Coordination of cell proliferation and migration is fundamental for life, and its dysregulation has catastrophic consequences, such as cancer. How cell cycle progression affects migration, and vice versa, remains largely unknown. We address these questions by combining in silico modelling and in vivo experimentation in the zebrafish trunk neural crest (TNC). TNC migrate collectively, forming chains with a leader cell directing the movement of trailing followers. We show that the acquisition of migratory identity is autonomously controlled by Notch signalling in TNC. High Notch activity defines leaders, while low Notch determines followers. Moreover, cell cycle progression is required for TNC migration and is regulated by Notch. Cells with low Notch activity stay longer in G1 and become followers, while leaders with high Notch activity quickly undergo G1/S transition and remain in S-phase longer. In conclusion, TNC migratory identities are defined through the interaction of Notch signalling and cell cycle progression.
Coordination of cell proliferation and migration is fundamental for life, and its dysregulation has catastrophic consequences, such as cancer. How cell cycle progression affects migration, and vice versa, remains largely unknown. We address these questions by combining in silico modelling and in vivo experimentation in the zebrafish trunk neural crest (TNC). TNC migrate collectively, forming chains with a leader cell directing the movement of trailing followers. We show that the acquisition of migratory identity is autonomously controlled by Notch signalling in TNC. High Notch activity defines leaders, while low Notch determines followers. Moreover, cell cycle progression is required for TNC migration and is regulated by Notch. Cells with low Notch activity stay longer in G1 and become followers, while leaders with high Notch activity quickly undergo G1/S transition and remain in S-phase longer. In conclusion, TNC migratory identities are defined through the interaction of Notch signalling and cell cycle progression.
The harmonious coupling of cell proliferation with migration is fundamental for the normal growth and homeostasis of multicellular organisms. A prominent consequence of the dysregulation of these processes is cancer. Uncontrolled cell proliferation leads to primary tumours, and the acquisition of migratory capacities leads to the formation of secondary tumours, the most common cause of cancer deaths. Metastatic cells can migrate collectively, which endows them with more aggressive behaviours (Nagai et al., 2020). Collective cell migration refers to the movement of a group of cells that maintain contact and read guidance cues cooperatively (Rorth, 2009). This mechanism has been studied in several contexts, such as wound healing, angiogenesis, and neural crest (NC) migration. However, how cell proliferation impacts collective cell migration, and vice versa, remains largely unknown. The molecular signals that may couple these two fundamental processes remain equally unclear.The NC is a mesenchymal cell population that arises early in development and migrates throughout the body, giving rise to a variety of cell types (neurons, glia, pigment cells, etc.). The NC’s stereotypical migratory behaviour (Gammill and Roffers-Agarwal, 2010) and similarity to metastatic cells (Maguire et al., 2015) make this cell type an ideal model to study the mechanisms of collective cell migration in vivo. Our previous work has shown that zebrafish trunk neural crest (TNC) migrate collectively forming single-file chains (Richardson et al., 2016). One cell at the front of the chain, the leader, is the only cell capable of instructing directionality to the group, while follower cells trail the leader. This division of roles into leaders and followers has been observed in other collectively migrating systems (Theveneau and Linker, 2017). Moreover, histopathological studies from cancer samples and cell lines show clear morphological and molecular differences between the invasive front, leaders, and the lagging cells, followers (Pandya et al., 2017). One outstanding question from these studies is what are the signals that determine leader versus follower migratory identities?Notch signalling is a cell-cell communication pathway that directly translates receptor activation at the membrane into gene expression changes. Notch receptors are activated by membrane-bound ligands of the Delta/Serrate/Lag2 family. Upon ligand binding, Notch receptors are cleaved by γ-secretases releasing their intracellular domain (NICD). Subsequently, NICD translocates to the nucleus, binds the CBF1/Su(H)/Lag-1 complex, and initiates transcription (Bray, 2016). Among the direct Notch targets are members of the Hes gene family, which encode transcriptional repressors able to antagonise the expression of specific cell fate determinants and Notch ligands, generating a negative feedback loop in which cells with high Notch receptor activity downregulate the expression of Notch ligands, and cannot activate the pathway in their neighbours. Hence, adjacent cells interacting through the Notch pathway typically end up with either low or high levels of Notch activity and adopt distinct fates, a mechanism known as lateral inhibition (Lewis, 1998). Interestingly, Notch signalling has also been implicated in cell migration (Giniger, 1998; Leslie et al., 2007; Timmerman et al., 2004) and promotes invasive behaviours during cancer progression (Reichrath and Reichrath, 2012). Furthermore, lateral inhibition is implicated in the allocation of migratory identities during angiogenesis (Phng and Gerhardt, 2009), trachea formation in Drosophila (Caussinus et al., 2008), and in cell culture (Riahi et al., 2015). Whether Notch signalling plays a similar role in the context of mesenchymal cell migration is unknown. Notch signalling is required for NC induction (Cornell and Eisen, 2005), and its components and activity remain present in migrating NC (Liu et al., 2015; Rios et al., 2011). Nevertheless, the role of Notch during NC migration remains unclear. Cardiac NC are reported to develop normally under lack of Notch signalling (High et al., 2007). However, using different genetic tools, it has been shown that both gain and loss of Notch function led to the lack of NC derivatives (Mead and Yutzey, 2012). Moreover, in Xenopus the loss of Notch effectors leads to aberrant NC migration (Vega‐López et al., 2015).The Notch pathway has not only been implicated in cell fate allocation, but it is also important for cell proliferation. Depending on the context, Notch can inhibit or promote cell cycle progression (Campos et al., 2002; Carlson et al., 2008; Devgan et al., 2005; Fang et al., 2017; Georgia et al., 2006; Mammucari et al., 2005; Nguyen et al., 2006; Nicoli et al., 2012; Noseda et al., 2004; Ohnuma et al., 1999; Park et al., 2005; Patel et al., 2016; Rangarajan et al., 2001; Riccio et al., 2008; Zalc et al., 2014). Indeed, Notch target genes include important cell cycle regulators such as CyclinD1, p21 and MYC (Campa et al., 2008; Guo et al., 2009; Joshi et al., 2009; Palomero et al., 2006; Ronchini and Capobianco, 2001).Using a combination of in vivo and in silico approaches, we have established that differences in Notch activity between premigratory TNC select the leader cell. Cells with high levels of Notch signalling adopt a leader identity, while cells that lack Notch activity become followers. Our data show that a single progenitor cell in the premigratory area divides asymmetrically, giving rise to a large prospective leader and smaller follower cell. We propose that this original small asymmetry generates differences in Notch activity between TNC that are thereafter enhanced by cell-cell communication through Notch lateral inhibition. Differences in Notch activity in turn drive distinct cell cycle progression patterns and regulate the expression of phox2bb. Leader cells undergo the G1/S transition faster and remain in S-phase for longer than follower cells. Moreover, continuous progression through the cell cycle is required for TNC migration. Taken together, our results support a model in which the interaction between Notch and the cell cycle defines leader and follower migratory behaviours.
Results
Notch signalling is required for TNC migration
NC cells are induced at the border of the neural plate early during development. The prospective NC expresses Notch components, and Notch activity is required for NC induction (Cornell and Eisen, 2005). Our analysis reveals that Notch components remain expressed in NC after induction, suggesting that Notch signalling may also be involved in later aspects of NC development (Figure 1—figure supplement 1). Moreover, analysis of the Notch activity reporter line 12xNRE:egpf (Moro et al., 2013) shows that Notch signalling levels vary widely between premigratory TNC (Figure 1), suggesting that Notch may play a role after TNC induction. To explore the role of Notch in TNC development, we first aimed to define the stage at which NC induction becomes independent of Notch signalling. To this end, we treated embryos with the γ-secretase inhibitor DAPT (Richter et al., 2017) and assessed expression of NC marker. Our results showed that Notch inhibition impairs TNC induction up to 11 hours post-fertilization (hpf; Figure 2) and confirmed previous reports that induction of the cranial and vagal NC populations is independent of Notch signalling (Cornell and Eisen, 2000). Next, we analysed the effect of Notch inhibition at 12 hpf on the development of TNC derivatives. We found a reduction in all TNC derivatives (neurons, glia, and pigment cells; Figure 3A–F) upon Notch inhibition, suggesting that Notch activity is important in a process subsequent to induction, yet prior to differentiation. We next explored whether TNC migration is affected by Notch inhibition. Analysis of crestin expression showed a reduction in the number of TNC cell chains formed and in their ventral advance upon DAPT treatment (Figure 3G–J), which likely explains the lack of TNC derivatives at later stages. We then asked whether these results are due to a delay or a halt of migration. To this end, embryos were treated with DAPT from 12 hpf for 6–12 hr and processed for crestin expression. Decreased numbers of migratory chains were observed at all timepoints, but as embryos developed new chains were formed, indicating that the blockade of Notch signalling delays TNC migration (Figure 3K). Comparable results were obtained by inhibiting Notch genetically in embryos where the dominant-negative form of Suppressor of Hairless is under the control of a heat shock element (Latimer et al., 2005; hs:dnSu(H); Figure 3L). We reasoned that if Notch inhibition delays the onset of TNC migration, its overactivation might lead to TNC migrating earlier, leading to an increased number of chains. To test this, we induced NICD expression in all tissues by heat shock of hs:Gal4;UAS:NICD embryos (Scheer and Campos-Ortega, 1999). To our surprise, Notch gain of function (GOF) and loss of function (LOF) resulted in almost identical phenotypes, both showing a similar reduction of TNC chain numbers (Figure 3L). Taken together, these results show that precise regulation of Notch signalling levels is required for TNC migration.
Figure 1—figure supplement 1.
Expression of Notch signalling components during trunk neural crest (TNC) migration.
Transversal sections at trunk level of Sox10:GFP embryos showing the expression of (A–C) notch1a, (D–F) dlb (deltaB), (G–I) dld (deltaD), and (J–L) her4. (A), (D), (G), and (J) bright field, (B), (E), (H), and (K) GFP-fluorescence, and (C), (F), (I), and (L) overlay. Dotted black line in the brightfield frames indicates TNC cells seen in the fluorescent image.
Figure 1.
Trunk neural crest (TNC) present different levels of Notch activity.
(A, E) Images of two different Notch reporter 12xNRE:egfp embryos (18 hpf) stained for sox10 (magenta) and GFP (green) RNAs, and nuclei stained with DAPI (blue). (B) Enlargement of the anterior area in (A). (C) Enlargement of the more posterior area in (A). (D) Enlargement of the anterior most posterior area in (A). (F) Enlargement of the outlined area in (E). Anterior to the left, dorsal top. White lines show approximate cell boundaries.
Transversal sections at trunk level of Sox10:GFP embryos showing the expression of (A–C) notch1a, (D–F) dlb (deltaB), (G–I) dld (deltaD), and (J–L) her4. (A), (D), (G), and (J) bright field, (B), (E), (H), and (K) GFP-fluorescence, and (C), (F), (I), and (L) overlay. Dotted black line in the brightfield frames indicates TNC cells seen in the fluorescent image.
Figure 2.
Trunk neural crest (TNC) induction is independent of Notch signalling after 12 hpf.
(A) crestin in situ hybridisation in wildtype (WT) embryo at 18 hpf. (B, C) crestin in situ hybridisation in DAPT-treated embryos: (B) reduced or (C) absent TNC. (D) Quantification of the crestin expression phenotypes upon DAPT treatment (phenotypes: WT, black; reduced, orange; absent, red; 30% epiboly n = 38, 75% epiboly n = 32, 11 hpf n = 35, 12 hpf n = 39). (E–J) In situ hybridisation for neural crest (NC) markers in representative control (DMSO) and DAPT-treated embryos from 12 to 16 hpf. (E, F) crestin (DMSO n = 32, DAPT n = 38), (G, H) foxd3 (DMSO n = 16, DAPT n = 35), and (I, J) sox10 (DMSO n = 27, DAPT n = 29). Anterior to the left, dorsal top.
Figure 3.
Notch signalling is required for trunk neural crest (TNC) migration and derivatives formation.
(A, B) Glial marker mbp in situ hybridisation upon (A) control (DMSO; n = 15) and (B) DAPT (n = 20) treatment from 12 hpf. (C, D) Neuronal marker bdh in situ hybridisation upon (C) control (DMSO; n = 25) and (D) DAPT (n = 18) treatment from 12 hpf. (E, F) Pigmentation upon (E) control (DMSO; n = 40) and (F) DAPT (n = 52) treatment from 12 hpf. (G, H) Neural crest marker crestin in situ hybridisation upon (G) control (DMSO) and (H) DAPT treatment from 12 to 18 hpf. (I, J) crestin in situ hybridisation upon (I) control (DMSO) and (J) DAPT treatment from 12 to 24 hpf. (K) Quantification of migratory chain formation upon control (DMSO) and DAPT treatment from 12 to 18 hpf (DMSO n = 98; DAPT n = 126), 20 hpf (DMSO n = 111; DAPT n = 109), and 24 hpf (DMSO n = 42; DAPT n = 61). (L) Quantification of migratory chain formation in control (HS:Gal4; n = 516), Notch loss of function (LOF) (HS:dnSu(H); n = 220), and gain of function (GOF) conditions (HS:Gal4xUAS:NICD; n = 142) heat shocked at 11 hpf and analysed at 18 hpf. Mann–Whitney U-test, control vs. LOF ****p<0.0001, control vs. GOF **p=0.0020. Anterior to the left, dorsal top, except in (C, D) anterior left, ventral view. Arrowheads indicate gene expression. All treatments performed from 12 hpf.
Trunk neural crest (TNC) present different levels of Notch activity.
(A, E) Images of two different Notch reporter 12xNRE:egfp embryos (18 hpf) stained for sox10 (magenta) and GFP (green) RNAs, and nuclei stained with DAPI (blue). (B) Enlargement of the anterior area in (A). (C) Enlargement of the more posterior area in (A). (D) Enlargement of the anterior most posterior area in (A). (F) Enlargement of the outlined area in (E). Anterior to the left, dorsal top. White lines show approximate cell boundaries.
Expression of Notch signalling components during trunk neural crest (TNC) migration.
Transversal sections at trunk level of Sox10:GFP embryos showing the expression of (A–C) notch1a, (D–F) dlb (deltaB), (G–I) dld (deltaD), and (J–L) her4. (A), (D), (G), and (J) bright field, (B), (E), (H), and (K) GFP-fluorescence, and (C), (F), (I), and (L) overlay. Dotted black line in the brightfield frames indicates TNC cells seen in the fluorescent image.
Trunk neural crest (TNC) induction is independent of Notch signalling after 12 hpf.
(A) crestin in situ hybridisation in wildtype (WT) embryo at 18 hpf. (B, C) crestin in situ hybridisation in DAPT-treated embryos: (B) reduced or (C) absent TNC. (D) Quantification of the crestin expression phenotypes upon DAPT treatment (phenotypes: WT, black; reduced, orange; absent, red; 30% epiboly n = 38, 75% epiboly n = 32, 11 hpf n = 35, 12 hpf n = 39). (E–J) In situ hybridisation for neural crest (NC) markers in representative control (DMSO) and DAPT-treated embryos from 12 to 16 hpf. (E, F) crestin (DMSO n = 32, DAPT n = 38), (G, H) foxd3 (DMSO n = 16, DAPT n = 35), and (I, J) sox10 (DMSO n = 27, DAPT n = 29). Anterior to the left, dorsal top.
Notch signalling is required for trunk neural crest (TNC) migration and derivatives formation.
(A, B) Glial marker mbp in situ hybridisation upon (A) control (DMSO; n = 15) and (B) DAPT (n = 20) treatment from 12 hpf. (C, D) Neuronal marker bdh in situ hybridisation upon (C) control (DMSO; n = 25) and (D) DAPT (n = 18) treatment from 12 hpf. (E, F) Pigmentation upon (E) control (DMSO; n = 40) and (F) DAPT (n = 52) treatment from 12 hpf. (G, H) Neural crest marker crestin in situ hybridisation upon (G) control (DMSO) and (H) DAPT treatment from 12 to 18 hpf. (I, J) crestin in situ hybridisation upon (I) control (DMSO) and (J) DAPT treatment from 12 to 24 hpf. (K) Quantification of migratory chain formation upon control (DMSO) and DAPT treatment from 12 to 18 hpf (DMSO n = 98; DAPT n = 126), 20 hpf (DMSO n = 111; DAPT n = 109), and 24 hpf (DMSO n = 42; DAPT n = 61). (L) Quantification of migratory chain formation in control (HS:Gal4; n = 516), Notch loss of function (LOF) (HS:dnSu(H); n = 220), and gain of function (GOF) conditions (HS:Gal4xUAS:NICD; n = 142) heat shocked at 11 hpf and analysed at 18 hpf. Mann–Whitney U-test, control vs. LOF ****p<0.0001, control vs. GOF **p=0.0020. Anterior to the left, dorsal top, except in (C, D) anterior left, ventral view. Arrowheads indicate gene expression. All treatments performed from 12 hpf.
In vivo Notch activity allocates TNC migratory identity
Interestingly, Notch signalling is required during collective migration to define distinct identities (Phng and Gerhardt, 2009; Caussinus et al., 2008; Riahi et al., 2015). To test whether Notch plays a similar role in TNC migration, we performed live-imaging analysis of TNC migration under lack (inhibition and LOF) or overactivation (GOF) of Notch signalling (Figure 4, Figure 4—videos 1 and 2). Our previous work defined a leader as the cell that retains the front position of the chain throughout migration, advancing faster and in a more directional manner than followers (Richardson et al., 2016). Under Notch inhibition (treatment with γ-secretase inhibitor Compound E; Richter et al., 2017), TNC remain motile with a single cell initiating the movement of the chain, but in contrast to control treatment (DMSO) the leader cell is unable to retain the front position and is overtaken by one or several followers (Figure 4A and C, Figure 5A and B, Figure 4—video 1). The overtaking follower cell, in turn, is not always able to retain the front position and can be overtaken by cells further behind in the chain. This loss of group coherence corresponds with a reduction in ventral advance, with most leader cells unable to move beyond the neural tube/notochord boundary (NT/not; Figure 4C, Figure 5A and C). This behaviour leads to an accumulation of cells at the NT/not, where some cells repolarise moving anterior or posteriorly and crossing the somite boundary and, in some cases, joining adjacent chains. Analysis of single-cell tracking showed that under Notch inhibition leader cells also have decreased speed and directionality (Figure 5D and E). Similar results were observed when Notch inhibition was achieved genetically by driving overexpression of dnSu(H) through heat shock in the entire embryo (not shown; hs:dnSu(H) line). Together, these results strongly suggest that upon lack of Notch signalling the TNC population is formed solely by follower cells that are unable to coordinate the movement of the group. Nevertheless, Notch signalling is important for the development of tissues surrounding TNC that act as a substrate for migration, raising the possibility that Notch signalling does not act cell-autonomously in TNC and instead the phenotypes observed are simply the consequence of somite and/or neural tube malformations. However, this appears unlikely as somite development (formation, patterning, and differentiation) and neuron formation are not affected by Notch inhibition at the axial level analysed (Figure 4—figure supplement 1). Next, we directly tested whether Notch signalling is autonomously required in TNC by inhibiting Notch activity exclusively in NC at the time of migration. To this end, we generated a new UAS:dnSu(H) line and crossed it with Sox10:Kalt4 fish (Alhashem et al., 2021). In the resultant embryos, all NC express Gal4 fused to the oestrogen receptor binding region (Gal4-ER) and are fluorescently labelled by nuclear-RFP. Under normal conditions, Gal4-ER is maintained inactive in the cytoplasm, whilst upon addition of tamoxifen, Gal4-ER is translocated to the nucleus activating transcription from the UAS:dnSu(H) transgene (Figure 4—figure supplement 2). We found that autonomous inhibition of Notch signalling in NC phenocopies the chemical inhibition. Leader cells are unable to retain the front position, being overtaken by followers, and ventral advance is reduced with cells accumulating at the NT/not boundary (Figure 4D, Figure 5A–C, Figure 4—video 2). Moreover, leader cells adopt followers’ migratory parameters, showing decreased speed and directionality (Figure 5D and E), confirming that Notch activity is autonomously required in TNC for identity allocation, and suggest that in the absence of Notch signalling a homogenous group of followers is established. In view of these results, we hypothesised that a homogeneous group of leaders would be formed upon Notch overactivation. Using a similar strategy, Notch overactivation was induced in the whole embryo (not shown, hs:Gal4;UAS:NICD; Scheer and Campos-Ortega, 1999), or exclusively in NC (Sox10:Kalt4;UAS:NICD), and migration was analysed by live imaging. Similar results were obtained in both experimental conditions: group coherence is lost, leader cells are overtaken by followers, and ventral advance is impaired (Figure 4F, Figure 5A–C, Figure 4—video 2). Interestingly, in Notch GOF conditions follower cells adopt leaders’ characteristics, moving with increased speed, but all cells in the chain follow less directional trajectories, which hinders the ventral advance of the group (Figure 5D and E), indicating that all cells in the chain migrate as leaders. Next, we tested whether the behavioural changes observed upon Notch alterations were mirrored by molecular changes by using the leader marker phox2bb. In control conditions, phox2bb transcripts are highly enriched in the leader cells from early stages of migration (Figure 6A, B, and G; Alhashem et al., 2022a). Consistent with expectations, upon Notch overactivation phox2bb is expressed by all the cells in the chain (Figure 6C, D, and G), while its expression is absent when Notch is inhibited (Figure 6E–G). These data show that Notch activity controls phox2bb expression and allocates TNC migratory identity.
(A) Selected frames from in vivo imaging of Sox10:Kalt4 control (DMSO treated) embryos. (B) Selected frames from control simulation with 1:3 leader/follower ratio. (C) Selected frames from in vivo imaging under Notch-inhibited condition, Sox10:Kalt4 embryos treated with CompE. (D) Selected frames from in vivo imaging of Notch loss of function (LOF) condition, Sox10:Kalt4; UAS:dnSu(H) embryos. (E) Selected frames from all followers simulation. (F) Selected frames from in vivo imaging of Notch gain of function (GOF) condition Sox10:Kalt4; UAS:NICD embryos. (G) Selected frames from all leaders simulation. Magenta tracks and green arrowheads indicate leaders; green arrows and cyan tracks follower cells. Asterisks indicate cells crossing somite borders. White line marks dorsal midline. Anterior to the left, dorsal up. Time in minutes.
(A, B) cb1045 in situ hybridisation upon (A) control (DMSO, n = 23) and (B) DAPT (n = 30) treatment. Arrows indicate segmentation defects. (C, D) myod in situ hybridisation upon (C) control (DMSO, n = 47) and (D) DAPT (n = 45) treatment. (E, F) dld (deltaD) in situ hybridisation upon (E) control (DMSO, n = 25) and (F) DAPT (n = 30) treatment. (G, H) Antibody staining for heavy myosin (F59) upon (G) control (DMSO, n = 37) and (H) DAPT (n = 32) treatment. (I, J) Antibody staining for Znp1 upon (I) control (DMSO, n = 35) and (J) DAPT (n = 42) treatment. (K, L) Antibody staining for acetylated tubulin (Ac Tub) upon (K) control (DMSO, n = 20) and (L) DAPT (n = 27) treatment. Arrowheads indicate the level at which trunk neural crest (TNC) migration was analysed. Anterior to the left, dorsal top.
(A) Diagram of the construct used to generate the UAS:dnSu(H) line. (B) Scheme of protocol used. (C–E) Trunk region of a Sox10:Kalt4;UAS:dnSu(H) embryo treated with tamoxifen from 11 to 24 hpf and immunostained for (C) RFP and (D) myc. (E) overlay. Dotted squares indicate enlargement. (F) Number of embryos expressing the UAS driven transcripts (myc+) after tamoxifen treatment from 11 hpf for different times (15′ n = 20, 30′ n = 27, 45′ n = 25, 1 hr n = 22, 3 hr n = 18, 5 hr n = 20, 24 hr n = 14, 48 hr n = 10).
(A, B) Time lapse of Sox10:mG control (DMSO treated) embryo from 16 to 27 hpf. (C, D) Time lapse of Sox10:mG CompE-treated embryo from 16 to 30 hpf. Upper panels show fluorescent nuclei in grey and membranes in green. Lower panels show nuclei in grey, leaders tracked in magenta and followers in cyan. Arrowheads indicate leaders and arrows follower cells. Time in minutes. Related to Figures 4 and 5.
(A, B) Time lapse of control Sox10:Kalt4 embryo from 18 to 28.5 hpf. (C, D) Time lapse of Notch loss of function Sox10:Kalt4;UAS:dnSu(H) embryo from 18 to 27.9 hpf. (E, F) Time lapse of Notch gain of function, Sox10:Kalt4;UAS:NICD, embryo from 18 to 28.5 hpf. Upper panels show fluorescent nuclei in grey. Lower panels show nuclei in grey, leaders tracked in magenta, and followers in cyan. Arrowheads indicate leaders, arrows follower cells. Time in minutes. Related to Figures 4 and 5.
(A) Simulation of a population with a single leader cell (Only 1L). (B) Simulation of a 1:1 leader follower ratio population (1L:1F). (C) Simulation of a 1:3 leader follower ratio population (1L:3F). (D) Simulation of a population composed only of follower cells (All followers). (E) Simulation of a population composed only of leader cells (All leaders). Leaders tracked in magenta and followers in cyan. Arrowheads indicate leaders, arrows follower cells. Time in minutes. Related to Figures 4, 5 and 7.
Figure 5.
Trunk neural crest (TNC) migration measurements in vivo and in silico.
(A) Final position of each cell in model simulations and in vivo experiments under different conditions. In silico results depicted in confined pathway, in vivo data graphed in model embryo, somites contour and dorsal midline (dark grey lines), edge of the premigratory area (dashed lines), and NT/not boundary (light grey lines). Anterior left, dorsal up. (B) Quantification of leader overtaking events in vivo and in silico. Leader overtaken by a single follower is overtaken = 1; leader overtaken by more than one follower cell is overtaken >1. (C) Quantification of the ventral advance of cells in vivo and in silico. (D) Quantification of cell speed in vivo and in silico. (E) Quantification of cell directionality in vivo and in silico. Leader cells in magenta, followers in cyan. Magenta and cyan dashed lines indicate the average values for leaders and followers respectively. Full statistical analysis in Supplementary file 1.
(A, B) Time lapse of Sox10:mG control (DMSO treated) embryo from 16 to 27 hpf. (C, D) Time lapse of Sox10:mG CompE-treated embryo from 16 to 30 hpf. Upper panels show fluorescent nuclei in grey and membranes in green. Lower panels show nuclei in grey, leaders tracked in magenta and followers in cyan. Arrowheads indicate leaders and arrows follower cells. Time in minutes. Related to Figures 4 and 5.
Figure 4—figure supplement 1.
Somites and neural tissue formation are not altered by Notch inhibition.
(A, B) cb1045 in situ hybridisation upon (A) control (DMSO, n = 23) and (B) DAPT (n = 30) treatment. Arrows indicate segmentation defects. (C, D) myod in situ hybridisation upon (C) control (DMSO, n = 47) and (D) DAPT (n = 45) treatment. (E, F) dld (deltaD) in situ hybridisation upon (E) control (DMSO, n = 25) and (F) DAPT (n = 30) treatment. (G, H) Antibody staining for heavy myosin (F59) upon (G) control (DMSO, n = 37) and (H) DAPT (n = 32) treatment. (I, J) Antibody staining for Znp1 upon (I) control (DMSO, n = 35) and (J) DAPT (n = 42) treatment. (K, L) Antibody staining for acetylated tubulin (Ac Tub) upon (K) control (DMSO, n = 20) and (L) DAPT (n = 27) treatment. Arrowheads indicate the level at which trunk neural crest (TNC) migration was analysed. Anterior to the left, dorsal top.
Figure 4—figure supplement 2.
UAS:dnSu(H) transgenic line.
(A) Diagram of the construct used to generate the UAS:dnSu(H) line. (B) Scheme of protocol used. (C–E) Trunk region of a Sox10:Kalt4;UAS:dnSu(H) embryo treated with tamoxifen from 11 to 24 hpf and immunostained for (C) RFP and (D) myc. (E) overlay. Dotted squares indicate enlargement. (F) Number of embryos expressing the UAS driven transcripts (myc+) after tamoxifen treatment from 11 hpf for different times (15′ n = 20, 30′ n = 27, 45′ n = 25, 1 hr n = 22, 3 hr n = 18, 5 hr n = 20, 24 hr n = 14, 48 hr n = 10).
Figure 4—video 2.
Notch gain and loss of function disrupts trunk neural crest (TNC) migratory identity allocation.
(A, B) Time lapse of control Sox10:Kalt4 embryo from 18 to 28.5 hpf. (C, D) Time lapse of Notch loss of function Sox10:Kalt4;UAS:dnSu(H) embryo from 18 to 27.9 hpf. (E, F) Time lapse of Notch gain of function, Sox10:Kalt4;UAS:NICD, embryo from 18 to 28.5 hpf. Upper panels show fluorescent nuclei in grey. Lower panels show nuclei in grey, leaders tracked in magenta, and followers in cyan. Arrowheads indicate leaders, arrows follower cells. Time in minutes. Related to Figures 4 and 5.
(A, B) Images of phox2bb expression in control embryos (Sox10:Kalt4). (C, D) Images of phox2bb expression under Notch gain of function (GOF) conditions (Sox10:Kalt4; UAS:NICD embryos). (E, F) Images of phox2bb expression in Notch inhibition conditions (Compound E). Magenta and cyan arrowheads indicate leaders and followers respectively. (G) Quantification of phox2bb expression in control (n = 13), Notch GOF (n = 14), and Notch inhibition conditions (n = 11). Welch’s t-test, Kalt4 control vs. GOF ****p<0.0001, DMSO control vs. inhibition ****p<0.0001.
(A) Selected frames from in vivo imaging of Sox10:Kalt4 control (DMSO treated) embryos. (B) Selected frames from control simulation with 1:3 leader/follower ratio. (C) Selected frames from in vivo imaging under Notch-inhibited condition, Sox10:Kalt4 embryos treated with CompE. (D) Selected frames from in vivo imaging of Notch loss of function (LOF) condition, Sox10:Kalt4; UAS:dnSu(H) embryos. (E) Selected frames from all followers simulation. (F) Selected frames from in vivo imaging of Notch gain of function (GOF) condition Sox10:Kalt4; UAS:NICD embryos. (G) Selected frames from all leaders simulation. Magenta tracks and green arrowheads indicate leaders; green arrows and cyan tracks follower cells. Asterisks indicate cells crossing somite borders. White line marks dorsal midline. Anterior to the left, dorsal up. Time in minutes.
Somites and neural tissue formation are not altered by Notch inhibition.
(A, B) cb1045 in situ hybridisation upon (A) control (DMSO, n = 23) and (B) DAPT (n = 30) treatment. Arrows indicate segmentation defects. (C, D) myod in situ hybridisation upon (C) control (DMSO, n = 47) and (D) DAPT (n = 45) treatment. (E, F) dld (deltaD) in situ hybridisation upon (E) control (DMSO, n = 25) and (F) DAPT (n = 30) treatment. (G, H) Antibody staining for heavy myosin (F59) upon (G) control (DMSO, n = 37) and (H) DAPT (n = 32) treatment. (I, J) Antibody staining for Znp1 upon (I) control (DMSO, n = 35) and (J) DAPT (n = 42) treatment. (K, L) Antibody staining for acetylated tubulin (Ac Tub) upon (K) control (DMSO, n = 20) and (L) DAPT (n = 27) treatment. Arrowheads indicate the level at which trunk neural crest (TNC) migration was analysed. Anterior to the left, dorsal top.
UAS:dnSu(H) transgenic line.
(A) Diagram of the construct used to generate the UAS:dnSu(H) line. (B) Scheme of protocol used. (C–E) Trunk region of a Sox10:Kalt4;UAS:dnSu(H) embryo treated with tamoxifen from 11 to 24 hpf and immunostained for (C) RFP and (D) myc. (E) overlay. Dotted squares indicate enlargement. (F) Number of embryos expressing the UAS driven transcripts (myc+) after tamoxifen treatment from 11 hpf for different times (15′ n = 20, 30′ n = 27, 45′ n = 25, 1 hr n = 22, 3 hr n = 18, 5 hr n = 20, 24 hr n = 14, 48 hr n = 10).
(A, B) Time lapse of Sox10:mG control (DMSO treated) embryo from 16 to 27 hpf. (C, D) Time lapse of Sox10:mG CompE-treated embryo from 16 to 30 hpf. Upper panels show fluorescent nuclei in grey and membranes in green. Lower panels show nuclei in grey, leaders tracked in magenta and followers in cyan. Arrowheads indicate leaders and arrows follower cells. Time in minutes. Related to Figures 4 and 5.
Notch gain and loss of function disrupts trunk neural crest (TNC) migratory identity allocation.
(A, B) Time lapse of control Sox10:Kalt4 embryo from 18 to 28.5 hpf. (C, D) Time lapse of Notch loss of function Sox10:Kalt4;UAS:dnSu(H) embryo from 18 to 27.9 hpf. (E, F) Time lapse of Notch gain of function, Sox10:Kalt4;UAS:NICD, embryo from 18 to 28.5 hpf. Upper panels show fluorescent nuclei in grey. Lower panels show nuclei in grey, leaders tracked in magenta, and followers in cyan. Arrowheads indicate leaders, arrows follower cells. Time in minutes. Related to Figures 4 and 5.
In silico simulation of trunk neural crest (TNC) chain migration.
(A) Simulation of a population with a single leader cell (Only 1L). (B) Simulation of a 1:1 leader follower ratio population (1L:1F). (C) Simulation of a 1:3 leader follower ratio population (1L:3F). (D) Simulation of a population composed only of follower cells (All followers). (E) Simulation of a population composed only of leader cells (All leaders). Leaders tracked in magenta and followers in cyan. Arrowheads indicate leaders, arrows follower cells. Time in minutes. Related to Figures 4, 5 and 7.
Figure 7.
In silico modelling of trunk neural crest (TNC) migration.
(A) Schematics of model parameters. Diff CIL: only leader/follower collisions induce repulsion and change of directionality. Intensity CIL: the leader’s response upon collision is stronger than the follower’s response. Co-A: co-attraction pulls together cells at a distance. Cell size: volume exclusion. (B) Schematics of simulations multi-objective scores. (C) Depiction of parameter space analysis showing the number of parameters sets that fulfilled each score when different variables were tested. One leader refers to chains with a single leader cell. 1:1, 1:2, and 1:3 refer to leader/follower ratios. (D) 3D plot of linear discriminant analysis (LDA). (E) LDA coefficients of in vivo data. A random dataset was used as control. (F) LDA coefficients of in silico data. A random dataset was used as control.
Trunk neural crest (TNC) migration measurements in vivo and in silico.
(A) Final position of each cell in model simulations and in vivo experiments under different conditions. In silico results depicted in confined pathway, in vivo data graphed in model embryo, somites contour and dorsal midline (dark grey lines), edge of the premigratory area (dashed lines), and NT/not boundary (light grey lines). Anterior left, dorsal up. (B) Quantification of leader overtaking events in vivo and in silico. Leader overtaken by a single follower is overtaken = 1; leader overtaken by more than one follower cell is overtaken >1. (C) Quantification of the ventral advance of cells in vivo and in silico. (D) Quantification of cell speed in vivo and in silico. (E) Quantification of cell directionality in vivo and in silico. Leader cells in magenta, followers in cyan. Magenta and cyan dashed lines indicate the average values for leaders and followers respectively. Full statistical analysis in Supplementary file 1.
(A, B) Images of phox2bb expression in control embryos (Sox10:Kalt4). (C, D) Images of phox2bb expression under Notch gain of function (GOF) conditions (Sox10:Kalt4; UAS:NICD embryos). (E, F) Images of phox2bb expression in Notch inhibition conditions (Compound E). Magenta and cyan arrowheads indicate leaders and followers respectively. (G) Quantification of phox2bb expression in control (n = 13), Notch GOF (n = 14), and Notch inhibition conditions (n = 11). Welch’s t-test, Kalt4 control vs. GOF ****p<0.0001, DMSO control vs. inhibition ****p<0.0001.In summary, our in vivo and molecular data show that Notch signalling is required autonomously in TNC for migratory identity allocation. TNC with high levels of Notch express phox2bb and become leaders, while cells with low Notch activity migrate as followers. Alterations of Notch signalling lead to a homogeneous TNC group with a single migratory identity that is unable to undergo collective migration. Taken together, these data suggest Notch lateral inhibition as the mechanism responsible for TNC migratory identity acquisition.
In silico modelling predicts that more than one leader is required for TNC migration
Our in vivo analysis shows that upon both Notch inhibition and overactivation TNC are unable to undergo collective migration due to lack of group coherence. On the other hand, our molecular analysis shows that upon Notch inhibition an all-followers group is established, while Notch overactivation leads to the formation of an all-leaders group. To gain a better understanding of these paradoxical results, we took an in silico approach, developing a discrete element model of TNC migration. Cells were simulated as 2D particles moving into a constrained space and endowed with intrinsic motility. Four variables control cell movement in the model: contact inhibition of locomotion (CIL) and co-attraction (co-A) define movement directionality and group cohesion, while volume exclusion regulates cell overlap, intuitively understood as cell size, while a noise element (zeta) was added to the cell’s trajectory (Figure 7A). A multi-objective scoring system, based on in vivo measurements, was developed to evaluate how close simulations with different underlying mechanisms matched chain behaviours. The scores were (1) chain cohesion, a maximum distance of 57 μm is allowed between adjacent cells; (2) single file migration for at least 80% of the simulation; (3) followers undergo rearrangements, while (4) leaders retain the front position, and (5) the chain should advance to the end of the migratory path (Figure 7B). Using this analysis and a parsimonious modelling approach, we attempted to match in vivo TNC migration with the simplest form of the model, only adding complexity incrementally in an effort to find the minimal set of predicted mechanisms required. We first simulated chains composed of homogeneous cells and systematically covaried all parameters. We found no parameter combination able to match all scores, confirming our previous findings that cell heterogeneity is required for TNC migration (Figure 7C; Richardson et al., 2016). Evidence from other systems (Astin et al., 2010; Bentley et al., 2014; Parkinson and Edwards, 1978; Theveneau and Mayor, 2013) led us to hypothesise that differences in the CIL response between cells may be at play. Thus, we simulated chains in which only cells of different identities present CIL (Diff CIL; Figure 7A). These simulations match several scores, but chains are unable to reach the end of the migratory path (Figure 7C, Figure 4—video 3). Next, we varied Diff CIL intensity, co-A, and cell size (volume exclusion) for leader cells. Interestingly, the model is only able to recapitulate control conditions when the difference between leaders and follower is maximal for all variables. Nevertheless, it is unable to recapitulate Notch GOF and LOF phenotypes (Figure 7C). Our previous results show that differences in Notch signalling establish migratory identities, suggesting that lateral inhibition may be the mechanism at play. To explore whether different outcomes of lateral inhibition may allow the model to simulate Notch altered conditions (GOF and LOF), different ratios of leader/follower cells were simulated. We first tested a 1:1 ratio, surprisingly this chain architecture over-migrates, moving beyond the end of the pathway (Figure 7C, Figure 4—video 3). Interestingly, we found that several parameter combinations from the 1:2 and 1:3 leader/follower ratios were able to recapitulate in vivo control condition, as well as the loss of group coherence and ventral advance observed in Notch GOF (all leader simulation) and LOF (all follower simulation; Figure 4B, E, and G, Figure 5, Figure 4—video 3). In these simulations, the six parameter combinations that match all in vivo scores had followers at the low setting, while leaders’ CIL intensity took medium or high values, cell size took medium or low values, and co-attraction took all levels. Nevertheless, all these parameter combinations endow the leader with enhanced migratory behaviour.
Figure 4—video 3.
In silico simulation of trunk neural crest (TNC) chain migration.
(A) Simulation of a population with a single leader cell (Only 1L). (B) Simulation of a 1:1 leader follower ratio population (1L:1F). (C) Simulation of a 1:3 leader follower ratio population (1L:3F). (D) Simulation of a population composed only of follower cells (All followers). (E) Simulation of a population composed only of leader cells (All leaders). Leaders tracked in magenta and followers in cyan. Arrowheads indicate leaders, arrows follower cells. Time in minutes. Related to Figures 4, 5 and 7.
In silico modelling of trunk neural crest (TNC) migration.
(A) Schematics of model parameters. Diff CIL: only leader/follower collisions induce repulsion and change of directionality. Intensity CIL: the leader’s response upon collision is stronger than the follower’s response. Co-A: co-attraction pulls together cells at a distance. Cell size: volume exclusion. (B) Schematics of simulations multi-objective scores. (C) Depiction of parameter space analysis showing the number of parameters sets that fulfilled each score when different variables were tested. One leader refers to chains with a single leader cell. 1:1, 1:2, and 1:3 refer to leader/follower ratios. (D) 3D plot of linear discriminant analysis (LDA). (E) LDA coefficients of in vivo data. A random dataset was used as control. (F) LDA coefficients of in silico data. A random dataset was used as control.Next, we used a linear discriminant analysis (LDA) to study which of the model parameters bear most weight in the definition of leader and follower identity. LDA is a dimensionality reduction method that projects the data onto a lower dimensional space minimizing the variation within classes (e.g. between leaders) and maximizing the variation between classes (leaders versus followers), allowing the hierarchical ordering of the factors that best explain the class separation. First, we used the in vivo data to determine whether leaders and followers were properly separated by LDA. A visual inspection of the data makes clear that LDA works well to classify migratory identities (Figure 7D). Moreover, the LDA shows that ventral distance is the most important variable separating leaders from followers, with speed and directionality playing a less dominant role (Figure 7E). Next, we used this method to assess the importance of each of the model parameters. CIL intensity appears to be the parameter that most differ between leader and follower cells, while heterogeneity in the other parameters is not essential (Figure 7F). Taken together, the in silico data confirms our previous conclusion that TNC chains are a heterogeneous group. Remarkably, it also predicts CIL intensity to be the most important distinction between leaders and followers. Finally, the model anticipates that TNC chains are formed of leaders and followers in a 1:2 or 1:3 ratio.
Leader cells arise from the asymmetric division of a progenitor cell
Cell size is a prominent characteristic distinguishing leader from follower cells. Leaders are almost twice as big as followers during migration and this difference is evident before migration initiation (Richardson et al., 2016), suggesting that size disparity arises at birth or shortly thereafter. Interestingly, differential cell size emerged as an important parameter in our in silico analysis, contributing to more realistic leader/follower coordination behaviours. To understand the origin of these size differences, we investigated whether leader and follower cells share a common progenitor, and at which point differences in size become apparent. To this end, we imaged FoxD3:mCherry;H2aFVA:H2a-GFP embryos. The FoxD3:mCherry reporter (Hochgreb-Hägele and Bronner, 2013; Lukoseviciute et al., 2018) labels NC from early stages and allows us to define TNC identity at later stages by their migratory position. Moreover, the nuclear marker H2aFVA:H2a-GFP (Pauls et al., 2001) was used to track single cells and their divisions. Tracking analysis shows that the asymmetric division of a single progenitor cell in each body segment gives rise to a larger cell that becomes a leader (102 ± 20 µm2), and a smaller sibling that migrates as follower (72 ± 9 µm2; Figure 8A and B, Figure 8—video 1). In contrast, all other progenitors divide symmetrically, giving rise to two follower cells (87 ± 27 µm2; Figure 8C and D). We also noticed that the leader progenitors’ divisions are spatially restricted to the anterior quarter of the premigratory area in each segment, while the followers’ progenitor divisions take place across the premigratory area (Figure 8E).
Figure 8.
Leaders arise from the asymmetric division of a progenitor cell and present characteristic division patterns.
(A) Selected frames from in vivo imaging of leaders’ progenitor division in FoxD3:mCherry;H2aFVA:H2a-GFP embryos. (B) Area of leaders’ progenitor daughter cells (n = 9 cells, seven embryos; Mann–Whitney U-test, p=0.0056). (C) Selected frames from in vivo imaging of followers’ progenitor division in FoxD3:mCherry;H2aFVA:H2a-GFP embryos. (D) Area of followers’ progenitor daughter cells (n = 10, four embryos; Mann–Whitney U-test, p>0.9999). (E) Position of progenitors’ divisions on model embryo (leaders n = 9, seven embryos; followers n = 10, four embryos). PM, premigratory area; NT/not, neural tube/notochord boundary. (F) Selected frames showing the D>M division pattern from 16 to 28 hpf in vivo imaging of a Sox10:mG embryo. Blue, before division; yellow and red, after division. Arrow indicates division position. (G) Selected frames showing the M>D division pattern from 16 to 28 hpf in vivo imaging of a Sox10:mG embryo. Labelling as in (F). (H) Quantification of leaders’ (n = 21, seven embryos) and follower’s division patterns (n = 43, seven embryos). Red, M>D; black, D>M. (I) Quantification of division positions (n = 13 leaders, n = 19 followers, seven embryos; Mann–Whitney U-test, p=0.0002). Time in minutes. Leaders in magenta, followers in cyan. Anterior left, dorsal top.
3D rotation and volume reconstruction of a FoxD3:mCherry;H2aFVA:H2a-GFP specimen at 18 hpf showing the daughter cells of a leader progenitor, the prospective leader in yellow, and its sibling a prospective follower in cyan. Related to Figure 8.
M>D time lapse of Sox10:mG embryo from 16 to 23 hpf, showing a leader cell dividing during migration. D>M time lapse of Sox10:mG from 16 to 28 hpf, showing a follower cell dividing before migration initiation. Tracks before division in blue, after division in red and yellow. Arrows indicate divisions. Imaged from 16 to 28 hpf. Related to Figure 8.
Figure 8—video 1.
Leader cells arise from the asymmetric division of a progenitor cell.
3D rotation and volume reconstruction of a FoxD3:mCherry;H2aFVA:H2a-GFP specimen at 18 hpf showing the daughter cells of a leader progenitor, the prospective leader in yellow, and its sibling a prospective follower in cyan. Related to Figure 8.
Leaders arise from the asymmetric division of a progenitor cell and present characteristic division patterns.
(A) Selected frames from in vivo imaging of leaders’ progenitor division in FoxD3:mCherry;H2aFVA:H2a-GFP embryos. (B) Area of leaders’ progenitor daughter cells (n = 9 cells, seven embryos; Mann–Whitney U-test, p=0.0056). (C) Selected frames from in vivo imaging of followers’ progenitor division in FoxD3:mCherry;H2aFVA:H2a-GFP embryos. (D) Area of followers’ progenitor daughter cells (n = 10, four embryos; Mann–Whitney U-test, p>0.9999). (E) Position of progenitors’ divisions on model embryo (leaders n = 9, seven embryos; followers n = 10, four embryos). PM, premigratory area; NT/not, neural tube/notochord boundary. (F) Selected frames showing the D>M division pattern from 16 to 28 hpf in vivo imaging of a Sox10:mG embryo. Blue, before division; yellow and red, after division. Arrow indicates division position. (G) Selected frames showing the M>D division pattern from 16 to 28 hpf in vivo imaging of a Sox10:mG embryo. Labelling as in (F). (H) Quantification of leaders’ (n = 21, seven embryos) and follower’s division patterns (n = 43, seven embryos). Red, M>D; black, D>M. (I) Quantification of division positions (n = 13 leaders, n = 19 followers, seven embryos; Mann–Whitney U-test, p=0.0002). Time in minutes. Leaders in magenta, followers in cyan. Anterior left, dorsal top.
Leader cells arise from the asymmetric division of a progenitor cell.
3D rotation and volume reconstruction of a FoxD3:mCherry;H2aFVA:H2a-GFP specimen at 18 hpf showing the daughter cells of a leader progenitor, the prospective leader in yellow, and its sibling a prospective follower in cyan. Related to Figure 8.
Leader and follower cells present distinct division patterns.
M>D time lapse of Sox10:mG embryo from 16 to 23 hpf, showing a leader cell dividing during migration. D>M time lapse of Sox10:mG from 16 to 28 hpf, showing a follower cell dividing before migration initiation. Tracks before division in blue, after division in red and yellow. Arrows indicate divisions. Imaged from 16 to 28 hpf. Related to Figure 8.We then reasoned that leader cells, being bigger, may undergo the next division in a shorter time span than follower cells, and in consequence, mitotic figures would be observed at different, but consistent, positions in their trajectory. Indeed, we found two different patterns of divisions in respect to migration: (1) cells that first Divide and then Migrate (D→M) or (2) cells that first Migrate and then Divide (M→D; Figure 8F and G, Figure 8—video 2). Interestingly, we found that the patterns of cell division correlate with cell identity. Most leader cells divide during migration (M→D: 86%), while the bulk of follower cells divide before migration initiation (D→M: 90%, Figure 8H). These patterns result in leader and follower cells dividing at distinct positions, 74% of leaders divide at the NT/not boundary (65.3 ± 9.6 µm), while 85% of followers divide mostly within the premigratory area or in the dorsal-most region of the somite (42 ± 12.4 µm; Figure 8I). Together, these results show that leader cells arise from the asymmetric division of a progenitor. Thereafter, leader and follower cells show distinct locations and patterns of division, suggesting that leaders and followers progress asynchronously through the cell cycle, which may influence their migratory behaviour.
Figure 8—video 2.
Leader and follower cells present distinct division patterns.
M>D time lapse of Sox10:mG embryo from 16 to 23 hpf, showing a leader cell dividing during migration. D>M time lapse of Sox10:mG from 16 to 28 hpf, showing a follower cell dividing before migration initiation. Tracks before division in blue, after division in red and yellow. Arrows indicate divisions. Imaged from 16 to 28 hpf. Related to Figure 8.
Cell cycle progression is required for TNC migration
To test the role of cell cycle progression in TNC migration directly, we used inhibitory drugs. The S-phase inhibitor aphidicolin blocks over 94.7% ± 4.5% of mitotic figures after 3 hr of treatment, while the G2/M inhibitor genistein prevents 90% ± 10% of divisions within 6 hr, but neither treatment affects NC induction (Figure 9—figure supplement 1). Inhibition of cell cycle progression by either of the treatments resulted in reduced numbers of migratory chains and decreased ventral advance (control 19 ± 2, genistein 10 ± 3, aphidicolin 6 ± 2 chains; Figure 9A–H). This result was not due to the loss of cell motility as premigratory TNC cells actively extend protrusions and move along the anteroposterior axis but are unable to migrate ventrally (Figure 9—video 1). Importantly, these effects were not a consequence of cell death or the permanent impairment of motility as TNC reinitiate migration and form new chains upon drug withdrawal (Figure 9G and H), showing that active cell cycle progression is required for migration. Next, we directly analysed TNC cell cycle progression in vivo. To this end, we imaged Sox10:FUCCI embryos (Rajan and Gallik, 2018), in which TNC nuclei are RFP-labelled during G1 and GFP-labelled during S and G2. Tracking analysis shows differential cell cycle progression, with most leader cells initiating migration in S-phase (79%), while followers start movement during G1 (77%; Figure 9I and J, Figure 9—video 2). These results show that cell cycle progression is required for migration and that leader and follower cells initiate movement at different points of the cell cycle, suggesting an intimate connection between cell growth and movement.
Figure 9—figure supplement 1.
Cell cycle inhibitor drugs working conditions.
(A) Confocal images showing nuclei and mitotic figures in control (DMSO) and aphidicolin treated H2aFVA:H2a-GFP embryos. Arrowheads indicate mitotic figures; dashed lines mark the neural tube borders. Dorsal view, anterior to the left. (B) Percentage of mitotic figures in control (DMSO-treated embryos) and embryos treated with different concentrations of cell cycle inhibitors (Kruskal–Wallis test, p<0.0001, aphidicolin n = 20 and genistein n = 32; teniposide p>0.9999, n = 27). (C) Time course of the effect of cell cycle drugs (Kruskal–Wallis test, control vs. 1 hr aphidicolin p=0.0007; control vs. 3 hr, 5 hr, and 7 hr aphidicolin p<0.0001; control vs. 2 hr, 3 hr, and 5 hr genistein p>0.0892; control vs. 6 hr genistein p<0.0001; control n = 62 embryos; aphidicolin 1 hr n = 16, aphidicolin 3 hr n = 15, aphidicolin 5 hr n = 16, aphidicolin 7 hr n = 15; genistein 2 hr n = 15, genistein 3 hr n = 16, genistein 5 hr n = 17, genistein 6 hr n = 16). (D) Quantification of cell cycle recovery times following aphidicolin removal (control n = 21; aphidicolin 8 hr n = 18, aphidicolin 4 + 2 hr wash n = 15, 4 + 3 hr wash n = 15 and 4 + 4 hr wash n = 15 embryos; one-way ANOVA, control vs. 8 hr and 4 + 2 hr wash p<0.0001; control vs. 4 + 3 hr wash and 4 + 4 hr wash p>0.0851). (E, F) Whole-mount in situ hybridisation of the neural crest (NC) marker crestin in 16 hpf embryos upon (E) aphidicolin and (F) DMSO treatment from 12 hpf. Anterior to the left, dorsal top. (G, H) Selected frames of in vivo imaging from Sox10:mG embryos showing cell tracks under (G) control (DMSO) 16–28 hpf and (H) aphidicolin 16–33 hpf treatment. Solid line indicates the dorsal midline, dashed line the premigratory area; time in minutes. (I) Quantification of the number of trunk neural crest (TNC) cells per three migratory chains under control, Notch gain of function (GOF) and loss of function (LOF) conditions at either 16 hpf (control n = 25 embryos; GOF n = 21; LOF n = 14) and 22–24 hpf (control n = 18 embryos; GOF n = 18; LOF n = 9). Brown–Forsythe and Welch’s ANOVA tests, 16 hpf: control vs. GOF p>0.9999, control vs. LOF p=0.9976, GOF vs. LOF p=0.9942; 22–24 hpf: control vs. GOF p=0.8985, control vs. LOF p=0.5940, GOF vs. LOF p=0.3892.
Figure 9.
Cell cycle progression is required for trunk neural crest (TNC) migration.
(A, C, E) crestin in situ hybridisation upon (A) DMSO, (C) genistein, or (E) aphidicolin treatment from 12 to 24 hpf. (B, D, F) Enlargement of areas indicated by boxes in (A, C, E). Dotted line marks NT/not boundary, arrowheads migratory chains, and vertical line the chain length. (G, H) Frequency distribution of migratory chains upon control (DMSO; n = 66), (G) genistein (12 hr pulse, n = 56; 6 hr pulse, n = 67), or (H) aphidicolin (12 hr, n = 64; 3 hr, n = 79). (I) Cell cycle phase at migration initiation for leaders (n = 38, four embryos) and followers (n = 43, four embryos). (J) Selected framed from in vivo imaging of Sox10:FUCCI. Time in minutes. Solid line marks dorsal midline, dotted line marks the premigratory area. Magenta arrowheads indicate leader and its daughters. Cyan arrowheads indicate followers.
(A) Confocal images showing nuclei and mitotic figures in control (DMSO) and aphidicolin treated H2aFVA:H2a-GFP embryos. Arrowheads indicate mitotic figures; dashed lines mark the neural tube borders. Dorsal view, anterior to the left. (B) Percentage of mitotic figures in control (DMSO-treated embryos) and embryos treated with different concentrations of cell cycle inhibitors (Kruskal–Wallis test, p<0.0001, aphidicolin n = 20 and genistein n = 32; teniposide p>0.9999, n = 27). (C) Time course of the effect of cell cycle drugs (Kruskal–Wallis test, control vs. 1 hr aphidicolin p=0.0007; control vs. 3 hr, 5 hr, and 7 hr aphidicolin p<0.0001; control vs. 2 hr, 3 hr, and 5 hr genistein p>0.0892; control vs. 6 hr genistein p<0.0001; control n = 62 embryos; aphidicolin 1 hr n = 16, aphidicolin 3 hr n = 15, aphidicolin 5 hr n = 16, aphidicolin 7 hr n = 15; genistein 2 hr n = 15, genistein 3 hr n = 16, genistein 5 hr n = 17, genistein 6 hr n = 16). (D) Quantification of cell cycle recovery times following aphidicolin removal (control n = 21; aphidicolin 8 hr n = 18, aphidicolin 4 + 2 hr wash n = 15, 4 + 3 hr wash n = 15 and 4 + 4 hr wash n = 15 embryos; one-way ANOVA, control vs. 8 hr and 4 + 2 hr wash p<0.0001; control vs. 4 + 3 hr wash and 4 + 4 hr wash p>0.0851). (E, F) Whole-mount in situ hybridisation of the neural crest (NC) marker crestin in 16 hpf embryos upon (E) aphidicolin and (F) DMSO treatment from 12 hpf. Anterior to the left, dorsal top. (G, H) Selected frames of in vivo imaging from Sox10:mG embryos showing cell tracks under (G) control (DMSO) 16–28 hpf and (H) aphidicolin 16–33 hpf treatment. Solid line indicates the dorsal midline, dashed line the premigratory area; time in minutes. (I) Quantification of the number of trunk neural crest (TNC) cells per three migratory chains under control, Notch gain of function (GOF) and loss of function (LOF) conditions at either 16 hpf (control n = 25 embryos; GOF n = 21; LOF n = 14) and 22–24 hpf (control n = 18 embryos; GOF n = 18; LOF n = 9). Brown–Forsythe and Welch’s ANOVA tests, 16 hpf: control vs. GOF p>0.9999, control vs. LOF p=0.9976, GOF vs. LOF p=0.9942; 22–24 hpf: control vs. GOF p=0.8985, control vs. LOF p=0.5940, GOF vs. LOF p=0.3892.
Time lapse of control (DMSO treated) Sox10:mG embryo from 16 to 23 hpf, and aphidicolin-treated Sox10:mG embryo from 16 to 30 hpf. Leaders tracked in yellow, followers tracked in cyan and white. Time in minutes. Related to Figure 9 and Figure 9—figure supplement 1.
Representative time lapse of Sox10:FUCCI from 16 to 18 hpf showing leaders initiate migration in S-phase, while followers emigrate in G1. Magenta arrowheads indicate the leader and its daughter cells; cyan arrowhead indicate follower cells. Time in minutes. Related to Figure 9 and Figure 9—figure supplement 1.
Figure 9—video 1.
Cell cycle progression is required for trunk neural crest (TNC) migration.
Time lapse of control (DMSO treated) Sox10:mG embryo from 16 to 23 hpf, and aphidicolin-treated Sox10:mG embryo from 16 to 30 hpf. Leaders tracked in yellow, followers tracked in cyan and white. Time in minutes. Related to Figure 9 and Figure 9—figure supplement 1.
Figure 9—video 2.
Leader and follower cells initiate migration at different phases of the cell cycle.
Representative time lapse of Sox10:FUCCI from 16 to 18 hpf showing leaders initiate migration in S-phase, while followers emigrate in G1. Magenta arrowheads indicate the leader and its daughter cells; cyan arrowhead indicate follower cells. Time in minutes. Related to Figure 9 and Figure 9—figure supplement 1.
Cell cycle progression is required for trunk neural crest (TNC) migration.
(A, C, E) crestin in situ hybridisation upon (A) DMSO, (C) genistein, or (E) aphidicolin treatment from 12 to 24 hpf. (B, D, F) Enlargement of areas indicated by boxes in (A, C, E). Dotted line marks NT/not boundary, arrowheads migratory chains, and vertical line the chain length. (G, H) Frequency distribution of migratory chains upon control (DMSO; n = 66), (G) genistein (12 hr pulse, n = 56; 6 hr pulse, n = 67), or (H) aphidicolin (12 hr, n = 64; 3 hr, n = 79). (I) Cell cycle phase at migration initiation for leaders (n = 38, four embryos) and followers (n = 43, four embryos). (J) Selected framed from in vivo imaging of Sox10:FUCCI. Time in minutes. Solid line marks dorsal midline, dotted line marks the premigratory area. Magenta arrowheads indicate leader and its daughters. Cyan arrowheads indicate followers.
Cell cycle inhibitor drugs working conditions.
(A) Confocal images showing nuclei and mitotic figures in control (DMSO) and aphidicolin treated H2aFVA:H2a-GFP embryos. Arrowheads indicate mitotic figures; dashed lines mark the neural tube borders. Dorsal view, anterior to the left. (B) Percentage of mitotic figures in control (DMSO-treated embryos) and embryos treated with different concentrations of cell cycle inhibitors (Kruskal–Wallis test, p<0.0001, aphidicolin n = 20 and genistein n = 32; teniposide p>0.9999, n = 27). (C) Time course of the effect of cell cycle drugs (Kruskal–Wallis test, control vs. 1 hr aphidicolin p=0.0007; control vs. 3 hr, 5 hr, and 7 hr aphidicolin p<0.0001; control vs. 2 hr, 3 hr, and 5 hr genistein p>0.0892; control vs. 6 hr genistein p<0.0001; control n = 62 embryos; aphidicolin 1 hr n = 16, aphidicolin 3 hr n = 15, aphidicolin 5 hr n = 16, aphidicolin 7 hr n = 15; genistein 2 hr n = 15, genistein 3 hr n = 16, genistein 5 hr n = 17, genistein 6 hr n = 16). (D) Quantification of cell cycle recovery times following aphidicolin removal (control n = 21; aphidicolin 8 hr n = 18, aphidicolin 4 + 2 hr wash n = 15, 4 + 3 hr wash n = 15 and 4 + 4 hr wash n = 15 embryos; one-way ANOVA, control vs. 8 hr and 4 + 2 hr wash p<0.0001; control vs. 4 + 3 hr wash and 4 + 4 hr wash p>0.0851). (E, F) Whole-mount in situ hybridisation of the neural crest (NC) marker crestin in 16 hpf embryos upon (E) aphidicolin and (F) DMSO treatment from 12 hpf. Anterior to the left, dorsal top. (G, H) Selected frames of in vivo imaging from Sox10:mG embryos showing cell tracks under (G) control (DMSO) 16–28 hpf and (H) aphidicolin 16–33 hpf treatment. Solid line indicates the dorsal midline, dashed line the premigratory area; time in minutes. (I) Quantification of the number of trunk neural crest (TNC) cells per three migratory chains under control, Notch gain of function (GOF) and loss of function (LOF) conditions at either 16 hpf (control n = 25 embryos; GOF n = 21; LOF n = 14) and 22–24 hpf (control n = 18 embryos; GOF n = 18; LOF n = 9). Brown–Forsythe and Welch’s ANOVA tests, 16 hpf: control vs. GOF p>0.9999, control vs. LOF p=0.9976, GOF vs. LOF p=0.9942; 22–24 hpf: control vs. GOF p=0.8985, control vs. LOF p=0.5940, GOF vs. LOF p=0.3892.Time lapse of control (DMSO treated) Sox10:mG embryo from 16 to 23 hpf, and aphidicolin-treated Sox10:mG embryo from 16 to 30 hpf. Leaders tracked in yellow, followers tracked in cyan and white. Time in minutes. Related to Figure 9 and Figure 9—figure supplement 1.
Leader and follower cells initiate migration at different phases of the cell cycle.
Representative time lapse of Sox10:FUCCI from 16 to 18 hpf showing leaders initiate migration in S-phase, while followers emigrate in G1. Magenta arrowheads indicate the leader and its daughter cells; cyan arrowhead indicate follower cells. Time in minutes. Related to Figure 9 and Figure 9—figure supplement 1.
Leader and follower cells progress through the cell cycle at different rates
Next, we studied TNC cell cycle progression in detail. First, we asked whether leaders and followers differ in the total length of their cell cycle. Measurements of the time span between two consecutive mitoses showed no significant differences in the total length of the cell cycle between leaders and followers (13.6 ± 1.2 and 13.3 ± 1.4 hr, respectively; Figure 10B). Next, we examined the length of each phase of the cell cycle by imaging the characteristic nuclear labelling pattern of the PCNA-GFP fusion protein (Leung et al., 2011). Sox10:Kalt4 embryos, in which all NC can be recognised by nuclear RFP expression, were injected with PCNA-GFP mRNA and live imaging was performed. PCNA-GFP shows uniform nuclear GFP labelling during G1, intense fluorescent nuclear puncta characterise the S-phase, these puncta dissipate during G2 restoring homogeneous nuclear fluorescence, at the onset of mitosis PCNA is degraded and TNC are recognised solely by nuclear RFP (Figure 10A, Figure 10—video 1). In these embryos, leader cells initiate migration during S-phase and followers in G1, confirming our FUCCI results and establishing that PCNA overexpression does not introduce artefacts to cell cycle progression (Figure 10—figure supplement 1). Using this tool, we measured the length of the cell cycle phases in TNC. We found striking differences in the time spent in G1- and S-phase between leader and follower cells. Leaders present a short G1 (3.2 ± 0.6 hr) but remain for twice as long in S-phase (8.7 ± 1.3 hr). Followers, on the other hand, present the opposite distribution, remaining for twice as long in G1 (7.4 ± 2.7 hr) than in S-phase (4.6 ± 2.8 hr; Figure 10C and D). No significant differences were observed in the length of G2 (leaders 1.6 ± 0.4 hr; followers 1.5 ± 0.3 hr) or M (leaders 0.6 ± 0.1 hr; followers 0.5 ± 0.1 hr). These data show that leader and follower cells present marked differences in the length of G1- and S-phase, suggesting that cell cycle progression may regulate their migratory behaviour.
Figure 10.
Leader and follower cells progress through the cell cycle at different rates.
(A) Selected frames from in vivo imaging of Sox10:Kalt4 embryos from 16 to 28 hpf injected with PCNA-GFP mRNA. White arrow points to cycling cell. Time in minutes. (B) Quantification of the cell cycle total duration in leaders (n = 20, seven embryos) and followers (n = 19, seven embryos; unpaired t-test, p=0.5240). (C) Quantification of the cell cycle phases duration in leaders (G1 n = 45, S n = 44, G2 n = 33 and M n = 32, 11 embryos) and followers (G1 n = 50, S n = 48, G2 n = 33 and M n = 34, 11 embryos). Brown–Forsythe and Welch’s ANOVA tests, G1 p<0.0001, S p<0.0001, G2 p=0.9997, M p=0.9231. (D) Schematic representation of the cell cycle phases durations.
(A, B) Selected frames of in vivo imaging from Sox10:Kalt4 embryos injected with PCNA-GFP mRNA, showing PCNA localisation in trunk neural crest (TNC). (A) Leader cell initiates migration in S-phase. (B) Follower cell divides before initiating migration in G1. Solid lines indicate embryo dorsal border, dotted lines the somite borders, segmented line the premigratory ventral border. Time in minutes. Anterior to the left, dorsal up. (C) Quantification of the cell cycle phase at which cells initiate migration in PCNA-GFP mRNA injected embryos (leaders n = 22, 10 embryos; followers n = 45, 10 embryos). (D) Quantification of the cell cycle phase at which cells initiate migration in Sox10:FUCCI embryos (leaders n = 38, four embryos; followers n = 43, four embryos).
Time lapse of PCNA-GFP mRNA-injected Sox10:Kalt4 embryo from 20 to 27.6 hpf. Left, raw image; right, the same image showing only RFP+ TNC. Time in minutes. Related to Figures 10 and 11 and Figure 9—figure supplement 1.
Figure 10—video 1.
PCNA-GFP reveals the cell cycle dynamics in trunk neural crest (TNC).
Time lapse of PCNA-GFP mRNA-injected Sox10:Kalt4 embryo from 20 to 27.6 hpf. Left, raw image; right, the same image showing only RFP+ TNC. Time in minutes. Related to Figures 10 and 11 and Figure 9—figure supplement 1.
Figure 10—figure supplement 1.
Leader and follower cells initiate migration at distinct cell cycle phases.
(A, B) Selected frames of in vivo imaging from Sox10:Kalt4 embryos injected with PCNA-GFP mRNA, showing PCNA localisation in trunk neural crest (TNC). (A) Leader cell initiates migration in S-phase. (B) Follower cell divides before initiating migration in G1. Solid lines indicate embryo dorsal border, dotted lines the somite borders, segmented line the premigratory ventral border. Time in minutes. Anterior to the left, dorsal up. (C) Quantification of the cell cycle phase at which cells initiate migration in PCNA-GFP mRNA injected embryos (leaders n = 22, 10 embryos; followers n = 45, 10 embryos). (D) Quantification of the cell cycle phase at which cells initiate migration in Sox10:FUCCI embryos (leaders n = 38, four embryos; followers n = 43, four embryos).
Leader and follower cells progress through the cell cycle at different rates.
(A) Selected frames from in vivo imaging of Sox10:Kalt4 embryos from 16 to 28 hpf injected with PCNA-GFP mRNA. White arrow points to cycling cell. Time in minutes. (B) Quantification of the cell cycle total duration in leaders (n = 20, seven embryos) and followers (n = 19, seven embryos; unpaired t-test, p=0.5240). (C) Quantification of the cell cycle phases duration in leaders (G1 n = 45, S n = 44, G2 n = 33 and M n = 32, 11 embryos) and followers (G1 n = 50, S n = 48, G2 n = 33 and M n = 34, 11 embryos). Brown–Forsythe and Welch’s ANOVA tests, G1 p<0.0001, S p<0.0001, G2 p=0.9997, M p=0.9231. (D) Schematic representation of the cell cycle phases durations.
Leader and follower cells initiate migration at distinct cell cycle phases.
(A, B) Selected frames of in vivo imaging from Sox10:Kalt4 embryos injected with PCNA-GFP mRNA, showing PCNA localisation in trunk neural crest (TNC). (A) Leader cell initiates migration in S-phase. (B) Follower cell divides before initiating migration in G1. Solid lines indicate embryo dorsal border, dotted lines the somite borders, segmented line the premigratory ventral border. Time in minutes. Anterior to the left, dorsal up. (C) Quantification of the cell cycle phase at which cells initiate migration in PCNA-GFP mRNA injected embryos (leaders n = 22, 10 embryos; followers n = 45, 10 embryos). (D) Quantification of the cell cycle phase at which cells initiate migration in Sox10:FUCCI embryos (leaders n = 38, four embryos; followers n = 43, four embryos).
PCNA-GFP reveals the cell cycle dynamics in trunk neural crest (TNC).
Time lapse of PCNA-GFP mRNA-injected Sox10:Kalt4 embryo from 20 to 27.6 hpf. Left, raw image; right, the same image showing only RFP+ TNC. Time in minutes. Related to Figures 10 and 11 and Figure 9—figure supplement 1.
(A) Quantification of the cell cycle total duration under control (DMSO, numbers as in Figure 10B) and Notch inhibition conditions (CompE, leaders n = 17, followers n = 22, eight embryos; one-way ANOVA, p=0.1939). (B) Quantification of the cell cycle phases duration under DMSO (numbers as in Figure 10C) and Notch inhibition conditions CompE, leaders G1 n = 29, S n = 28, G2 n = 25, and M n = 25, seven embryos; followers G1 n = 32, S n = 32, G2 n = 30, and M n = 30, seven embryos; Brown–Forsythe and Welch’s ANOVA tests, all phases G1, S, G2, and M p>0.9999 between leaders and followers. (C) Quantification of cell area ratio (leaders/followers) under DMSO and Notch-inhibited conditions (n as in D; Brown–Forsythe and Welch’s ANOVA tests, DMSO control vs. CompE p= 0.0157). (D) Quantification of cell area under DMSO (leaders n = 26, followers n = 22, six embryos) and CompE conditions (leaders n = 44, followers n = 41, seven embryos). Brown–Forsythe and Welch’s ANOVA tests, DMSO leaders vs. followers p<0.0001, CompE leaders vs. followers p>0.9999. (E, F) Frequency distribution of G1- and S-phases durations in control conditions (DMSO; leaders: G1 n = 45, S n = 44, 11 embryos; followers: G1 n = 50, S n = 48, 11 embryos). (G, H) Frequency distribution of G1- and S-phases durations in Notch inhibition conditions (CompE; leaders: G1 n = 29, S n = 28, seven embryos; followers: G1 n = 32, S n = 32, seven embryos). (I–N) Images of phox2bb expression in 24 hpf Sox10:GFP embryo. (K–N) Enlargements of follower 3 and leader cells in (I, J). Orange dotted lines mark leader and third follower cell outline; white dotted lines mark followers' outline.
Our data show that Notch signalling allocates leader and follower identities, cell cycle progression is necessary for TNC migration, and leader and follower cells progress through the cell cycle at different rates. Does Notch signalling regulate cell cycle progression, thus differentiating leader from follower cells? To investigate this question, we measured the total length of the cell cycle and the length of each phase under control and Notch-inhibited conditions. Neither the total cell cycle length (Figure 11A) nor the number of TNC (Figure 9—figure supplement 1) were affected by alterations of Notch signalling. Remarkably, we found significant differences in the length of G1- and S-phase upon Notch inhibition. Leader cells lose their characteristic cell cycle progression pattern and behave as followers, with a long G1 and a short S-phase (Figure 11B). Furthermore, Notch inhibition abolishes the size difference between migratory leader and follower cells, with all cells presenting the average follower’s area (Figure 11C and D). These data show that Notch activity defines TNC migratory identity by regulating cell cycle progression, cells with low Notch activity remain for longer in G1 behaving as followers. Interestingly, we noticed that Notch inhibition also changes the cell cycle behaviour of the followers’ population. While the followers’ average length of cell cycle phases is not altered, the dispersion of this population is significantly reduced, with standard deviations cut almost by half (from 2.7 hr to 1.42 hr for G1 and from 2.8 hr to 1.38 hr for S; Figure 11B). This prompted us to analyse the frequency distribution of cell cycle phases length. In control conditions, leader cells show a normal distribution with a single peak for G1- and S-phase, as expected for a homogeneous population. Followers, on the other hand, present a bimodal distribution, with the smaller peak coinciding with that of leader cells, and accounting for 26% of followers in G1- and 31% in S-phase (Figure 11E and F). Strikingly, these results fulfil the predictions of our in silico model that best recapitulates TNC migration when chains are composed of leaders and followers in a 1:2 or 1:3 ratio. Furthermore, upon Notch inhibition the bimodal distribution of the follower population is lost, with all cells grouped at the major mean (Figure 11G and H). Consistent with these data, closer analysis (at higher magnification) of normal phox2bb expression shows increased expression in followers at position 3 in addition to that in leaders (Figure 11I–N). Taken all together, our data demonstrate that the levels of Notch activity in TNC allocate migratory identity by controlling cell cycle progression and that migratory chains are formed of one leader cell for every three followers.
(A) Quantification of the cell cycle total duration under control (DMSO, numbers as in Figure 10B) and Notch inhibition conditions (CompE, leaders n = 17, followers n = 22, eight embryos; one-way ANOVA, p=0.1939). (B) Quantification of the cell cycle phases duration under DMSO (numbers as in Figure 10C) and Notch inhibition conditions CompE, leaders G1 n = 29, S n = 28, G2 n = 25, and M n = 25, seven embryos; followers G1 n = 32, S n = 32, G2 n = 30, and M n = 30, seven embryos; Brown–Forsythe and Welch’s ANOVA tests, all phases G1, S, G2, and M p>0.9999 between leaders and followers. (C) Quantification of cell area ratio (leaders/followers) under DMSO and Notch-inhibited conditions (n as in D; Brown–Forsythe and Welch’s ANOVA tests, DMSO control vs. CompE p= 0.0157). (D) Quantification of cell area under DMSO (leaders n = 26, followers n = 22, six embryos) and CompE conditions (leaders n = 44, followers n = 41, seven embryos). Brown–Forsythe and Welch’s ANOVA tests, DMSO leaders vs. followers p<0.0001, CompE leaders vs. followers p>0.9999. (E, F) Frequency distribution of G1- and S-phases durations in control conditions (DMSO; leaders: G1 n = 45, S n = 44, 11 embryos; followers: G1 n = 50, S n = 48, 11 embryos). (G, H) Frequency distribution of G1- and S-phases durations in Notch inhibition conditions (CompE; leaders: G1 n = 29, S n = 28, seven embryos; followers: G1 n = 32, S n = 32, seven embryos). (I–N) Images of phox2bb expression in 24 hpf Sox10:GFP embryo. (K–N) Enlargements of follower 3 and leader cells in (I, J). Orange dotted lines mark leader and third follower cell outline; white dotted lines mark followers' outline.
Discussion
Collective migration plays an important role in embryogenesis, wound healing, and cancer. The acquisition of specific migratory identities has proven fundamental to angiogenesis, trachea development in Drosophila, and cancer metastasis. TNC migrate collectively, forming chains with a leader cell at the front of the group that direct the migration, while follower cells form the body of the chain that trails the leaders. TNC leader and follower identities are established before migration initiation and remain fixed thereafter (Richardson et al., 2016). Herein, we have addressed the mechanism that establishes leader and follower identities and can propose the following model (Figure 12): (A) premigratory TNC progenitors arise at the dorsal part of the neural tube. The leader’s progenitor divides asymmetrically, giving rise to a large prospective leader cell and a small sibling that migrates as a follower. Other progenitors divide symmetrically, giving rise to follower cells. (B) Interactions via Notch signalling results in the prospective leader cell accumulating higher levels of Notch activity, which induces phox2bb expression. (C) The combination of high Notch activity and a larger cell size prompts the prospective leader cell to rapidly undergo the G1/S transition, entering S-phase and initiating migration earlier than its follower siblings, which are smaller and initiate migration whilst in G1. (D) Premigratory cells that have not been in contact with the prospective leader cell or that have lost contact with it due to its ventral advance maintain communication with surrounding premigratory TNC through Notch and undergo a new round of leader cell selection. This working model of TNC migration is supported by both our experimental data and our in silico modelling, and provides a useful conceptual framework for future studies to build upon.
Figure 12.
Working model of trunk neural crest (TNC) migratory identity allocation through Notch-cell cycle interaction.
(A) Leader TNC progenitors divide asymmetrically giving rise to a prospective leader cell that is larger than the prospective followers that arise from symmetric divisions. (B) Interactions between TNC through Notch lateral inhibition establish higher levels of Notch activity in the bigger cell, triggering the initiation of S-phase and increased levels of phox2bb expression. (C) Leader cell initiated the chain movement while in S-phase trailed by followers in G1. (D) Loss of the leader contact with premigratory TNC allows for a new round of Notch interaction that establishes a second leader cell.
Working model of trunk neural crest (TNC) migratory identity allocation through Notch-cell cycle interaction.
(A) Leader TNC progenitors divide asymmetrically giving rise to a prospective leader cell that is larger than the prospective followers that arise from symmetric divisions. (B) Interactions between TNC through Notch lateral inhibition establish higher levels of Notch activity in the bigger cell, triggering the initiation of S-phase and increased levels of phox2bb expression. (C) Leader cell initiated the chain movement while in S-phase trailed by followers in G1. (D) Loss of the leader contact with premigratory TNC allows for a new round of Notch interaction that establishes a second leader cell.Notch signalling is a seemingly simple pathway that directly transduces receptor activation into changes in gene expression. Nevertheless, its outcomes in terms of cellular patterning are very diverse, from the generation of gene expression boundaries to temporal oscillations, or from the induction of similar fates in neighbouring cells to forcing adjacent cells into alternative fates. The latter function, known as lateral inhibition, is characterised by an intercellular negative feedback loop regulating the expression of Notch ligands. The activation of the Notch receptor in a ‘signal-receiving’ cell leads to the downregulation of Notch ligands expression, making it less able to act as a ‘signal-sending’ cell. The signature 2D patterning outcome of lateral inhibition is a mosaic of signal-sending cells with low Notch activity, surrounded by signal-receiving cells with high Notch levels. This is the case during the selection of sensory organ precursor cells in the epidermis of Drosophila (Lewis, 1998) or the formation of the mosaic of hair cells and supporting cells in the sensory organs of the inner ear (Daudet and Żak, 2020). In general, however, lateral inhibition operates among cells subjected to extensive rearrangements and its patterning outcome is not a salt-and-pepper mosaic of cells (Bocci et al., 2020). For example, during angiogenesis, cells with low Notch signalling become tip or leaders, while cells with high Notch activity differentiate as stalk or followers (Phng and Gerhardt, 2009). In this context, leaders are interspersed with various numbers of followers. Several models have been proposed to explain how signal-sending (leader/tip) cells can exert a long-lasting or long-range inhibition on signal-receiving (follower/stalk) cells. These take into account the modulation of Notch signalling that arise from heterogeneity in Notch receptor levels, tension, Notch-regulators, and interaction with other pathways (Bentley and Chakravartula, 2017; Hadjivasiliou et al., 2019; Koon et al., 2018; Kur et al., 2016; Venkatraman et al., 2016). Our data show that TNC deviate from the classical mosaic pattern, forming chains with one leader every two or three followers. Further studies will be required to define whether the aforementioned mechanisms are responsible for this architecture.In the case of the TNC, however, the most striking divergence from the classic lateral inhibition model (or indeed angiogenesis) is the fact that the leader cell identity is associated with higher intrinsic Notch activity. In other words, there are more signal-sending cells than signal-receiving cells. This apparent inversion in the ratio of the cell types produced is surprising. Explanation of this conundrum may arise from the fact that Notch lateral inhibition, dynamics and outcomes, can be modulated by ‘cis-inhibition’, a process whereby Notch ligands cell-autonomously interfere with the activation of Notch receptors (Bray, 2016; del Álamo et al., 2011). Computational models show that an increase in the strength of cis-inhibition can result in the inversion of the salt-and-pepper pattern (signal-sending to signal-receiving cells ratio), with the production of one cell with high Notch activity for every three cells with low Notch levels (Formosa-Jordan and Ibañes, 2014), a scenario that is congruent with the leader/follower ratio we observe in TNC. The detailed dynamics of lateral inhibition and whether cis-inhibition is at work in TNC remain to be investigated and will require direct visualisation at the single-cell level of Notch activity in live embryos.Our data show that active progression through the cell cycle is required for TNC migration. This is consistent with studies in chicken embryos, showing that progression through G1/S is required for TNC delamination, and that NC continue cycling as they migrate (Burstyn-Cohen and Kalcheim, 2002; Théveneau et al., 2007). Our data extend these findings by showing that leader and follower cells progress through the cell cycle at different rates. Leader cells, which are larger and more motile, initiate migration in S-phase and spend twice as long in this phase as followers. It is possible that these differences arise from the fact that leaders are larger than followers. It has been shown that the timing of G1/S transition depends on cell size and the dilution of the nuclear retinoblastoma protein (Zatulovskiy and Skotheim, 2020). Due to the larger volume of their cytoplasm, leader cells could be primed for a rapid G1/S phase transition. The initiation of S-phase may in turn enhance leaders’ migratory characteristics through the interaction of cyclins and cyclin/CDK inhibitors (CDKI) with small GTPases. Cyclins B and D have been shown to phosphorylate cytoskeleton regulators, resulting in increased cell migration and tumour invasion (Blethrow et al., 2008; Chen et al., 2020; Chi et al., 2008; Hirota et al., 2000; Li et al., 2006; Manes et al., 2003; Song et al., 2008; Zhong et al., 2010). Furthermore, Rac1 activity, which is required for migration, oscillates during the cell cycle being highest at S-phase when cells are most invasive (Kagawa et al., 2013; Walmod et al., 2004). CDKIs, on the other hand, interact with RhoA- and ROCK-enhancing motility (Bendris et al., 2015; Creff and Besson, 2020; Yoon et al., 2012). Interestingly, enhanced motility increases actin branching, which in turn can accelerate the G1/S transition (Molinie et al., 2019). These factors could therefore generate a positive feedback loop in which slightly larger leader cells are prone to undergo the G1/S transition, in turn the activation of S-phase cyclins and CDKIs may enhance motility, reinforcing S-phase initiation.Our data also show that TNC cell cycle progression is under the control of Notch signalling. Upon Notch inhibition, all TNC present cell cycle phase lengths typical of follower cells. Notch has been shown to regulate cell cycle in a context-dependent manner. Depending on the cell type, Notch can regulate cell cycle through the transcriptional induction of cyclins A and D, and the inhibition of CDKIs (Campa et al., 2008; Dabral et al., 2016; Ridgway et al., 2006; Rizzo et al., 2008; Rowan et al., 2008). Conversely, cell cycle progression can impact on Notch signalling. Notch activity is enhanced at the G1/S transition, while cells become refractory to Notch during G2/M (Ambros, 1999; Carrieri et al., 2019; Hunter et al., 2016; Nusser-Stein et al., 2012). Hence, the combination of large volumes and higher Notch activity levels could act synergistically to promote leaders’ G1/S transition.In this study, we have uncovered new functional interactions between Notch signalling, cell cycle dynamics, and the migratory behaviour of leader and follower cells in the TNC. These complex and intricate interactions, which remain to be fully characterised at a molecular level, could apply to other cell types exhibiting collective migration. For example, studies in cancer cell lines have shown that activation or inhibition of Notch signalling hinders migration, similar to what we observe in TNC (Konen et al., 2017), while the maintenance of collective migration depends on the regulation of cell proliferation during angiogenesis (Costa et al., 2016). In view of our work, it is important to revisit the assumption that migratory phenotypes are in conflict with cell cycle progression (Kohrman and Matus, 2017) and consider the possible implication for cancer therapies.
Materials and methods
Resource availability
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Claudia Linker (claudia.linker@kcl.ac.uk).
Materials availability
Newly generated materials from this study are available by request from the lead contact, Claudia Linker (claudia.linker@kcl.ac.uk), except for computational tools to be requested from Katie Bentley (katie.bentley@crick.ac.uk).
Data and code availability
The model code is accessible at https://github.com/Bentley-Cellular-Adaptive-Behaviour-Lab/NeuralCrestCpp, (copy archived at swh:1:rev:cdf63f3786390fb7905092717456cc69f5657ddc; Alhashem, 2022b). The code used to perform the LDA is accessible in the supplementary files. All numerical data used in the figures are accessible in the supplementary data source file.
Zebrafish lines and injections
Zebrafish were maintained in accordance with UK Home Office regulations UK Animals (Scientific Procedures) Act 1986, amended in 2013 under project licence P70880F4C. Embryos were obtained from the following strains: wild type, AB strain; Sox10:mG, Tg(–4.9sox10: Hsa.HIST1H2BJ-mCherry-2A-GLYPI-EGFP); Sox10:Fucci, Tg(–4.9sox10:mAGFP-gmnn-2A-mCherry-cdt1); hs:dnSu(H), vu21Tg (hsp70l:XdnSu(H)-myc); hs:Gal4, kca4Tg Tg(hsp70l:Gal4)1.5kca4 (1); UAS:NICD, Tg(UAS:myc-Notch1a-intra)kca3; Sox10:Kalt4, Tg(–4.9sox10: Hsa.HIST1H2BJ-mCherry-2A-Kalt4ER); UAS:dnSu(H), Tg(UAS:dnSu(H)-myc); Tg(h2afva:GFP)kca13; 12XNRE:egfp. Embryos were selected based on anatomical/developmental good health and the expression of fluorescent reporters when appropriate, split randomly between experimental groups and maintained at 28.5°C in E3 medium. Genotyping was performed by PCR of single embryos after imaging when required (UAS:NICD; UAS:dnSu(H); hs:dnSu(H)). Injections were carried at 1–4-cell stage with 30 pg of PCNA-GFP mRNA in a volume of 1 nl. mRNA was synthesised from pCS2 + PCNA GFP plasmid, kindly provided by C. Norden (IGC, Portugal), linearised with NotI and transcribed with the SP6 mMessage Machine Kit (Thermo Fisher Scientific, Cat# AM1340).
Live imaging and tracking
Imaging and analysis were carried out as in Alhashem et al., 2021. In short, embryos were mounted in 1% agarose/E3 medium plus 40 µM Tricaine. Segments 6–12 were imaged in lateral views every 5′ from 16 hpf for 16–18 hr in an upright PerkinElmer Ultraview Vox system using a ×40 water immersion objective. 70 μm z-stacks with 2 μm z-steps were obtained. Image stacks were corrected using Correct 3D Drift Fiji and single-cell tracking performed with View5D Fiji plugin. Tracks were displayed using the MTrackJ and Manual Tracking Fiji plugins. Cell area measurements were done in Fiji using the freehand selection tool to draw around cell membranes in 3D stacks using the orientation that best recapitulated the cell morphology (as in Richardson et al., 2016). Cell speed measurements were calculated from 3D tracks using the following formula: ((SQRT((X1-X2)^2+(Y1-Y2)^2+(Z1-Z2)^2))/T)*60, where X, Y, and Z are the physical coordinates and T is the time step between time-lapse frames. Ventral distances were measured in a straight line from dorsal edge of the embryo to the cell position at the end of the movie. Cell directionality measurements were calculated using a previously published Excel macro (Gorelik and Gautreau, 2014). Total duration of the cell cycle was measured between two mitotic events. Cell cycle phase duration were measured using the characteristic nuclear pattern of PCNA-GFP, in movies where only TNC (expressing RFP and GFP) are shown using this custom Fiji macro:macro "Segment Nuclei [s]" {
title = getTitle();
run("Split Channels");
selectWindow("C1-" + title); //select window with C1 in its name, nuclei should be C1
getDimensions(width, height, channelCount, slices, frames);
run("Subtract Background...", "rolling = 200 sliding stack");
setAutoThreshold("Default dark");
run("Threshold...");
setThreshold(5, 255); //change as appropriate for your cells
setOption("BlackBackground", false);
run("Convert to Mask", "method = Default background = Dark");
run("Close");
run("Fill Holes", "stack");
run("Despeckle", "stack");
run("Dilate", "stack");
run("Dilate", "stack");
//now go over every frame and slice
for(frame = 1; frame ≤ frames; frame++){
for(slice = 1; slice ≤ slices; slice++){
selectWindow("C1-" + title);
setSlice(slice);
Stack.setFrame(frame);
run("Create Selection");
selectWindow("C2-" + title);
setSlice(slice);
Stack.setFrame(frame);
run("Restore Selection");
setBackgroundColor(0, 0, 0);
run("Clear Outside", "slice");
In situ hybridisation, immunostaining, and sectioning
The whole-mount in situ hybridisation protocol was adapted from https://wiki.zfin.org/display/prot/Whole-Mount+In+Situ+Hybridization. In short, embryos were fixed overnight (O/N) in 4% paraformaldehyde (PFA), dehydrated in 100% methanol, then rehydrated, digested with proteinase K for different times depending on the stage and pre-hybridised for 2 hr at 65°C. Riboprobes were added, and embryos incubated at 65°C O/N. Probes were removed and embryos washed and equilibrated to PBS. Embryos were incubated in blocking solution for 2 hr and in anti-dig antibody O/N (Sigma-Aldrich, Cat# 11093274910), washed 5 × 30′ and NBT/BCIP colour reaction performed. Riboprobes for notch1a, dlb (deltaB), dld (deltaD), her4, cb1045 were kindly provided by J. Lewis (CRUK); crestin, mbp, bdh, myoD by S. Wilson (UCL, UK). After the in situ colour development, embryos were processed for sections, washed 5 × 10′ with PBS, embedded in OCT, frozen by dipping the blocks in dry ice-cold 70% ETOH, and sectioned to 12–15 μm using a cryostat. Sections were thawed at room temperature (RT), incubated with blocking solution for 30′ (10% goat serum, 2% BSA, 0.5% Triton, 10 mM sodium azide in PBS) and in anti-GFP antibody ON at 4°C (Merck Millipore, Cat# 06-896). Sections were washed with PBST 5 × 5′ (0.5% Triton-PBS) and incubated with secondary antibody for 2 hr at RT, mounted in ProLong Gold Antifade Mountant (Molecular Probes, Cat# P10144) and imaged. Whole-mount antibody staining was performed in embryos fixed for 2 hr in 4% PFA, washed 4 × 10′, incubated in blocking solution for 2 hr and in primary antibodies O/N at 4°C (anti-myc, Cell Signaling, Cat# 2276S; F59 and Znp1, Developmental Studies Hybridoma Bank; acetylated tubulin, Sigma-Aldrich, Cat# MABT868). Embryos were washed 5 × 30′, incubated in secondary antibodies O/N at 4°C, washed 6 × 30′, and mounted in 1% agarose for imaging. Imaging of sectioned and whole-mount antibody-stained samples was performed in PerkinElmer Ultraview Vox system.RNAScope (RNAscope Fluorescent Multiplex Reagent Kit, Cat# 320850) experiments were performed as in Alhashem et al., 2022a. In short, embryos were fixed with 4% PFA O/N at 4°C and dehydrated in 100% methanol and stored at –20°C until processing. All methanol was removed, and embryos were air dried at RT for 30′, permeabilised with Proteinase Plus for 10′ at RT (provided in kit), washed with PBS-Tween 0.01%, and incubated with probes for egfp and sox10 or phox2bb at 1:100 dilution at 60°C O/N. Probes were recovered, embryos washed three times with SSCT 0.2× for 15′. We followed manufacturer’s instructions for amplification steps AMP 1–3 and HRP C1–C4. Opal dyes 520, 570, and 650 (Akoya Biosciences, Cat# FP1487001KT, Cat# FP1488001KT, and Cat# FP1496001KT) were added at 1:3000 dilution followed by HRP blocker. Washes in between steps were performed with SSCT 0.2× for 10′ twice. Primary a-GFP-chicken (1:750) and a-RFP-rabbit (1:750; TFS, Cat# A10262, and MBL, Cat# PM005) antibodies diluted in blocking solution (PBS-Tween 0.1%, goat serum 5%, DMSO 1%) were added and incubated O/N at 4°C. Samples were washed three times in PBS-Tween 0.1% for 1 hr and then incubated in secondary antibodies, a-chicken-Alexa Fluor488 and a-rabbit-Alexa Fluor546 (TFS, Cat# A11039 and Cat# A11010) both in a 1:1000 dilution in blocking solution, for 3 hr at RT. Samples were washed six times with PBS-Tween 0.1% for 30′. For counterstaining, DAPI was added (1:1000) in the third wash (Roche, Cat# 10236276001, 2 mg/ml). Embryos were cleared in 50% glycerol/PBS an mounted in glass-bottom Petri dishes and imaged using Zeiss Laser Scanner Confocal Microscope 880 (405, 488, 514, 561, and 633 lasers).
Drug treatments and gene expression induction
Embryos were treated by adding cell cycle inhibitors to the media from 11 hpf and incubated for 3–12 hr at 28.5°C. 20 μM hydroxyurea (Sigma-Aldrich, Cat# H8627), 300 μM aphidicolin (Sigma-Aldrich, Cat# A0781), 100 μM genistein (Calbiochem, Cat# 345834), teniposide (Sigma-Aldrich, Cat# SML0609), or 1% DMSO as control (Sigma-Aldrich, Cat# D8418). Notch signalling was inhibited at 11 hpf by adding 100 μM DAPT (Sigma-Aldrich, Cat# D5942-25MG) or 50 μM of Compound E (Abcam, Cat# ab142164). The latter reagent was used to perform live imaging, which is difficult to do with DAPT as it generates an interfering precipitate. 1% DMSO was added as control. Gene expression was induced by addition of 2.5 μM of tamoxifen (Sigma-Aldrich, Cat#H7904) to the media at 11 hpf of Sox10:Kalt4 embryos, or by heat shock at 11 hpf in hs:Gal4 and hs:dnSu(H) embryos by changing the media to 39°C E3, followed by 1 hr incubation at this temperature, thereafter embryos were grown at 28.5°C to the desired stage.
Generation of UAS:dnSu(H) transgenic line
Using the Infusion cloning system (Takara), the following construct was inserted into the Ac/Ds vector (Chong-Morrison et al., 2018): 5xUAS sequence (Tol2Kit, http://tol2kit.genetics.utah.edu/index.php/Main_Page) flanked at the 3′ and 5′ ends by rabbit β-globin intron sequence. At the 3′ end, GFP followed by SV40polyA sequence was cloned to generate the Ac/Ds dUAS:GFP vector. The cmlc2:egfp transgenesis marker (Tol2Kit) was cloned after GFP in the contralateral strand to prevent interaction between the UAS and the cmnl sequences. The Xenopus dnSu(H)-myc sequence (Latimer et al., 2005) was cloned into the Ac/Ds dUAS:GFP vector at the 5′ end of the 5xUAS sequence, followed by the SV40polyA sequence (Figure 4—figure supplement 2). Transgenesis was obtained by injecting Sox10:Kalt4 embryos with 1 nl containing 50 pg of DNA plus 30 pg of Ac transposase mRNA at 1-cell stage. Embryos carrying the transgene were selected by heart GFP expression at 24 hpf. Upon Gal4ER activation by tamoxifen, dnSu(H)-myc protein was readily detected with anti-Myc antibody (Figure 4—figure supplement 2). GFP fluorescence driven by UAS was never observed.
Statistical analysis
All graphs and statistical analysis were carried out in GraphPad Prism 9. All numbers in the texts are mean ± standard deviation. Every sample was tested for normality using the d’Agostino–Pearson, followed by Shapiro–Wilk tests. Samples that passed both tests were compared using either unpaired two-tailed t-test or one-way ANOVA. Those without a normal distribution were compared through a Mann–Whitney U-test, Kruskal–Wallis test, or Brown–Forsythe and Welch’s ANOVA tests. For all analyses, p-values < 0.05 were deemed statistically significant, with ****p<0.0001, ***p<0.001, **p<0.01, and *p<0.05. Full statistical analysis of data in Figure 5 is presented in Supplementary file 1.
Computational model
The computational model used in this study is described in Appendix 1.Standard LDA was carried out using the sklearn package in Python (see supplementary code files).Using a combination of in vivo and in silico approaches, the authors have demonstrated how cell-fate decisions are orchestrated at the level of leader vs. follower cells in collective cell migration of trunk neural crest cells. They highlight the role of Notch signaling and cell cycle progression, showing how these traits differ between the leader and follower cells. The findings are of wide interest, as collective cell migration is a fundamental process critical for embryonic development as well as invasion of various cancers.In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.[Editors' note: this paper was reviewed by Review Commons.]Reviewer # 1:We are delighted that this reviewer finds that our work builds an elegant story that sets the stage and provides an effective conceptual framework for future explorations. Indeed, the reviewer points out the importance of TNC-environment interaction for migration, and we are actively working on this question in a follow-up manuscript. Beyond this, the reviewer does not raise any specific questions.Reviewer # 2:We are pleased that in the reviewer’s opinion we tackle important and challenging questions, she/he finds our study is well-designed and appreciates the interdisciplinary approach taken.1. In Figure 3F-H, the authors present how one parameter at a time (cell speed, cell directionality) is different for leader vs. follower in different scenarios. This is a good starting point for such analysis but does not reveal relative contributions or causal connection of these parameters to the leader-follower decision. The authors should perform some kind of dimension reduction analysis (PCA, LDA) to identify which changes in their model can trigger a transition from leader to follower or vice versa. Can these predictions be tested experimentally in the TNC? Moreover, the authors comment on the role of heterogeneity in these parameters to be able to recapitulate experimental observations. Is this heterogeneity essential in all parameters here?As suggested by the reviewer we performed a linear discriminant analysis (LDA). First, we analysed the in vivo data to assess the relative contribution of Speed, Directionality and Ventral distance to migratory identity. A random dataset drawn from a normal distribution was included as a negative control. Any association shown by LDA that is no greater than the random coefficient can be considered as irrelevant. Importantly, the LDA projection successfully separated the samples (Author response image 1A) with a classifier accuracy of 80% (defined as number of correct predictions/total predictions; Author response image 1B). The LDA coefficient shows that all three measurements (ventral distance, directionality and speed) have a positive association with cell type, in that order of importance (Author response image 1C). Next, we use LDA to interpret our model simulations. As for the in vivo case, LDA successfully separated the samples (Author response image 1D), but in this case with an elevated classifier accuracy of94% (Author response image 1E). In the case of the model, we could not directly use LDA to determine which were the most important parameters in determining migratory identities, as leader or follower types are assigned at the beginning of the simulations. Instead, as suggested by the reviewer, we analysed the importance of heterogeneity between leaders and followers for each of the model parameters. LDA shows that CIL intensity is the parameter that differs most between leader and follower cells, while heterogeneity is not essential for other parameters is the only parameter in which heterogeneity is essential to match in vivo behaviour (Author response image 1F). A summary of these data is now included in the Results section of the paper (page 7 line 31 onwards; Figure 7).
Author response image 1.
LDA results.
A. LDA leader/follower class separation of in vivo data. B. LDA leader/follower class separation of in-sillico data. C. LDA matrix of class separation confusion of in vivo data. D. LDA matrix of class separation confusion of in-sillico data. E. LDA coefficients of in vivo measurements. F. LDA coefficients of in-sillico parameters..
LDA results.
A. LDA leader/follower class separation of in vivo data. B. LDA leader/follower class separation of in-sillico data. C. LDA matrix of class separation confusion of in vivo data. D. LDA matrix of class separation confusion of in-sillico data. E. LDA coefficients of in vivo measurements. F. LDA coefficients of in-sillico parameters..2. The in-silico analysis suggests that more than one leader cell is required for TNC migration. Has this been demonstrated by authors earlier or previous studies to be true in the case of TNC?The requirement of more than one leader cell in the TNC chain is a novel prediction of the model that we developed. Previous studies have therefore not addressed this point. Nevertheless, our model is supported by the following experimental findings:A. In Figure 10 E-G the frequency distribution of the cell cycle phases’ lengths was analyzed. The follower population presents a bimodal distribution in which the minor mean coincides with the leader population mean, indicating the presence of leader cells within the follower population. Moreover, the percentage of cells that comprise the smaller peak (G1: 26% and S: 31%) is in accordance with the model prediction of a 1:2 or 1:3 leader/follower ratio in the chain. These results are described in the text.B. We have found Phox2bb to be strongly enriched in leader cells as well as being expressed by cells in the positions of follower 2 or 3. These data are included in Figure 11 of the manuscript.3. The authors claim that cell cycle progression is required for TNC migration, and that Notch signaling is crucial for cell cycle regulation. Which aspects of TNC migration are impacted upon perturbing cell cycle and/or Notch – is it contact inhibition of locomotion, group cohesion, cell overlap or a combination of them? This causal mechanistic connection seems lacking.Experiments presented in the paper show that inhibition of cell cycle progression halts TNC migration. Moreover, in vivo imaging of these embryos shows that perturbation of cell cycle progression does not affect motility but impairs TNC chain formation (Figure S4; Video S6). Together these data support the conclusion that cell cycle progression is required for TNC migration. Our manuscript also discusses at length the possible connections between cell cycle progression and cell migration, and how Notch signalling may regulate these processes concomitantly (Discussion, page 12 and 13).While we agree with the reviewers that understanding the direct mechanisms by which Notch and/or cell cycle progression regulate TNC migration is not only interesting but also important, such study will require an amount and depth of work that is beyond the scope of this already extensive study. For example, to understand which aspect of TNC migration is altered upon changing the cell cycle phases length, will require the generation of new transgenic lines in which the cell cycle phase lengths can be altered exclusively in NC cells with time control and, ideally, in a reversible manner. The generation and validation of such tools, followed by long term live imaging and analysis of migratory parameters at the single cell level, entails an amount of work that will provide a full new story and, most probably open new lines of investigation. We consider such an endeavour to be beyond the scope of the present manuscript.4. Do the authors observe no overtaking or exchange of leader and follower positions in TNC migration, as seen in Zhang et al. PNAS 2019, in absence of compound E treatment?Our previous work (Richardson et al., 2016) shows that TNC migration requires the establishment of leader and follower cells which differ in morphology and migratory parameters (leader cells always remain at the front of the chain, are larger, move faster and more directional than followers). Moreover, we have also shown that TNC migratory identities are established before migration initiation and are not interchangeable thereafter. In accord with our previous work, herein leader/follower exchanges are not observed in control conditions. We do not find it surprising that our results differ from the migratory behaviour reported by Zhang et al., as these studies were carried out in a different model system and under different experimental conditions. Our work was performed in vivo in zebrafish TNC, while Zhang et al. analysed breast cancer cell migration in vitro and ex vivo, with cells embedded in an artificial extracellular matrix. Hence, the different behaviours observed may be due to a combination of cell type specificity and the environment in which cells migrate. Having said that, our findings and those of Zhang et al. are not necessarily in contradiction. The fact that TNC leaders are not overtaken may be explained by differences in metabolism as demonstrated by Zhang et al. Their paper established that leader cells require high energy levels to retain the front position. As cells migrate the leader gradually depletes its available energy and is overtaken by a follower with higher energy levels. Our study showed that leader cells are larger than followers (Richardson et al., 2016), and that this difference is established at birth by the asymmetric division of a progenitor cell (Figure 8 A-D). It is conceivable that larger leader cells, which bear more mitochondria, do not deplete their energy during migration, and that followers that remain smaller do not attain the higher energy levels required to overtake the leader.Further, in cases of follower cells overtaking the leader cell as shown for compound E treatment, do cells also change their cell cycle status? If any, how and when does the cell division take place?Our data show that upon compound E treatment leader cells are unable to retain the front position being overtaken by followers (Figure 4 and 5, Video S1) and present the characteristic cell cycle profile of follower cells (Figure 11B). Taken together these data show that leader cells that are overtaken by followers do indeed change their cell cycle status. It is important to notice that Notch inhibition does not affect the total length of the cell cycle (Figure 11A; on average Control: 13.4h ± 1.3 hours; Notch Inhibition (CompE): 12.8h ± 1.6 hours), and in accord, the total number of TNC cells present in Notch gain and loss of function conditions is not significantly different from control conditions. We have now included these data in page 10, line 19 onwards and Figure S4.5. The authors discuss the role of Notch-Δ mediated lateral inhibition in ensuring a leader-follower commitment. Does the lateral induction mediated by Notch-Jagged signaling (Vilchez, Bocci et al. bioRxiv 2021) not interfere here? Have they measured Δ and Jagged levels in leader vs. follower cells in TNC to establish this claim?Our data show that Notch activity levels in TNCs define migratory identity. Communication through Notch lateral inhibition has been shown to define binary fate decisions in many systems. Hence, we hypothesized that migratory identity is allocated through Notch lateral inhibition, and we discuss at length the mechanisms and the modulators that may be responsible for generating the leader/follower ratio observed. Among the modulators that may play a role in this process, are the expression of more than one Notch receptor and the heterogeneity in their levels of expression among TNC (page 12, line 7 onwards).As the reviewer mentions we have not been able to measure the levels of Notch receptor expression in TNC. We agree that such an analysis is important and for this reason we invested considerable energy and resources to obtain these data, attempting in situ hybridization for Notch components and effectors (in sections and wholemount embryos), as well as analysis of the Her4:GFP reporter. However, none of these approaches produced fully satisfactory results due to the morphology of TNC cells, which are very thin and flat, and intermingled with other tissues (neural tube, somites, and epidermis) that presents high levels of Notch signalling. Prompted by the reviewers comments we have now analysed a new Notch reporter transgenic (Moro et al., 2013), and in these embryos clear differences in the levels of Notch activity between TNC can be observed (Figure 1). These data support our conclusions and are consistent with Notch lateral inhibition being the mechanism allocating TNC migratory identity. Considering that the concept of lateral induction is not required to explain our data and the absence of quantitative data on levels of Notch receptors, it is our opinion that introducing lateral induction in the discussion would be highly speculative and will lengthen and overcomplicate the manuscript.Reviewer # 3:The reviewer finds our study of wide interest, carefully done and finds our conclusions supported by the data presented. Nevertheless, she/he finds two moderately weak points: (1) there is no specific marker(s) to define leaders versus followers, and (2) the authors do not show expression of Notch pathway components. In the revised version of our manuscript, we address both of these points by analysing Phox2bb expression, a molecular marker of TNC leaders, and by studying Notch signalling levels in TNC using a Notch reporter line.Major commentsWhile, it does not appear that Notch signaling has been examined in the context of Trunk Neural Crest (TNC) migration in zebrafish, previous studies have examined the effects of Notch signaling in mice in regards to cardiac neural crest cell migration as well as neural crest cells that contribute to the enteric nervous system (Mead and Yutzey, 2012). Researchers found that either gain or loss of function lead to deficient neural crest cell migration in both contexts leading to a lack of neural crest cell contribution to the developing cardiac outflow tract and a neural crest ell deficiency in the ENS. Additionally, these researchers (Mead and Yutzey 2012) also examined the effects of Notch signaling on neural crest cell proliferation in mice and found a loss of Notch signaling results in decreased proliferation of NCC's in the DRG. Therefore, while this manuscript does go into greater depth than Mead and Yutzey did in 2012 specifically in regards to tracking cells in vivo the findings surrounding gross effects on migration and proliferation are entirely novel. These studies should be referenced in the introduction or discussion.We fully agree with the reviewer that the work by Mead et al., 2012 is important and, indeed, this work was cited in the introduction of our initial submission. This section has now been expanded.Figure S1: it is not possible to see whether any of these genes (with possible exception of her4) are really expressed in the TNC. It would benefit this study greatly if the authors can perform fluorescent in situs using one of their TNC transgenic lines to definitely show which Notch pathway members are expressed in leaders and followers. They are certainly capable of imaging the TNC at a single cell resolution (e.g., Figure 4 and Videos).As mentioned before (see reviewer# 2 point 5), the analysis of Notch components expression did not produce satisfactory results due to the morphology of TNC cells and the fact that these are intermingled with other tissues that present high levels of Notch signalling. Nevertheless, prompted by the reviewers comments we have added analysis of a Notch reporter line (Moro et al. 2012) that clearly shows differences in the levels of Notch activity between TNC (Figure 1). These data support our conclusions and are consistent with Notch lateral inhibition being the mechanism allocating TNC migratory identity.Figure 2: a better explanation to as to why the authors switched γ-secretase inhibitors would be valuable here.We thank the reviewer for pointing this out, the following explanation has now been added to the Material and Methods section. Page 20, line 33:-‘Notch signalling was inhibited at 11hpf by adding 100μM DAPT (Σ-Aldrich, Cat#D5942-25MG) or 50μM of Compound E (Abcam Cat#ab142164). The latter reagent was used to perform live imaging, which is difficult to do with DAPT as it generates an interfering precipitate.’-Figure 1 shows that the number of TNC chains is reduced following Notch inhibition. However, this mainly affects posterior TNC chains and the effect while significant is not great (especially in case of HS:Gal4xUAS:NICD). Is it because the inhibitor (heat-shock) was applied after the anterior TNC already initiated its migration? Does it take some time for these manipulations to take effect? The authors need a better explanation here.As the reviewer points out the induction and migration of anterior NC chains (up to somite 6, heart and vagal populations) is not affected by Notch signalling alterations. This may be due to these populations having different migratory mechanisms, not being sensitive to Notch signalling, and/or to the timing of the experiment, migration being underway when Notch was altered. In any case, heart and vagal NC do not form part of the TNC population in zebrafish (reviewed in Hutchins et al., 2018), and have not been analysed in our study. Our analysis confirms previous reports (Cornell and Eisen, 2000) showing that anterior NC induction is independent of Notch signalling (Figure 2). This explanation has now been added to the text. Moreover, our data show that Notch inhibition delays TNC migration at all antero-posterior levels of the trunk (from somites 6-29; Figure 3K, Figure 1K in the original manuscript).It is unknown whether zebrafish heart and/or vagal NC migrate collectively using similar mechanisms as TNC, or whether these are responsive to Notch signalling. Moreover, as the reviewer points out, there may be a time delay to attain full Notch inhibition, which may allow vagal NC to migrate unaffected. Full Notch inhibition is attained only 1h after treatment (chemical and heat shock inhibition, personal communication Guidicelli F. and Lewis J.; time delay of tamoxifen treatment shown in Figure S3F). As all experiments were performed at 12hpf, to avoid alterations to NC induction (Figure 2), full Notch inhibition only take place by 13hpf, time at which vagal NC migration is already underway (Raible et al., 1992).Figures 2 and 3: While I agree that Notch inhibition causes the leader cell to be unable to maintain its leader cell position, I do not completely agree with the implication that the "collective is now all followers". Specifically how can we be sure of this? What are the specific requirements for a cell to be labeled a "leader cell" versus a "follower cell"? Definitions of how the researchers characterize cells as leaders and followers are necessary. Ideally, the authors would have markers for leaders and follower; in not they should provide a better definition.– This explanation would also be helpful in the Notch GOF experiments in regards to live imaging of cell migration. Specifically, explaining the characteristics a leader and follower cell prior to explaining the results would more clearly support the researchers findings.Page 6 Line 40: Again, based on the above comment, the authors should be careful making this conclusion: "TNC with high Notch levels become leaders while cells with low Notch activity migrate as followers". There is no specific data showing that leaders have high levels of expression of Notch signaling via reporter expression or in situ hybridization for downstream signaling molecules and vice versa for followers.We addressed these issues in two different ways. First, as proposed by the reviewer, we have included definitions for TNC migratory identities in the text (page 4, line 43). Second, we use Phox2bb expression as a molecular marker for leader cells in Notch altered conditions. These data are shown in Figure 6 and confirm our previous conclusion that high Notch activity defines the leader identity.Page 10 Line 31-34: The fluorescent images shown in Figure 4A do not seem to indicate a difference in size of cells as depicted by the graph. A better example is necessary. Also, cell volume rather than cell area is much better indicator of cell size!We thank the reviewer for pointing out the fact that the picture shown in Figure 4A does not seem to indicate the difference in size quantified in Figure 4C. This is due to the fact that the prospective leader cell depicted in Figure 4A at 35min has an extension in the z plane (coming out of the page) that is not visible in the z projection shown. This is clearly observed in the 3D reconstruction of this stack that has now been added as Video S4. Nevertheless, the orientation of the picture in the figure has been maintained as it the best orientation to show the plane of division. Measurements of cell area were performed using the plane that best recapitulated cell morphology, this explanation has now been added to the Materials and methods section in page 20, lane 35.We also agree with the reviewer that analysis of cell volume is a better measurement of size than cell area. Nevertheless, calculation of cell volume from in vivo imaging presents a major technical difficulty. Accurate estimation of volume from 3D rendering requires imaging at 1mm z step, as estimations obtained from imaging with bigger z steps introduce invalidating errors. Unfortunately, imaging at 1mm z step frequency produces photobleaching, cell death and embryo death after a few hours. For this reason, all imaging was performed at 2 mm z step, which is incompatible with volumetric 3D rendering. Hence, we performed area measurements as a proxy for volume. We believe this approach is not problematic because areas are calculated to the power of 2 and volumes to the power of 3, which means the differences observed in area are an underrepresentation of the volume differences. Thus, we are confident to conclude that the leader’s progenitor divides asymmetrically giving rise to daughter cells of different sizes.Figure 6: While the author implicated that there are differences in cell cycle progression in terms of lengths of G1 and S phase, they did not examine how this affects migratory behavior. This would helpful in emphasizing their claims that "cell cycle progression may regulate their migratory behavior".Our conclusion that cell cycle progression is required for TNC migration is fully supported by the results presented in Figure 9 and Video S5, and we discuss the possible mechanisms that may link cell cycle to migration. While we agree with the reviewer that exploring how the cell cycle phases length affect migration is very interesting, the depth and the amount of work that such analysis requires is beyond the scope of this manuscript (see answer to Reviewer 2 point 3).Page 17: Line 34-41: I think this is the model rather than fact. These claims need to be toned down to indicate potential mechanisms by which these cells are initiating migration.As the reviewer points out this section describes the proposed working model and is not intended to outline experimental results or conclusions. Importantly, we begin this section by stating that: -“we have addressed the mechanism that establishes leader and follower identities and can propose the following model”- (page 11, line 14). Taking in account the reviewer’s comment and to emphasize the fact that we are describing a working model, we have added the following phrase at the end of this paragraph (page 11, line 27): – “This working model of TNC migration is supported by both our in vivo data and our in-silico modeling and provides a useful conceptual framework for future studies to build upon.”-Minor comments:Figure 3: Parameters is spelled incorrectlyThis has been changed.References:Cornell, R.A., Eisen, J.S., 2000. Δ signaling mediates segregation of neural crest and spinal sensory neurons from zebrafish lateral neural plate. Development 127, 2873–2882.Hutchins, E.J., Kunttas, E., Piacentino, M.L., Howard, A.G.A., Bronner, M.E., Uribe, R.A., 2018. Migration and diversification of the vagal neural crest. Developmental Biology, The Neural Crest: 150 years after His’ discovery 444, S98–S109. https://doi.org/10.1016/j.ydbio.2018.07.004Moro, E., Vettori, A., Porazzi, P., Schiavone, M., Rampazzo, E., Casari, A., Ek, O., Facchinello, N., Astone, M., Zancan, I., Milanetto, M., Tiso, N., Argenton, F., 2013. Generation and application of signaling pathway reporter lines in zebrafish. Mol Genet Genomics 288, 231–242. https://doi.org/10.1007/s00438-013-0750-zRaible, D.W., Wood, A., Hodsdon, W., Henion, P.D., Weston, J.A., Eisen, J.S., 1992. Segregation and early dispersal of neural crest cells in the embryonic zebrafish. Dev. Dyn. 195, 29–42. https://doi.org/10.1002/aja.1001950104Richardson, J., Gauert, A., Briones Montecinos, L., Fanlo, L., Alhashem, Z.M., Assar, R., Marti, E., Kabla, A., Härtel, S., Linker, C., 2016. Leader Cells Define Directionality of Trunk, but Not Cranial, Neural Crest Cell Migration. Cell Reports 15, 2076–2088. https://doi.org/10.1016/j.celrep.2016.04.067
Hochgreb-Hägele and Bronner, 2013; Lukoseviciute et al., 2018
ZDB-FISH-150901-9571
Antibody
Anti-myosin heavy chain(mouse monoclonal)
Developmental Studies Hybridoma Bank
F59
IF (1:200)
Antibody
Anti-synaptotagmin 2 (mouse monoclonal)
Developmental Studies Hybridoma Bank
Znp1
IF (1:50)
Antibody
Anti-acetylated tubulin (mouse monoclonal)
Sigma-Aldrich
Clone 6-11B-1;Cat# MABT868
IF (1:1000)
Antibody
Anti-digoxigenin-AP (sheep polyclonal)
Sigma-Aldrich
Cat# 11093274910
IF (1:2000)
Antibody
Anti-GFP (chicken polyclonal)
Merck Millipore
Cat# 06-896
IF (1:750)
Antibody
Anti-RFP (rabbit polyclonal)
MBL
Cat# PM005
IF (1:750)
Antibody
Myc-Tag (mouse monoclonal)
Cell Signaling
Clone 9B11; Cat# 2276S
IF (1:1000)
Antibody
Anti-GFP (chicken polyclonal)
Thermo Fisher
Cat# A10262
IF (1:750)
Recombinant DNA reagent
PCNA-GFP
Addgene
Cat# 105942
Leung et al., 2011
Sequence-based reagent
UAS:NICD FUAS:NICD R
This paper
Genotyping primer
CATCGCGTCTCAGCCTCACCGGAATCGTTTATTGGTGTCG500 bp band
Sequence-based reagent
UAS:dnSu(H) FUAS:dnSu(H) R
This paper
Genotyping primer
GCGGTGTGTGTACTTCAGTCTCTCCCCAAACTTCCCTGTC409 bp band
Sequence-based reagent
hs:dnSu(H) F hs:dnSu(H) R
This paper
Genotyping primer
CGGGCATTTACTTTATGTTGCTGCATTTCTTGCTCACTGTTTC1 kb band
Commercial assay or kit
RNAscope Multiplex Fluorescent kit
Bio-Techne
Cat# 320850
Commercial assay or kit
mMESSAGE mMACHINE SP6 Transcription Kit
Thermo Fisher
Cat# AM1340
Chemical compound, drug
In-Fusion HD Cloning Plus
Takara
Cat# 638910
Chemical compound, drug
ProLong Gold Antifade Mountant
Thermo Fisher
Cat# P10144
Chemical compound, drug
Hydroxyurea
Sigma-Aldrich
Cat# H8627
20 μM
Chemical compound, drug
Aphidicolin
Sigma-Aldrich
Cat# A0781
300 μM
Chemical compound, drug
Genistein
Calbiochem
Cat# 345834
100 μM
Chemical compound, drug
Teniposide
Sigma-Aldrich
Cat# SML0609
No effect on cell cycle in zebrafish
Chemical compound, drug
DAPT
Sigma-Aldrich
Cat# D5942-25MG
100 μM
Chemical compound, drug
Compound E
Abcam
Cat# ab142164
50 μM
Software, algorithm
Tamoxifen
Sigma-Aldrich
Cat# H7904
2.5 μM
Software, algorithm
GraphPad Prism 9
GraphPad Software
Software, algorithm
Fiji
ImageJ
Schindelin et al., 2012
Appendix 1—table 1.
Simulation parameters, description, range, and source.
Name
Description
Range
Optimised setting
Units
Source
PMZ width
Horizontal space of the premigratory zone.
57.0
57.0
μm
Measurement
PMZ height
Vertical space in the premigratory zone.
28.5
28.5
μm
Measurement
CE width
Horizontal width in the migratory chain.
22.8
22.8
μm
Model specific
MZ ratio
Vertical space around the midpoint relative to the height of the PMZ.
0.5
0.5
Units
Model specific
Cell radius
Interaction radius of cell radius was inferred assuming cells were perfect spheres, based on volumetric measurements(Richardson et al., 2016).
7.4
7.4
mm
Measurement
Nc
Number of cells.
18
18
Number
Measurement
ζ
Magnitude of stochastic component. Term of the Langevin equation, which controls random cell movement magnitude.
0.035
0.035
Units
Model specific
γ
Overdamped Langevin equation drag factor.
1
1
Units
Model specific
S
Leader spacing – number of follower cells between leader cells in migration.
{0, 1, 2, 3, ∞}
3
Number
Calibrated
Follower k
Spring constant near equilibrium (parameter of Morse potential) for follower type cells. This can be thought of as the cell volume exclusion of the cells. High k means that cells are stiffer.
Low: [0.01]Medium: [0.02]High:[0.03]
0.01
Units
Calibrated
Leader k
As above but for leader-type cells.
Low: [0.01]Medium: [0.02]High:[0.03]
0.02
Units
Calibrated
Follower De
Depth of potential well (parameter of Morse potential). Greater De means greater range of co-attraction. This can be thought of as the amount of chemotactic attraction signal released by each cell.
Low:[3e-05]Medium: [6e-05]High:[9e-05]
3e-05
Units
Calibrated
LeaderDe
As above but for leader-type cells.
Low:[3e-05]Medium: [6e-05]High:[9e-05]
6e-05
Units
Calibrated
Follower aMag
Magnitude of autonomous cell velocity. In the model’s implementation of contact inhibition, cells move into the widest open space. This parameter modulates the velocity with which they move into this space.
Low:[1.1e-07]Medium: [1.56e-06]High:[3e-06]
1.1e-07
Units
Calibrated
Leader aMag
As above but for leader-type cells.
Low:[1.1e-07]Medium: [1.56e-06]High:[3e-06]
3e-06
Units
Calibrated
Interaction threshold
Multiples of cell radii beyond which neighbours no longer cause polarisation by contact inhibition.
Authors: Jonathan W Astin; Jennifer Batson; Shereen Kadir; Jessica Charlet; Raj A Persad; David Gillatt; Jon D Oxley; Catherine D Nobes Journal: Nat Cell Biol Date: 2010-11-14 Impact factor: 28.824
Authors: Orbicia Riccio; Marielle E van Gijn; April C Bezdek; Luca Pellegrinet; Johan H van Es; Ursula Zimber-Strobl; Lothar J Strobl; Tasuku Honjo; Hans Clevers; Freddy Radtke Journal: EMBO Rep Date: 2008-02-15 Impact factor: 8.807
Authors: Frances A High; Maozhen Zhang; Aaron Proweller; Lili Tu; Michael S Parmacek; Warren S Pear; Jonathan A Epstein Journal: J Clin Invest Date: 2007-02 Impact factor: 14.808
Authors: Sheldon Rowan; Kevin W Conley; Tien T Le; Amy L Donner; Richard L Maas; Nadean L Brown Journal: Dev Biol Date: 2008-06-13 Impact factor: 3.582
Authors: Yong Chi; Markus Welcker; Asli A Hizli; Jeffrey J Posakony; Ruedi Aebersold; Bruce E Clurman Journal: Genome Biol Date: 2008-10-13 Impact factor: 13.583