| Literature DB >> 35444684 |
Ming Zhu1,2,3, Xue Wang4, Yanqiu Zhou1,2,3, Jinhua Tan1,2,3, Yijun Zhou1,2,3, Fei Gao1,2,3.
Abstract
MicroRNAs (miRNAs) are small endogenous single-stranded RNAs that regulate plant growth, development, and environmental stress response posttranscriptionally. Ammopiptanthus nanus, a rare evergreen broad-leaved shrub in the temperate area of Central Asia, can tolerate freezing stress as low as -30 degrees centigrade in winter, and miRNA might be involved in the cold acclimation which enables A. nanus to obtain tolerance to freezing stress. Systematic identification and functional analysis of the miRNAs involved in the cold acclimation in A. nanus may promote understanding of the miRNA-mediated gene regulation network underlying cold acclimation. Here, based on small RNA and degradome sequencing, 256 miRNAs and 1,808 miRNA-target pairs were identified in A. nanus. A total of 39 cold-responsive miRNAs were identified, of which 29 were upregulated and ten were downregulated. These cold-responsive miRNAs may participate in the cold acclimation by regulating redox homeostasis (miR398, miR4415, and miR408), calcium signaling (miR5225 and miR5211), growth and development (miR159 and miR390), and small RNA-mediated gene silencing (miR168 and miR1515). We found that miR4415, a legume-specific miRNA, is involved in the cold acclimation of A. nanus by targeting an L-ascorbate oxidase gene and then regulating the redox state of the apoplast. Our study provides important data for understanding the regulatory role of miRNA in the cold acclimation of A. nanus.Entities:
Keywords: Ammopiptanthus nanus; L-ascorbate oxidase; cold acclimation; miR4415; miRNA
Year: 2022 PMID: 35444684 PMCID: PMC9013972 DOI: 10.3389/fgene.2022.870446
Source DB: PubMed Journal: Front Genet ISSN: 1664-8021 Impact factor: 4.772
FIGURE 1Cold acclimation enhanced the freezing stress tolerance of A. nanus. (A) Phenotype of A. nanus seedling in CK, SCK, CA, and SCA. The change of MDA (B) and REL (C) in the leaves of A. nanus before (CK and CA) and after freezing treatment (SCK and SCA). Values are expressed as means ± SD. Duncan’s method was used for multiple comparison analysis of variance, n = 3.
Statistics of the clean reads generated by high-throughput sequencing.
| Library | Number of raw reads | Number of high-quality reads | Reads without 3′ adapter | Reads without insert fragment | 5′ adapter contaminants | Reads with polyA | Reads smaller than 18nt | Number of clean reads |
|---|---|---|---|---|---|---|---|---|
| miCK_1 | 176,958,37 (100%) | 173,638,56 (98.12%) | 94,823 (0.54%) | 158,912 (0.91%) | 71,408 (0.41%) | 728 (0.01%) | 4,759,128 (27.40%) | 12,278,857 (70.71%) |
| miCK_2 | 18,724,118 (100%) | 18,316,541 (97.82%) | 70,928 (0.38%) | 147,893 (0.80%) | 52,832 (0.28%) | 1340 (0.01%) | 3,316,221 (18.10%) | 14,727,327 (80.40%) |
| miCK_3 | 19,377,347 (100%) | 19,001,586 (98.06%) | 61,387 (0.32%) | 88,535 (0.46%) | 59,142 (0.31%) | 1097 (0.01%) | 2,690,773 (14.16%) | 16,100,652 (84.73%) |
| miCA_1 | 18,647,262 (100%) | 18,277,927 (98.01%) | 108,694 (0.59%) | 128,250 (0.70%) | 53,975 (0.29%) | 918 (0.01%) | 3,387,959 (18.53%) | 14,598,131 (79.86%) |
| miCA_2 | 19,485,083 (100%) | 19,126,024 (98.15%) | 66,229 (0.34%) | 109,935 (0.57%) | 82,378 (0.43%) | 576 (0.01%) | 5,235,308 (27.37%) | 13,631,598 (71.27%) |
| miCA_3 | 18,046,481 (100%) | 17,705,703 (98.11%) | 66,387 (0.37%) | 130,810 (0.73%) | 75,991 (0.42%) | 504 (0.01%) | 4,288,459 (24.22%) | 13,143,552 (74.23%) |
FIGURE 2Length distribution of sRNA sequences in the six sRNA libraries prepared from leaves of the A. nanus seedlings cultured in untreated conditions (CK) (A) and under cold acclimation (CA) (B).
FIGURE 3Statistics on the number of precursors of the miRNA families (A) and the secondary structure of the miRNA precursors of ana-miRN4 (B), ana-miRN9 (C), and ana-miRN33 (D). Mature sequences of miRNAs are shown in uppercase, with red representing 5p and blue representing 3p. The structure diagrams were generated by using the UNAFold Web Server.
Species-specific miRNAs predicted from A. nanus.
| ID | miRNA name | Sequence | Length (nt) | Total reads | ΔG (kcal/mol) |
|---|---|---|---|---|---|
| N1 | ana-miRN1-5p | AAGCTCTTGCTAGGTTGATTG | 21 | 12 | −70.20 |
| ana-miRN1-3p | ATTGCCTACAGTTAGATCCTTA | 22 | 281 | ||
| N2 | ana-miRN2-5p | AGGATATTGCTGGGTTGATTG | 21 | 57 | −76.80 |
| ana-miRN2-3p | ATTACCTATAGTTTTATCCT | 20 | 3 | ||
| N3 | ana-miRN3-5p | TACTAATTTGGTCCTCAAGAA | 21 | 11 | −66.80 |
| ana-miRN3-3p | TCTTGAGGATCAAATTTGTATT | 22 | 34 | ||
| N4 | ana-miRN4-5p | TGCCAACTTGAAGAACAAACA | 21 | 150 | −56.60 |
| ana-miRN4-3p | TTTGTTCTTCAAGTTGGCATC | 21 | 40,865 | ||
| N5 | ana-miRN5-5p | TGTTTGGGAGAAGTGGGAAAG | 21 | 243 | −55.80 |
| ana-miRN5-3p | TTTTCCGCTTCTTTCAAACAG | 21 | 1791 | ||
| N6 | ana-miRN6-5p | TCATTTAATCCCTATACGTAG | 21 | 25 | −38.80 |
| ana-miRN6-3p | TAACGGGAGGGACCAAATGGG | 21 | 101 | ||
| N7 | ana-miRN7-5p | TATGGTGATACATATCTGATG | 21 | 709 | −36.10 |
| ana-miRN7-3p | TTAGATATGTATCTCCTTATT | 21 | 772 | ||
| N8 | ana-miRN8-5p | TCCGTGGCCAAGATGACGAAGAA | 23 | 1437 | −40.70 |
| ana-miRN8-3p | CTCTTCATCTTCCTCGGATTC | 21 | 43 | ||
| N9 | ana-miRN9-5p | TTTAGGATAGGCTTTGATACC | 21 | 630 | −54.30 |
| ana-miRN9-3p | TATCAAAGCCTATCCGAGATC | 21 | 16 | ||
| N10 | ana-miRN10-5p | ATTCTTCATTTAGTCTCTATA | 21 | 334 | −40.70 |
| ana-miRN10-3p | TAGGGACTAAATGAAGAATCT | 21 | 10 | ||
| N11 | ana-miRN11-5p | CATTAACGAAATTCCAAAAAC | 21 | 69 | −93.40 |
| ana-miRN11-3p | TTTTGGAATTTCGTTAATATC | 21 | 393 | ||
| N12 | ana-miRN12-5p | TCCGCCGAGACTCGTCTGCA | 20 | 172 | −81.90 |
| ana-miRN12-3p | CAGACGGGTCATGGCAGACGA | 21 | 21 | ||
| N13 | ana-miRN13-5p | TTTCCTGTCACATTCTCTGTC | 21 | 49 | −93.70 |
| ana-miRN13-3p | CAGAGAATGTGACAGGAAAGTG | 22 | 12 | ||
| N14 | ana-miRN14-5p | TTGTACGATTTTGGTCCCTCA | 21 | 12 | −85.00 |
| ana-miRN14-3p | TGAGGGACCAAAATTACACAAT | 22 | 43 | ||
| N15 | ana-miRN15-5p | TGGGATTACAGGGGTTCTCTT | 21 | 10 | −82.30 |
| ana-miRN15-3p | AGAGAACCCCTGTAATCCCAG | 21 | 36 | ||
| N16 | ana-miRN16-5p | TTACGGGACATTCTTATGTGGC | 22 | 14 | −43.40 |
| ana-miRN16-3p | CACATAGGAATGACACGTAAGCT | 23 | 20 | ||
| N17 | ana-miRN17-5p | TTTTGTTTTTGGTCCCTGTCA | 21 | 18 | −54.00 |
| ana-miRN17-3p | CAGGGACCAAAAACAAAATTTT | 22 | 10 | ||
| N18 | ana-miRN18-5p | CCCACCCACACAGTTGACCTAA | 22 | 1057 | −37.10 |
| ana-miRN18-3p | AGGTCAAATTTGTGGGGGGTG | 21 | 67 | ||
| N19 | ana-miRN19-5p | GAGGGACTAAATGAAGAATTT | 21 | 105 | −123.00 |
| ana-miRN19-3p | ATTCTTCATTTAGTCTCTATA | 21 | 347 | ||
| N20 | ana-miRN20-5p | TAAGGACTAAATGAAGAATTT | 21 | 32 | −63.90 |
| ana-miRN20-3p | ATTCTTCATTTAGTCTCTATA | 21 | 347 | ||
| N21 | ana-miRN21-5p | CATTAACGAAATTCCAAAAAC | 21 | 67 | −78.70 |
| ana-miRN21-3p | TTTTGGAATTTCGTTAATATC | 21 | 365 | ||
| N22 | ana-miRN22-5p | CGTCCTGGTGAAACGCGCCACT | 22 | 307 | −70.10 |
| ana-miRN22-3p | TGGCGCGTTCCACCAGGATGC | 21 | 11 | ||
| N23 | ana-miRN23-5p | TCCACTGAACGTAATTAACCA | 21 | 227 | −57.70 |
| ana-miRN23-3p | ATTAATTACGTTCAGTGGATG | 21 | 13 | ||
| N24 | ana-miRN24-5p | TTGATCAACTCCTCCACCGTGA | 22 | 25 | −34.90 |
| ana-miRN24-3p | CACGGTGAGAGTTGGACTTTGC | 22 | 200 | ||
| N25 | ana-miRN25-5p | TCCACTGAACGTAATTAACCA | 21 | 210 | −90.90 |
| ana-miRN25-3p | ATTAATTACGTTCAGTGGATG | 21 | 15 | ||
| N26 | ana-miRN26-5p | TACCAATTTGATCCTCAAGAAT | 22 | 10 | −68.90 |
| ana-miRN26-3p | TTTGAGGATCAAATTGGTATT | 21 | 194 | ||
| N27 | ana-miRN27-5p | TGGCGCGACGCAGTGGAAGGC | 21 | 72 | −114.50 |
| ana-miRN27-3p | TCCACTGCGTCGCGCCACGTG | 21 | 67 | ||
| N28 | ana-miRN28-5p | TGGCGCGACGCAGTGGAAGGC | 21 | 43 | −83.10 |
| ana-miRN28-3p | TCCACTGCGTCGCGCCACGTG | 21 | 67 | ||
| N29 | ana-miRN29-5p | TCACTCATCGTTGGATCAATC | 21 | 75 | −32.50 |
| ana-miRN29-3p | TTGATCTAACGGTGCGTGAAT | 21 | 18 | ||
| N30 | ana-miRN30-5p | TAGCACATCATGTCCCAATCA | 21 | 12 | −47.80 |
| ana-miRN30-3p | ATTGGGATATAATGTGATACAT | 22 | 55 | ||
| N31 | ana-miRN31-5p | CATTAACCACGATTTTGAACG | 21 | 37 | −91.40 |
| ana-miRN31-3p | TTCAAAATCGTGGTTAATGAA | 21 | 27 | ||
| N32 | ana-miRN32-5p | TCCGGATCCTCTAACTTTAGG | 21 | 49 | −55.70 |
| ana-miRN32-3p | TAAAGTTAGAGGATCCAAATC | 21 | 20 | ||
| N33 | ana-miRN33-5p | CCAAATCTCAATCGTTGGATT | 21 | 39 | −58.90 |
| ana-miRN33-3p | TCCAACGGTTGAGATTTGAGT | 21 | 34 | ||
| N34 | ana-miRN34-5p | CATTAACCACGATTTTGAACG | 21 | 37 | −72.40 |
| ana-miRN34-3p | TTCAAAATCGTGGTTAATGAA | 21 | 21 | ||
| N35 | ana-miRN35-5p | TATCAATTTGGTCCTCAAGAA | 21 | 32 | −56.07 |
| ana-miRN35-3p | TCTTGAGGATCAAATTTGTATT | 22 | 34 | ||
| N36 | ana-miRN36-5p | TTTGGATCCTCTAACTTTAGG | 21 | 15 | −56.58 |
| ana-miRN36-3p | TAAAGTTAGAGGATCCGGATC | 21 | 26 | ||
| N37 | ana-miRN37-5p | TTTGGATCCTCTAACTTTAGG | 21 | 15 | −50.50 |
| ana-miRN37-3p | TAAAGTTAGAGGATCCGGATC | 21 | 26 | ||
| N38 | ana-miRN38-5p | TATCAATTTGGTCCTCAAGAA | 21 | 32 | −50.10 |
| ana-miRN38-3p | TTGAGGACCAAATTAATATTTT | 22 | 13 | ||
| N39 | ana-miRN39-5p | CGGAAAATTGTTGCAGTTAAGC | 22 | 41 | −83.10 |
| ana-miRN39-3p | TTAACTGCAACAATTTGTCCAT | 22 | 2655 |
FIGURE 4GO analysis and T-plots of miRNA targets in A. nanus. GO analysis of the miRNA targets (A). Red columns represent BP, green columns represent CC, and blue columns represent MF. T-plots of miR160-ARF (B), miR159-MYB (C), miR169-NF-YA (D), miR1507-NB-ARC (E), miR1509-comp35748_c0_seq1 (F), and miR1511-comp15186_c1_seq10 (G) pairs identified by degradome sequencing. Cleavage sites on target genes are indicated by red dots.
Noncanonical targets of the predicted miRNAs identified by degradome sequencing in A. nanus.
| miRNA | Non-canonical target | Annotation/coding potential |
|---|---|---|
| ana-miR1507a-3p | comp13515_c0_seq1 | Pre-rRNA-processing protein TSR2, conserved region |
| ana-miR1507a-3p | comp15069_c7_seq8 | Basic-leucine zipper (bZIP) transcription factor family protein |
| ana-miR1507a-3p | comp19088_c0_seq1 | TIM23-2 | translocase inner membrane subunit 23–2 |
| ana-miR1509a-5p | comp15920_c0_seq10 | hydrolases; protein serine/threonine phosphatases (PP) |
| ana-miR1509a-5p | comp15920_c0_seq1 | hydrolases; protein serine/threonine phosphatases |
| ana-miR1511a-3p | comp15499_c1_seq10 | Bromo-adjacent homology (BAH) domain-containing protein |
| ana-miR1511a-3p | comp15499_c1_seq2 | Bromo-adjacent homology (BAH) domain-containing protein |
| ana-miR1511a-3p | comp15499_c1_seq9 | Bromo-adjacent homology (BAH) domain-containing protein |
| ana-miR1511a-3p | comp15745_c1_seq1 | GAUT6 | galacturonosyltransferase 6 |
| ana-miR1511a-3p | comp19214_c0_seq1 | ARM repeat superfamily protein |
| ana-miR1511a-3p | comp6070_c1_seq1 | SWIB complex BAF60b domain-containing protein |
| ana-miR156d-3p | comp13662_c0_seq4 | GTE8 | global transcription factor group E8 |
| ana-miR156i-3p | comp15773_c2_seq28 | DNA glycosylase superfamily protein (DGS) |
| ana-miR156j-5p | comp11270_c0_seq3 | BPM2 | BTB-POZ and MATH domain 2 |
| ana-miR156j-5p | comp16323_c0_seq1 |
|
| ana-miR159h-3p | comp4558_c0_seq1 | Mitochondrial transcription termination factor family protein |
| ana-miR159i-3p | comp14691_c0_seq1 | Ypt/Rab-GAP domain of gyp1p superfamily protein (Gyp1p) |
| ana-miR171-1b-5p | comp15661_c0_seq18 | Phox-associated domain, Phox-like, Sorting nexin, C- terminal (PX) |
| ana-miR171-1f-3p | comp14326_c1_seq1 | Nucleotide/sugar transporter family protein |
| ana-miR396c-5p | comp11385_c0_seq1 | LACS1 | AMP-dependent synthetase and ligase family protein |
| ana-miR396c-5p | comp19381_c0_seq1 | BSD domain-containing protein |
| ana-miR1509a-5p | comp15155_c0_seq14 | Noncoding |
| ana-miR1509a-5p | comp35748_c0_seq1 | Noncoding |
| ana-miR1509b-5p | comp14487_c0_seq2 | Noncoding |
| ana-miR1509b-5p | comp15155_c0_seq6 | Noncoding |
| ana-miR1511a-3p | comp15186_c1_seq10 | coding |
| ana-miR1511a-3p | comp15876_c0_seq40 | Noncoding |
| ana-miR1511a-3p | comp390_c0_seq1 | Noncoding |
| ana-miR156d-5p | comp12590_c1_seq4 | coding |
| ana-miR156h-5p | comp12590_c1_seq2 | coding |
| ana-miR164a-3p | comp14847_c0_seq4 | Noncoding |
| ana-miR164c-3p | comp21396_c0_seq1 | Noncoding |
| ana-miR396b-5p | comp10567_c1_seq1 | Noncoding |
| ana-miR396b-5p | comp10567_c1_seq2 | Noncoding |
FIGURE 5Expression of cold-responsive miRNAs in A. nanus. (A) Expression of cold-responsive conserved miRNAs and non-conserved miRNAs. (B) qRT-PCR validation of the cold-responsive conserved miRNAs. (C) qRT-PCR validation of the cold-responsive nonconserved miRNAs. The Y-axis shows the relative expression levels of conserved miRNAs and non-conserved miRNAs, with U6 as an internal reference, averaged over three technical replicates. Values are expressed as means ± SD (n = 3).
FIGURE 6Abiotic stress–responsive cis-elements predicted from the promoters of cold-responsive miRNA genes.
FIGURE 7qRT-PCR analysis of the targets of the 12 selected cold-responsive miRNAs. Red columns represent miRNAs and blue columns represent target genes. The Y-axis shows the relative expression with U6 or actin as the internal reference, and data are averaged over three technical replicates. Values are expressed as means ± SD.
FIGURE 8Bioinformatics analysis of miR4415 sequences. Multiple sequence alignment of the mature forms of miR4415 (guide strand) (A). Phylogenetic tree of the precursors of miR4415 from several plant species (B). Multiple sequence alignment of miR4415 precursors from several plant species (C). cca-miR4415, miR4415 from Cajanus cajan; tsu-miR4415, miR4415 from Trifolium subterraneum; vun-miR4415, miR4415 from Vigna unguiculata; gso-miR4415a and gso-miR4415b, miR4415 from Glycine soja; tpr-miR4415a and tpr-miR4415b, miR4415 from Trifolium pratense; van-miR4415, miR4415 from Vigna angularis; mtr-miR4415, miR4415 from Medicago truncatula; vra-miR4415, miR4415 from Vigna radiata; pvu-miR4415, gma-miR4415a and gma-miR4415b, miR4415 from Glycine max; amo-miR4415, miR4415 from Ammopiptanthus mongolicus; ana-miR4415, miR4415 from Ammopiptanthus nanus.
FIGURE 9L-AO gene was targeted by ana-miR4415a-3p. Binding sites of ana-miR4415a-3p on L-AO as predicted by psRNAtarget (A). Dual-luciferase reporter vector construction for dual-luciferase reporter assay (B). Ratio of LUC/REN in the 62 SK + L-AO and Pre-miR4415 + L-AO cells (C). Values are expressed as means ± SD (n = 5). Student’s t-test, *p < 0.05.
FIGURE 10Subcellular localization of L-AO-GFP and analysis of apoplastic redox homeostasis in leaves of A. nanus under cold acclimation. (A) Subcellular localization of L-AO-GFP. Bars = 50 µm (B) AO activity. (C) Content of ASA. (D) Content of DHA. (E) ASA/DHA ratio. Values are expressed as means ± SD. Student’s t-test, *p < 0.05.
FIGURE 11miRNA-mediated gene regulation network in response to cold acclimation in A. nanus leaves. miRNAs are indicated by red squares and targets by blue squares.
FIGURE 12Proposed model of the regulatory role of miR4415 in cold acclimation in A. nanus. Under cold acclimation, expression of the miR4415 precursor was inhibited, resulting in downregulation of the ana-miR4415a-3p and upregulation of L-AO. Upregulated L-AO catalyzes the oxidation of ASA to form DHA, lowering the AsA/DHA ratio, thereby changing the redox status of the apoplast. Change in apoplastic redox state regulates the tolerance to freezing stress in A. nanus seedlings.