:  Diabetes mellitus; Hyposalivation; Microarray; ceRNA; lncRNA

Mesh:

Substances:

Year:  2022        PMID: 35449001      PMCID: PMC9028094          DOI: 10.1186/s12902-022-01019-1

Source DB:  PubMed          Journal:  BMC Endocr Disord        ISSN: 1472-6823            Impact factor:   3.263


Introduction

Diabetes is a group of metabolic diseases characterized by abnormal insulin secretion and/or insulin resistance. In addition to causing long-term damage to different organs, diabetes can also change the function of salivary glands and may cause changes in the composition and volume of salivary secretion, thus affecting the oral homeostasis [1]. Some studies have found that the salivary flow of diabetic patients is significantly decreased compared with control group [2, 3]. Clinical studies showed that 92.5% of the elderly patients with type 2 diabetes suffered decreased salivary flow rate [4]. Saliva played a key role in digestion, taste, cleaning, hydration of oral mucosa and tooth protection and was essential for maintaining the dynamic balance of the oral environment [5]. Damage to the salivary glands was typically manifested as a reduction in salivary flow, which can be converted into bad subjective feelings such dry mouth, taste disorders, difficulty with swallowing and chewing, and increased risk of caries. These feelings ultimately have a negative impact on quality of life. Many studies have demonstrated that the incidence of oral fungal and bacterial infection, lichen planus and caries was high in patients with diabetes [2, 3, 6]. In our previous study, we observed atrophy of the acini, and decreased stimulated salivary flow of SMG in db/db mice [7]. However, the mechanism by which diabetes induces SMG damage is not clear. LncRNA is a class of RNA molecules that are greater than 200 nucleotides in length. In recent decades, lncRNAs have been identified as important epigenetic factors that regulate various human diseases, such as cancer, neurodegenerative diseases and cardiovascular diseases [8-12]. Recent studies have shown that the incidence and development of type 2 diabetes was associated with lncRNAs. Downregulation of the lncRNA ANRIL improved the cardiac function index and inflammatory factor expression in diabetic rats, enhanced the pathological state of myocardial tissue and myocardial remodeling, and reduced the area of myocardial collagen deposition [13]. The lncRNA NONRATT021972 was upregulated in diabetic rat nervous system cells, suggesting that it may participate in the pathophysiological processes associated with sympathetic neurons in diabetes [14]. Downregulation of the lncRNA SOX2OT regulated the NRF2/HO-1 signaling pathway and protected against high glucose-induced damage in retinal ganglion cells in vivo and in vitro [15]. Based on these findings, we hypothesized that lncRNAs represented a potential cause of diabetes-induced reductions in salivary secretion. CeRNA can regulate each other at post-transcription level by competing for common miRNAs [16]. LncRNA MEG3 acted as a ceRNA of miR-214 to promote hepatic insulin resistance by facilitating the expression of ATF4 [17]. Protein-coding mRNA DKK1 and PTEN served as ceRNA, showing crosstalk and affecting the expression of each other via competition for miRNAs binding [18]. In studies exploring lncRNAs, the identification of a target gene and its correlation with diabetes-related xerostomia can help us to understand the pathology of diabetes-related xerostomia and provide further information for the treatment of diabetes-related xerostomia. To better understand the function of lncRNA in the impairment of salivary function in diabetes, this study characterized the expression profiles of lncRNA in the SMG tissues of db/db and db/m mice using microarray. The establishment of CNC and ceRNA networks based on lncRNA may help to explore the potential functions of lncRNAs in diabetes-induced SMG dysfunction.

Material and methods

Animal models

Sixteen-week-old male db/db mice (a model of spontaneous type 2 diabetes mellitus) were purchased from Changzhou Cavens Laboratory Animal (Changzhou, China). Studies have found that estrogen can reduce insulin resistance, improve the ability to deal with glucose, so as to reduce blood glucose. So we used male mice in our research to avoid the effects of estrogen [19]. Age and weight matched db/m mice were used as control group. All experimental procedures were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals (NIH Publication No. 85-23; revised 1996). The study was carried out in compliance with the ARRIVE guidelines as well as the relevant national laws on the protection of animals. All mice were maintained at room temperature with a relative humidity of ~ 60% environment with a 12 h light-dark cycle and fed normal food and water. After anesthesia and sacrifice with CO2, the SMG was removed immediately from the animal, frozen in liquid nitrogen for 1 min, and then stored at − 80 °C.

RNA extraction and microarray analysis

Four mice were andomly chosen from each group. The total RNA was extracted from the SMG tissues using the TRIzol LS Reagent (Invitrogen, CA, USA), and was used for lncRNA microarray analysis (KangCheng, Shanghai, China). The concentration and purity of RNA were measured using a NanoDrop ND-1000 (Thermo, MA, USA), and quantity and integrity of RNA was tested using denaturing agarose gel electrophoresis. Microarray hybridization was performed using Quick Amp Labeling Kit, One-Color (Agilent, CA, USA) based on the manufacturer’s standard protocols. Agilent Feature Extraction software (Agilent, CA, USA) was used to analyze acquired array images. Quantile normalization and subsequent data processing were performed using the GeneSpring GX v12.1 software package (Agilent, CA, USA). All microarray hybridization and analyses were performed by KangChen Biotech (Shanghai, China). The accession number of microarray data was GSE141411.

Real-time quantitative polymerase chain reaction (RT-qPCR)

We selected the 11 most significantly differentially expressed lncRNAs for RT-qPCR validation. Briefly, total RNA was extracted from two groups of SMG tissues using TRIzol reagent (Invitrogen, CA, USA). Total RNA (1 μg) was reverse-transcribed into cDNA using 5X All-In-One RT MasterMix (ABM, Richmond, BC, Canada) according to the manufacturer’s instructions. The RT-qPCR was performed on ViiA™ 7 Real-Time PCR System (Thermo, MA, USA) using a 2X SYBR Green qPCR Master Mix (Bimake, HOU, USA). The RT-qPCR primers were synthesized by Sangon Biotech (Shanghai, China). ΔΔCq method was used.

Bioinformatics analysis

Volcano plot filtering was used to identify differentially expressed lncRNAs based on the threshold defined as fold-change > 2.0 (Student’s t test P < 0.05). The differentially expressed lncRNAs between db/db and db/m mice were displayed by hierarchical clustering. GO analysis (http://www.geneontology.org/) and KEGG analysis (http://www.genome.jp/kegg/) were used to explore the roles of the target genes of differentially expressed lncRNAs [20-22].

Coding-noncoding co-expression and competing endogenous RNA networks

The normalized signal intensities of differentially expressed mRNA from whole-genome expression profiling (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE141412) and differentially expressed lncRNA validated by RT-qPCR were used to construct CNC networks. In this study, lncRNAs, mRNAs, and miRNAs were collected from the same batch of samples. The lncRNA-mRNA pairs were identified based on a Pearson’s correlation coefficient of more than 0.95. The CNC network was constructed using Cytoscape software (The Cytoscape Consortium, CA, USA). Next, we constructed the lncRNA-miRNA-mRNA ceRNA networks based on microarray data. The lncRNA-miRNA interactions and miRNA-mRNA pairs were predicted using Arraystar’s home-made miRNA target prediction software and TargetScan & miRanda [23-26].

Statistical analysis

Statistical analysis was performed by GraphPad Prism 5.0 (GraphPad Software, USA). Data of relative expression level of lncRNAs were expressed as the mean ± standard error. Student’s t-test was used to test whether the two sets of data were statistically significant, and P < 0.05 was considered to indicate statistical significance of gene expression difference between the two group.

Results

Expression profiling of lncRNAs in the SMG in db/db mice

In our study, lncRNA expression profile of the SMG tissues was carried out using microarray analysis. In comparison with db/m mice, 1273 differentially expressed lncRNAs were identified in the SMG tissues from db/db mice, including 536 upregulated and 737 downregulated lncRNAs (fold-change > 2.0, P < 0.05). Table 1 provided the top ten upregulated and downregulated lncRNAs. A volcano plot of lncRNA expression profiles was displayed in Fig. 1A, the heat maps of the 60 most significantly differentially expressed lncRNAs (30 upregulated and 30 downregulated) was displayed in Fig. 1B.
Table 1

Top 10 upregulated and downregulated lncRNA in microarray

Probe NameRegulationSeqnameGene SymbolRNA lengthChromeFold ChangeP-value
ASMM10P027186upENSMUST00000137025Mup9787chr4118.82119353.21678E-05
ASMM10P055456upENSMUST00000169784Mup-ps4474chr4109.1955638.37692E-05
ASMM10P003383upENSMUST00000163495Tg4952chr1568.8209012.01088E-06
ASMM10P029469upENSMUST00000120341Gm12897250chr435.77830475.78685E-05
ASMM10P055944upTCONS_00006898TCONS_0000689875chr1234.92705692.16253E-06
ASMM10P058117upAI642987humanlincRNA1158226chr233.62009335.09835E-06
ASMM10P027204upENSMUST00000121132Mup-ps20389chr432.17687470.000137217
ASMM10UP787upuc.86+uc.86340chr228.85796972.12019E-05
ASMM10P002133upENSMUST000001397941700013G23Rik446chr1125.89741878.39099E-05
ASMM10P010990upAK078011AK078011742chr1422.77604046.19189E-06
ASMM10P026501downNR_0405896330410L21Rik3869chr319.10228740.000141403
ASMM10P020728downNR_040496Gad1os905chr213.1251090.000521638
ASMM10P002832downENSMUST00000151559Uqcr10510chr1112.60151120.036962683
ASMM10P048643downENSMUST00000122825Myo152285chr1111.91266980.000174835
ASMM10P010250downAK021108AK021108489chr1311.77954250.00555039
ASMM10P036325downENSMUST00000120706Gm11606617chr111.62651570.005532558
ASMM10P019099downNR_0453064931403E22Rik668chr1911.49489910.013329559
ASMM10P025520downAK076356AK0763562681chr310.23211040.000895843
ASMM10P020729downENSMUST00000150702Gm16292608chr29.55763140.000103482
ASMM10P019262downTCONS_00016118XLOC_012418330chr199.18574110.004675328
Fig. 1

The expression profiling changes of significantly differentially expressed lncRNAs in db/db and db/m mice. A Volcano plots presenting differences in the expression of lncRNAs between db/db mice and db/m mice. B Heat maps showing the top 60-fold change distinct mRNAs expression profiles between the db/db mice and db/m mice

Top 10 upregulated and downregulated lncRNA in microarray The expression profiling changes of significantly differentially expressed lncRNAs in db/db and db/m mice. A Volcano plots presenting differences in the expression of lncRNAs between db/db mice and db/m mice. B Heat maps showing the top 60-fold change distinct mRNAs expression profiles between the db/db mice and db/m mice

Validation of lncRNA microarray results

Because there is no previous research that has explored the relationship between lncRNA and saliva secretion in diabetes, there is no literature that can be referred to. Considering that the most differentially expressed lncRNAs should play an important role in the process, we chose the top 10 (up and down regulated) differentially expressed lncRNAs in our study [27]. In these 20 lncRNAs, 9 lncRNAs could not be verified by qRT-PCR because primers could not be designed. Finally, 11 lncRNAs (NR-040589, ENSMUST00000142612, ENSMUST00000139794, ENSMUST00000163495, ENSMUST00000137025, AK021108, NR-045306, ENSMUST00000156336, ENSMUST0000014113, ENSMUST00000120706 and ENSMUST0000069768) were selected from microarray results to carry out RT-qPCR. Of these, five lncRNAs, including 2 downregulated (NR_040589 and ENSMUST00000142612) and 3 upregulated (ENSMUST00000139794, ENSMUST00000163495, and ENSMUST00000137025), were consistent with microarray analysis results (Fig. 2). The advantages of microarray analysis were fast and efficient, but it also has false positives and false negatives. It is a common phenomenon that qRT-PCR and microarray results are inconsistent. Usually, we selected lncRNA with consistent result for in-depth research [28]. The corresponding primers used were listed in Table 2.
Fig. 2

Validation of lncRNA expression. The relative expression levels of selected lncRNAs as detected by RT-qPCR. β-Actin was used as a housekeeping gene for normalizing changes in specific gene expression. *P < 0.05 and **P < 0.01 vs db/m mice, n = 6 ~ 9 per group. RT-PCR, real-time quantitative polymerase chain reaction

Table 2

The Primers of differentially expressed lncRNAs

LncRNAForward primeReverse primer
ENSMUST00000137025TGCACAACTATGTGAGGAGCATGGGGAGGCTCAGGCCATTCTTCATTC
ENSMUST00000163495GCAATGAGGAGAGTGGAGCAACCGTCTGCCAAGAGTCCGAAGTAACC
ENSMUST00000139794GACTGGCAGGAAGAACGGATGACGGCACACCTGGTTCCATCTTAGAC
NR_040589TCCCGCTTCTCTCGCTTCTCTCCTGTTGCTCGCCTTCCTGCTG
AK021108GGTGGCTGTGAAGACGCTGAAGTTGACAATGTGCTCGTGCTGGAG
ENSMUST00000120706AGGTGGCTGGTTTCTCTGGAAGCAGCTACTCTTGCCTGGA
NR_045306GCCTGCCTGCCTCCTCTCTCTTCTGAGCCTGGGTGTCTCTGG
ENSMUST00000142612TTGAGCATGTGCCAGACAGAAGTGTCTCCATCGTGTTGCCTTCAAGTG
ENSMUST00000069768ACGGACACCTCTCCTGCCTTGCTTCCTGAAGCTCGCGGAGAATC
ENSMUST00000156336ATGAGCGACTGAGCAGGACTACCGGCTGGCGTCCTCACCTCTAG
ENSMUST00000141103AACTGAGCAGAGACAGCGTGTGTCATGGTCTTGTCGTGAGATGACG
Validation of lncRNA expression. The relative expression levels of selected lncRNAs as detected by RT-qPCR. β-Actin was used as a housekeeping gene for normalizing changes in specific gene expression. *P < 0.05 and **P < 0.01 vs db/m mice, n = 6 ~ 9 per group. RT-PCR, real-time quantitative polymerase chain reaction The Primers of differentially expressed lncRNAs

Coding-noncoding co-expression network analysis

Five lncRNAs validated by RT-qPCR and the differentially expressed mRNA from the database (GSE141412) was used to construct the CNC network shown in Fig. 3. There were 615 lncRNA-mRNA connection pairs in the network, including 369 positive connection pairs and 246 negative pairs. The top ten positive and negative interaction pairs according to the Pearson’s correlation coefficient were showed in Table 3. These closely interaction pairs may be involved in the regulation of saliva secretion of SMG in db/db mice. GO analysis based on the target genes of the CNC network showed that the mostly enriched biological process was “Cellular response to hormone stimulus”, the mostly enriched cellular component was “Extracellular region”, while mostly enriched molecular function was “Calcium ion binding”, as shown in Fig. 4A. KEGG pathway analysis revealed that the mainly enriched pathways were “Cysteine and methionine metabolism”, “Phosphatidylinositol signaling system”, and “Vitamin digestion and absorption”, as shown in Fig. 4B. Cystathionine-gamma-lyase (CTH), glutamate-cysteine ligase modifier subunit (Gclm) and phosphoserine aminotransferase 1 (PSAT1) were enriched in “Cysteine and methionine metabolism”. These enriched GO terms and pathways may participate in the DIO-induced hyposalivation.
Fig. 3

CNC network. Red nodes are lncRNAs, and blue nodes are mRNAs. Positive correlation is a solid line, and negative correlation is a dashed line

Table 3

Top ten positive and negative correction pairs of lncRNA-mRNA

mRNALncRNAPearson’s correlation coefficientCorrelation typeP-valueFalse discovery rate
Mup11ENSMUST000001634950.999661+9.75E-117.06E-06
Mup1ENSMUST000001634950.998694+5.57E-090.000202
Mup14ENSMUST000001634950.998433+9.60E-090.000232
Mup20ENSMUST000001634950.998044+1.87E-080.000338
Mup8ENSMUST000001634950.997129+5.90E-080.00078
Mup7ENSMUST000001634950.997041+6.46E-080.00078
Defb29ENSMUST000001397940.9964+1.16E-070.001203
Kcnj16NR_0405890.995913+1.70E-070.00154
Mup5ENSMUST000001634950.995466+2.32E-070.001869
1600014C23RikNR_0405890.995075+2.98E-070.002063
Acin1ENSMUST00000139794−0.950110.0002990.035206
Zfp36NR_040589−0.950250.0002970.035084
Mup7NR_040589−0.95030.0002960.035024
Utp14aENSMUST00000142612−0.950340.0002950.035024
Scgb2b27NR_040589− 0.950370.0002940.035024
SynmENSMUST00000163495−0.950420.0002930.035024
H2-M3ENSMUST00000139794−0.95050.0002920.034963
Ppp1r14aENSMUST00000137025−0.950510.0002920.034963
Ube2cbpENSMUST00000142612−0.950730.0002880.034859
Ppp1r14dENSMUST00000137025−0.950780.0002870.034859
Fig. 4

Bioinformatic analysis of CNC network. A GO and B KEGG pathway analyses based on CNC analysis results

CNC network. Red nodes are lncRNAs, and blue nodes are mRNAs. Positive correlation is a solid line, and negative correlation is a dashed line Top ten positive and negative correction pairs of lncRNA-mRNA Bioinformatic analysis of CNC network. A GO and B KEGG pathway analyses based on CNC analysis results

Competing endogenous RNA network analysis

We constructed ceRNA network based on five lncRNAs validated using RT-qPCR and all differentially expressed mRNAs in the microarray (Fig. 5). We totally found 37 mRNAs in the ceRNA network (Supplemental Table S1). GO analysis based on the target genes of ceRNA analysis results showed that the mostly enriched biological process was “Localization”, the mostly enriched cellular component was “Cell part”, and the mostly enriched molecular function was “Protein binding” (Fig. 6A). KEGG pathway analysis revealed that the main pathways included “Rap1 signaling pathway”, “Renal cell carcinoma” and the “mTOR signaling pathway” (Fig. 6B). Signal-induced proliferation-associated 1 like 3 (SIPA1L3), enabled homolog (ENAH), thrombospondin 1 (Thbs1) et al. were enriched in “Rap1 signaling pathway”. These results showed that biological processes and regulatory pathways might play vital roles in the secretion of SMG in obesity.
Fig. 5

CeRNA network. Red circles represent miRNAs, blue circles represent mRNAs, and green circles represent lncRNAs

Fig. 6

GO and KEGG pathway analyses of the ceRNA network. A GO and C KEGG pathway analyses based on the competing endogenous RNA analysis results

CeRNA network. Red circles represent miRNAs, blue circles represent mRNAs, and green circles represent lncRNAs GO and KEGG pathway analyses of the ceRNA network. A GO and C KEGG pathway analyses based on the competing endogenous RNA analysis results

Discussion

In humans, approximately 60% of resting saliva and 40% of stimulated saliva is secreted from the SMG [29]. However, studies focusing on the SMG in the context of diabetes are very limited. We collected SMG of mice for high-throughput sequencing to study the underlying mechanism by which diabetes reduced saliva secretion. Compared with db/m mice, 536 upregulated and 737 downregulated lncRNAs were identified, these changed lncRNAs may play an important role in the diabetes-induced hyposalivation. We performed RT-qPCR verification on 11 differentially expressed lncRNAs with the most significant dysregulations, and five differentially expressed lncRNAs exhibited consistent with the results of high-throughput sequencing. We previously determined the whole genome expression profile of SMG tissues in db/db mouse and found that 1146 mRNAs exhibited significant dysregulation. Of these, 606 mRNAs were upregulated and 540 mRNAs were downregulated, and this data should be found in GSE141412. We used these five lncRNAs to perform CNC network and ceRNA network analyses in combination with 1146 differentially expressed mRNAs. GO analysis of mRNA obtained from the CNC network showed that “Calcium ion binding” is highly enriched in the molecular function. The mobilization of Ca2+ played an important role in salivary secretion, the activation of muscarinic cholinergic receptors rapidly triggered the release of intracellular Ca2+ from the endoplasmic reticulum and subsequently the influx of Ca2+ from the extracellular medium, resulting in a sustained increase in intracellular Ca2+ [30, 31]. The increased intracellular Ca2+ induced the transport of aquaporin 5, leading to the formation of water pores and thus promoting the rapid increase in transcellular water permeability [32]. In addition, our previous study found that adiponectin can also induce salivary secretion of the rat db/db mouse by activating adenosine monophosphate-activated protein kinase, and the Ca2+ signaling pathway played an important role in this process [33]. In human and rabbit SMGs, the activation of muscarinic cholinergic receptors and transient receptor potential vanilloid subtype 1 increased salivary secretion via increased intracellular Ca2+ [34, 35]. In human transplanted epiphora SMG, the elevated intracellular Ca2+ mobilization induced by muscarinic acetylcholine receptors activation contributed to hypersecretion [34]. In spontaneously hypertensive rats, the damaged Ca2+ response to carbachol was confirmed in the acinar cells of spontaneously hypertensive rats, which may also be related to the reduced salivary secretion caused by hypertension [36]. These studies indicate that the increased intracellular Ca2+ derived from extracellular and intracellular Ca2+ plays an important role in the salivary secretion of SMG. Our results from microarray analysis show that significantly altered “calcium ion binding”, suggesting that the salivary secretion of the SMG may be also affected by the Ca2+ signaling pathway during diabetes. However, the regulatory mechanism of related lncRNA-mRNA requires further research. KEGG analysis from the CNC network showed that “Cysteine and methionine metabolism” is the highest enriched pathway. An important feature of diabetes is abnormal nutrient homeostasis. One of metabolic abnormalities is to change the metabolism of sulfur-containing amino acid cysteine. Cysteine produced hydrogen sulfide through enzymatic decomposition, which is a gas transmitter regulating glucose and lipid homeostasis [37]. Studies found that type 2 diabetes was associated with lower plasma cysteine levels [38]. Both cysteine and hydrogen sulfide can inhibit β Cells release insulin after glucose stimulation. The level of low hydrogen sulfide found in plasma of patients with type 2 diabetes may be a compensatory response. In addition to regulating insulin secretion, hydrogen sulfide may regulate other aspects of cell physiology include viability and respiratory function of mitochondria. In the stretptozotocin-induced diabetes model, elevated hydrogen sulfide decrease the viability of cultured β Cells [39]. Our previous research found that high glucose (HG) induced mitochondrial dysfunction and PINK1/Parkin-mediated mitophagy in cultivated rat SMG cell line SMG-C6 cells [40]. We also demonstrated that autophagy plays a crucial role in HG-modulated aquaporin 5 degradation, which contributes to the dysfunction of diabetic SMG [7]. However, the mechanism of diabetes inducing mitophagy and mitochondrial dysfunction in salivary gland is still not well understood. Our results from microarray analysis suggested that the salivary secretion of the SMG may be also affected by “Cysteine and methionine metabolism” during diabetes. From these results, we speculated that these 5 validated lncRNAs might the major regulatory molecules. LncRNA regulates mRNA via various mechanisms, one of which is ceRNA-mediated changes in the expression of downstream molecules regulated by miRNAs. We performed ceRNA network analysis on five significantly altered lncRNAs and 1146 dysregulated mRNAs to identify the related pathways regulated by the miRNA pathway. We also analyzed the obtained mRNAs via GO and KEGG analyses. KEGG analysis suggested that the “mTOR signaling pathway” was significantly enriched, suggesting that these five lncRNAs might affect the downstream “mTOR signaling pathway” through ceRNA. The PI3K/Akt /mTOR pathway is an intracellular signaling pathway that played a key role in regulating cell cycle-mediated processes, including cellular quiescence and cell proliferation [41], and various disease such as epithelial ovarian cancer [42]. Many studies have demonstrated that the “mTOR signaling pathway” plays an important role in the pathophysiological process of diabetes. In MC3T3-E1 cells, high glucose increased the production of reactive oxygen species and induced autophagy by inhibiting the Akt/mTOR pathway [43]. The mTOR/PI3K/Akt pathway was involved in the regulation of autophagy in diabetic kidney [44]. PI3K/Akt/mTOR pathway was significantly downregulated in the brain of streptozotocin-induced type 2 diabetic rats, this might explain the neurodegeneration commonly observed in diabetes [45]. In addition, the mTOR pathway is also related to the process of salivary secretion. Bleomycin induced epithelial to mesenchymal transformation of human SMG cells via the Akt/mTOR pathway [46]. In our previous studies, we found that autophagy induced aquaporin 5 degradation through the PI3K/Akt /mTOR pathway signaling pathway, resulting in decreased salivary secretion of SMG in db/db mice [7]. These studies suggest that the “mTOR signaling pathway” may play an important role in SMG injury caused by diabetes. The five lncRNAs we verified may involve in the regulation of the “mTOR signaling pathway” through the ceRNA mechanism via miRNA sponging, but further research is needed. KEGG analysis from the ceRNA network also showed that “Rap1 signaling pathway” is the highest enriched pathway. Ras-associated protein1 (Rap1) is a member of the Ras-like small GTP binding protein family. In endothelium Rap1 is a key positive regulator of angiogenesis and an important regulator of endothelial barrier [47]. Constitutive activation of Rap1 has not only led to T cell anergy, but also inhibited autophagy and supported cancer progression through various oncogenic events [48]. In addition, Rap1 signaling has been shown to play a role in Ca2+ signaling pathways to control the important cellular functions. Rap1 modulates cardiac Ca2+ homeostasis through the regulation of Ca2+-induced Ca2+ release in adult ventricular cardiomyocytes [49]. Rap1 may act directly to open Ca2+-sensitive K+ channels, inducing smooth muscle hyperpolarization and leading to vasorelaxation. Rap1 plays an important role in maintaining normal vascular contractile state and contributes to blood pressure regulation by altering Ca2+ sensitivity of vascular smooth muscle cells [50]. As intracellular Ca2+ plays an important role in the salivary secretion of SMG, these 5 validated DE lncRNAs might be a novel treatment strategy for future treatment of diabetes-induced xerostomia in the clinic. It is worth noting that both KEGG analyses from the ceRNA network and CNC network found “Phosphatidylinositol signaling system” was significantly enriched. Phosphatidylinositol is involved in many signal transduction pathways, such as PI3K/Akt pathway. PI3K/Akt signaling plays a central role in cellular physiology by mediating critical cellular processes, like glucose homeostasis. In db/db mice and high fat diet-induced diabetic mice, activates PI3K/Akt in an insulin-independent manner could attenuates hepatic gluconeogenesis and lipogenesis [51]. Zhang et al. found that artesunate and metformin combination improve salivary gland hypofunction in murine Sjögren’s syndrome though regulating the PI3K/Akt pathway [52]. We speculated that these 5 validated DE lncRNAs might be key molecules regulating PI3K/Akt pathway. CeRNA may be one of the regulatory mechanisms, and there might be other regulatory mechanisms. These 5 validated DE lncRNAs we found regulating PI3K/Akt pathway might be a novel treatment strategy for future treatment of diabetes-induced xerostomia in the clinic. The present study has some potential limitations. First, the results of differential expression analysis were from small samples. Second, we have used db/db mice for our experiment. Db/db mouse was a model of spontaneous type 2 diabetes with leptin receptor-deficient. The expression levels of the identified differentially expressed lncRNAs may vary in case of human. In addition, the potentially biological functions of differentially expressed lncRNAs have not been validated by technical and biological experiments. Our results revealed that lncRNAs may play an important role in SMG dysfunction caused by diabetes. CNC network and ceRNA network analyses showed that “calcium ion binding”, “mTOR signaling pathway” and other pathway potentially served as the downstream pathways regulated by the five lncRNAs in our study. Our findings expand our understanding of the roles of lncRNAs in salivary secretion in diabetic mice, and help us to understand the roles of lncRNAs in the pathogenesis of diabetes-induced hyposalivation by performing regulatory networks analyses. This study can provide valuable information for further research. Additional file 1: Supplemental Table S1. Analysis of ceRNA network.
  52 in total

Review 1.  Salivary dysfunction associated with systemic diseases: systematic review and clinical management recommendations.

Authors:  Inger von Bültzingslöwen; Thomas P Sollecito; Philip C Fox; Troy Daniels; Roland Jonsson; Peter B Lockhart; David Wray; Michael T Brennan; Marco Carrozzo; Beatrice Gandera; Takashi Fujibayashi; Mahvash Navazesh; Nelson L Rhodus; Morten Schiødt
Journal:  Oral Surg Oral Med Oral Pathol Oral Radiol Endod       Date:  2007-03

2.  Antioxidant profile, carbonyl and lipid oxidation markers in the parotid and submandibular glands of rats in different periods of streptozotocin induced diabetes.

Authors:  Anna Zalewska; Małgorzata Knaś; Mateusz Maciejczyk; Napoleon Waszkiewicz; Anna Klimiuk; Magdalena Choromańska; Jan Matczuk; Danuta Waszkiel; Halina Car
Journal:  Arch Oral Biol       Date:  2015-06-22       Impact factor: 2.633

Review 3.  Rap1 in endothelial biology.

Authors:  Magdalena Chrzanowska-Wodnicka
Journal:  Curr Opin Hematol       Date:  2017-05       Impact factor: 3.284

Review 4.  The emergence of lncRNAs in cancer biology.

Authors:  John R Prensner; Arul M Chinnaiyan
Journal:  Cancer Discov       Date:  2011-10       Impact factor: 39.397

5.  Ca2+-CaMKKβ pathway is required for adiponectin-induced secretion in rat submandibular gland.

Authors:  Chong Ding; Zhi-Hao Du; Sheng-Lin Li; Li-Ling Wu; Guang-Yan Yu
Journal:  J Mol Histol       Date:  2017-12-14       Impact factor: 2.611

Review 6.  Cysteine and hydrogen sulphide in the regulation of metabolism: insights from genetics and pharmacology.

Authors:  Roderick N Carter; Nicholas M Morton
Journal:  J Pathol       Date:  2015-11-13       Impact factor: 7.996

7.  Pathogenic role of lncRNA-MALAT1 in endothelial cell dysfunction in diabetes mellitus.

Authors:  J-Y Liu; J Yao; X-M Li; Y-C Song; X-Q Wang; Y-J Li; B Yan; Q Jiang
Journal:  Cell Death Dis       Date:  2014-10-30       Impact factor: 8.469

Review 8.  NONRATT021972 long-noncoding RNA: A promising lncRNA in diabetes-related diseases.

Authors:  Abhishek Suwal; Ji-Long Hao; Xiu-Fen Liu; Dan-Dan Zhou; Om Prakash Pant; Ying Gao; Peng Hui; Xin-Xuan Dai; Cheng-Wei Lu
Journal:  Int J Med Sci       Date:  2019-06-02       Impact factor: 3.738

9.  MicroRNA targets in Drosophila.

Authors:  Anton J Enright; Bino John; Ulrike Gaul; Thomas Tuschl; Chris Sander; Debora S Marks
Journal:  Genome Biol       Date:  2003-12-12       Impact factor: 13.583

10.  Vitamin D and L-cysteine levels correlate positively with GSH and negatively with insulin resistance levels in the blood of type 2 diabetic patients.

Authors:  S K Jain; D Micinski; L Huning; G Kahlon; P F Bass; S N Levine
Journal:  Eur J Clin Nutr       Date:  2014-06-25       Impact factor: 4.016

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.