The beneficial effect of chronic muscular exercise on muscle fragility is increased by Prox1 gene transfer in dystrophic mdx muscle.

PURPOSE: Greater muscle fragility is thought to cause the exhaustion of the muscle stem cells during successive degeneration/repair cycles, leading to muscle wasting and weakness in Duchenne muscular dystrophy. Chronic voluntary exercise can partially reduce the susceptibility to contraction induced-muscle damage, i.e., muscle fragility, as shown by a reduced immediate maximal force drop following lengthening contractions, in the dystrophic mdx mice. Here, we studied the effect of Prospero-related homeobox factor 1 gene (Prox1) transfer (overexpression) using an AAV on fragility in chronically exercised mdx mice, because Prox1 promotes slower type fibres in healthy mice and slower fibres are less fragile in mdx muscle.
METHODS: Both tibialis anterior muscles of the same mdx mouse received the transfer of Prox1 and PBS and the mice performed voluntary running into a wheel during 1 month. We also performed Prox1 transfer in sedentary mdx mice. In situ maximal force production of the muscle in response to nerve stimulation was assessed before, during and after 10 lengthening contractions. Molecular muscle parameters were also evaluated.
RESULTS: Interestingly, Prox1 transfer reduced the isometric force drop following lengthening contractions in exercised mdx mice (p < 0.05 to 0.01), but not in sedentary mdx mice. It also increased the muscle expression of Myh7 (p < 0.001), MHC-2x (p < 0.01) and Trpc1 (p < 0.01), whereas it reduced that one of Myh4 (p < 0.001) and MHC-2b (p < 0.01) in exercised mdx mice. Moreover, Prox1 transfer decreased the absolute maximal isometric force (p < 0.01), but not the specific maximal isometric force, before lengthening contraction in exercised (p < 0.01) and sedentary mdx mice.
CONCLUSION: Our results indicate that Prox1 transfer increased the beneficial effect of chronic exercise on muscle fragility in mdx mice, but reduced absolute maximal force. Thus, the potential clinical benefit of the transfer of Prox1 into exercised dystrophic muscle can merit further investigation.

Introduction

Duchenne muscular dystrophy (DMD), the most common X-linked inherited muscular disease, is caused by mutations in the DMD gene, leading to dystrophin deficiency that results in skeletal muscle fibre injury and progressive muscle wasting and weakness. Dystrophin is a costameric protein that plays a role in force transmission and sarcolemma stability in skeletal muscle [1]. In line, muscle of dystrophin-deficient mdx mouse, the “classic” animal model for DMD, exhibits two important functional dystrophic features. First, muscular weakness that is the decrease of the specific maximal force (the absolute maximal force generated relatively to muscle cross-sectional area or weight) with an unmodified/maintained absolute maximal force due to the muscle hypertrophy [2]. A second robust phenotype is muscle fragility that is revealed by the high susceptibility of the fast and low oxidative mdx muscle for damage caused by the lengthening (eccentric) contractions, leading in particular to an immediate marked force drop following lengthening contractions [2-4]. This force drop is proportional to both the length of the stretch and the absolute maximal lengthening force produced during the first contraction in fast mdx muscle [3, 4]. It was also found no muscle histological structural change immediately following lengthening contractions in mdx mice [5], as well as no reduction in maximal force of permeabilized muscle fiber [5, 6]. The greater fragility in mdx mice is associated to reduced muscle excitability [5, 7–9], and several genes coding ion membrane channels interacting with dystrophin are involved in muscle excitability, such as Scn4a, Cacna1s, Slc8a1, Trpc1 and chrna1 [10, 11]. Increased fragility is also related to NADPH oxidase 2 (NOX2) activity [12-14] and aggravated by inactivation of Utrn and Des coding utrophin and desmin respectively in mdx mice [15, 16].

The fragility of the dystrophic muscle is thought to cause the exhaustion of the muscle stem cells during successive degeneration/repair cycles [17]. Thus, attempt to reduce this fragility is very important because it has the potential to slow the progression of the dystrophic disease. Interestingly, chronic muscular exercise can improve (reduced) the fragility in mdx mice [9, 18–20]. In particular, voluntary running decreases fragility, i.e., reduces the force drop following lengthening contractions, in mdx mouse fast muscle [9, 19], whereas physical inactivity aggravates it [19]. Recently, it was found that the reduced fragility induced by voluntary running in mdx mice was related to calcineurin pathway activation, and changes in the program of genes involved in slower contractile features of muscle fibre and genes coding membrane ions channels involved in muscle excitability [9]. However, voluntary running only partly reduced the susceptibility to exercise-induced muscle damage [9, 19], so it would be interesting to combined the effects of exercise with those of another treatment.

While voluntary exercise offers potential therapeutic benefit, additional adjunct therapies could further improve functional dystrophic features. In the recent years, genetic or pharmacological treatments promoting slower and more oxidative fibres are been shown to be beneficial in the mdx mice. In fact, several studies support the idea that activation of the AMPK, calcineurin, E2F1, ERRγ, IGF1, SIRT1 and PGC1 signalling pathways alleviates some of the dystrophic features in mdx muscle [21-30]. For example, genetic activation of calcineurin pathway improves fragility in fast muscle of the mdx mouse, but decreases maximal force production, thus, aggravating weakness [28]. Recently, in healthy fast muscle, it was demonstrated that the loss of Prospero-related homeobox factor 1 (Prox1), a transcription factor essential for the development of several organs like lymphatic vessels and highly conserved among vertebrates, represses the expression of slow contractile genes, whereas its overexpression via Prox1 transfer has the opposite effect and down-regulates the fast contractile genes, [31, 32]. In particular, the inactivation of Prox1 reduces the expression of the slowest myosin heavy chain Myh7 in fast healthy muscle, without affecting oxidative capacity (succinate dehydrogenase staining) and absolute maximal force [32]. Prox1, that is more expressed in slow fibres, is involved in the activation of the NFAT/calcineurin pathway, and promotes the slow contractile gene program in healthy muscle [31].

The principal purpose of the present study was to determine whether Prox1 transfer using an adeno-associated vectors (AAV9) carrying the Prox1 construct reduced muscle fragility in voluntary exercised mdx mice, with fragility being defined as the immediate loss of muscle function (i.e., maximal force drop) following lengthening contractions. The study including physiological outcome measurement of fragility was complemented by molecular analyses. Because we found that voluntary running and Prox1 transfer have additive beneficial effects on fragility, a second set of experiment was performed to compare the effect of Prox1 transfer on fragility between voluntary exercised and sedentary mdx mice. Interestingly, Prox1 transfer did not reduced fragility in sedentary mdx mice.

Materials and methods

Animal groups and voluntary running

All procedures were performed in accordance with national and European legislations and were approved by our institutional Ethics Committee “Charles Darwin” (Project # 01362.02). Male mice with exon 23 mutation in the dmd gene encoding dystrophin (Mdx mice) were used (hybrid background C57Bl/6 x C57Bl/10). Mice (2–3 months of age) were randomly divided into different control and experimental groups (Fig 1). In the first set of experiment, Mdx mice were placed (Mdx+W) in separate cages containing a wheel and were allowed to run 1-month ad libitum. The muscles of Mdx mouse runners received (Mdx+W+P) or not (Mdx+W) Prox1 transfer into the muscle 3 days before the initiation of voluntary exercise. The running distances were collected and daily running distance was 4.2 ± 0.1 km/day. A group of sedentary Mdx mice was also studied (Mdx). At the end of the experiment, the body weight of the Mdx+W+P/Mdx+W mice and Mdx mice was 29.9 ± 0.3 g and 31.4 ± 0.2 g respectively (p = 0.019). The first set of experiment was performed to study the effect of Prox1 transfer in exercised Mdx mice. Because we found an effect of Prox1 transfer on fragility in Mdx+W+P muscle, we then performed a second set of experiment to compare the effect of Prox1 transfer on fragility between voluntary exercised muscle and sedentary muscle. In the second set of experiment, the muscles of sedentary Mdx mice received (Mdx+P) or not (Mdx) Prox1 transfer. The muscles were measured and collected 4 weeks after Prox1 transfer.

Fig 1

Experimental design.

Two sets of experiments were performed. In the first set of experiment, we want to determine the effect of Prox1 transfer on fragility in voluntary exercised mdx mice. AAV-Prox1 and PBS were injected in TA muscles of the same mdx mice before voluntary exercise. The aim of the second set of experiment was to compare the effect of Prox1 transfer between voluntary exercised and sedentary mdx mice.

Prox1 transfer

To overexpress Prox1, adeno-associated vectors (AAV9) carrying the Prox1 construct (AAV-Prox1) [31] was injected in one of the Tibialis anterior (TA) muscles of the mouse (2.1 x 1011 vector genomes). The other TA muscle (control muscle) of the same mouse was injected with saline solution only (Fig 1). The mouse was anesthetized (3% isoflurane) and TA muscles were injected (30 μl). Briefly, hProx1 cDNA’s were cloned into psub plasmid (promoter CMV) [31]. The plasmid was purified using the PureYield™ endotoxin-free Plasmid Maxiprep System (Promega, Lyon, France) and then verified by restriction enzyme digestion and by sequencing (Eurofins MWF Operon, Ebersberg, Germany). The AAV-Prox1 was produced in human embryonic kidney 293 cells by the triple-transfection method using the calcium phosphate precipitation technique. The virus was then purified by 2 cycles of cesium chloride gradient centrifugation and concentrated by dialysis. The final viral preparations were kept in PBS solution at -80°C. The number of viral genomes was determined by a quantitative PCR. Titer for AAV-Prox1 was 7.1 x 1012 vector genomes (vg).ml-1.

Muscle fragility measurement

Muscle fragility (susceptibility to contraction induced damage) was evaluated by measuring the in situ TA muscle contraction properties in response to nerve stimulation, as described previously [5]. Fragility was estimated from the isometric force drop resulting from lengthening contraction-induced damage. Briefly, mice were anesthetized using pentobarbital (60 mg/kg, ip). Body temperature was maintained at 37°C using radiant heat. The knee and foot were fixed with pins and clamps and the distal tendon of the muscle was attached to a lever arm of a servomotor system (305B, Dual-Mode Lever, Aurora Scientific) using a silk ligature. The sciatic nerve was proximally crushed and distally stimulated by a bipolar silver electrode using supramaximal square wave pulses of 0.1 ms duration. We first determined the optimal length (L0, length at which maximal isometric force was obtained during the tetanus). Once L0 was obtained, a maximal isometric contraction of the TA muscle was initiated during the first 500 ms. Then, muscle lengthening (10% L0) at a velocity of 5.5 mm/s (0.85 fibre length/s) was imposed during the last 200 ms. Nine lengthening contractions of the TA muscles were performed in Mdx mice, each separated by a 60 s rest period. Absolute maximal isometric force was measured 1 min after each lengthening contraction and expressed as a percentage of the initial maximal force (force drop). Absolute maximal isometric force measured before the first lengthening contraction was also normalized to the muscle mass in order to calculate the specific maximal isometric force, an index of muscle weakness. In addition, we measured the absolute maximal lengthening force during the first lengthening contraction, and index of the muscle stress. After contractile measurements, the animals were killed with cervical dislocation.

Real-time quantitative PCR (polymerase chain reaction)

Muscles (TA) were snap frozen in liquid nitrogen and stored at −80°C until use. Total RNA was isolated from TA muscles using Trizol (Invitrogen). Complementary DNA (cDNA) was then synthesized from 1 μg of total RNA using the RevertAid First Strand cDNA Synthesis kit with random hexamers, according to the manufacturer’s instructions (Thermo Scientific). RT-PCR was performed on a LightCycler 480 System at the platform iGenSeq of the Institut du Cerveau et de la Moelle epinière, using LightCycler 480 SYBR Green I Master Mix (Roche, Basel, Switzerland) [5]. The expression of Hmbs was used as reference transcript because it’s expression did not differ between groups. The 2-ΔΔCP method has been used as a relative quantification strategy for quantitative real-time polymerase chain reaction (qPCR) data analysis. All sequences of primers used are presented in Table 1.

Table 1

Sequences of primers used.

Gene	Forward	Reverse
House keeping gene
Hmbs	5’- AGGTCCCTGTTCAGCAAGAA -3’	5’- TGGGCTCCTCTTGGAATGTT -3’
Genes of interest
Cacna1	5’-CCTCATCAGCAAGAAGCAGG-3’	5’-TATGACAGACAGACCCTGGC-3’
Chrna1	5’- TGGTCTTTGTCATTGCGTCC -3’	5’- GATAAAAACCTTCCGCACCCA -3’
Des	5’- GTCCTCACTGCCTCCTGAAG-3’	5’- AGCATGAAGACCACAAAGGG-3’
Fn14	5’- AGGGGCTATAATGCCACTCC -3’	5’- GGGAGATGGTTGTTTCCGTG -3’
Fst	5’- CGAGTGTGCCATGAAGGAAG -3’	5’- GGTCTTCCTCCTCCTCCTCT -3’
Gadd45	5’- GGTGACGAACCCACATTCAT -3’	5’- GATTAATCACGGGCACCCAC -3’
Gp91phox	5’-TCACATCCTCTACCAAAACC-3’	5’-CCTTTATTTTTCCCCATTCT-3’
Hdac4	5’- AAGTAGCTGAGAGACGGAGC -3’	5’- GCATGCGGAGTCTGTAACAT -3’
Igf1	5’-ACAAGCCCACAGGCTATGGCTC -3’	5’-AGTCTCCTCAGATCACAGCTCCG -3’
Lc3 Map1lc3a	5’- CATGAGCGAGTTGGTCAAGA -3’	5’- CCATGCTGTGCTGGTTGA -3’
Mafbox	5’-TCACAGCTCACATCCCTGAG-3’	5’- TCAGCCTCTGCATGATGTTC-3’
Mstn	5’- GCTACCACGGAAACAATCAT-3’	5’-CAATACTCTGCCAAATACCA-3’
Murf1	5’-TGAGGTGCCTACTTGCTCCT-3’	5’-GTGGACTTTTCCAGCTGCTC-3’
Myh2	5’-AAGCGAAGAGTAAGGCTGTC-3’	5’-GTGATTGCTTGCAAAGGAAC-3’
Myh4	5’-ACAAGCTGCGGGTGAAGAGC-3’	5’-CAGGACAGTGACAAAGAACG-3’
Myh7	5’-AGGTGTGCTCTCCAGAATGG-3’	5’-CAGCGGCTTGATCTTGAAGT-3’
P47phox	5’-AGAACAGAGTCATCCCACAC-3’	5’-GCTACGTTATTCTTGCCATC-3’
PrxII	5’-GGTTTGGGCCACGCATAAAA-3’	5’-GCCATGACTGCGTGAGCAAG-3’
Prox1	5’-GCTACCCCAGCTCCAACATGCT-3’	5’-TGATGGCTTGACGCGCATACTTCT-3’
Rac1	5’-GTAAAACCTGCCTGCTCATCA-3’	5’-GAGAGGGGACGCAATCTGT-3’
Redd1 Ddit4	5’- ACTACTGACCTGTTCGAGGC -3’	5’- TCAAGTGTCGAAGATCCCGA -3’
Redd2 Ddit4l	5’- GTGCAGCCCCATCAAAACATA -3’	5’- GAAGCCATGCTCTTGTCACTG -3’
Sdha	5’-TTACAAAGTGCGGGTCGATG-3’	5’-GTGTGCTTCCTCCAGTGTTC-3’
Scn4a	5’-GCAACCTGGTGGTCCTGAAT-3’	5’-CAGCCCCAAGAGGAAGGTTT-3’
Slc8a1	5’- GGAGACTGCTCGTGTGTCTA -3’	5’- TGTTGGTTGGCCTGAGAGAT -3’
Smox	5’-AAGTTGTGAATCCAGTGGCG-3’	5’-GTCTCCAAGCCTCACACTCT-3’
Tnni1	5’-ATGGAGGAGGTGGATCTGC-3’	5’-TTCAAATTTGGCCCGGCAC-3’
Trpc1	5’- TCTATAGATGTCTGGCCAGTCC-3’	5’- CATTTTGCACTGACGGGCTA-3’
Utrn	5’- CACTATGACCCCTCCCAGTC -3’	5’- CGCTTCCTGTTGTAGAGCTG -3’

SDS-PAGE electrophoresis of MHC isoforms (proteins)

The muscles were extracted on ice for 60 min in four volumes of extracting buffer containing 0.3 M NaCl, 0.1 M NaH2PO4, 0.05 M Na2HPO4, 0.01 M Na4P2O7, 1 mM MgCl2, 10 mM EDTA, and 1.4 mM 2-mercaptoethanol (pH 6.5). Following centrifugation, the supernatants were diluted 1:1 (vol/vol) with glycerol and stored at -20°C. MHC isoforms (proteins) were separated on 8% polyacrylamide gels, which were made in the Bio-Rad mini-Protean II Dual slab cell system. The gels were run for 31 h at a constant voltage of 72 V at 4°C [33]. Following migration, the gels were silver stained. The gels were scanned using a video acquisition system. The relative level of MHC isoforms was determined by densitometric analysis using Image J software.

Histology

Transverse serial sections (8 μm) of TA muscles were obtained using a cryostat, in the mid-belly region. For determination of muscle fibre diameter (min ferret), frozen unfixed sections were blocked 1h in phosphate buffer saline plus 2% bovine serum albumin, 2% fetal bovine serum. Sections were then incubated overnight with primary antibodies against laminin (Sigma, France). After washes in PBS, sections were incubated 1 h with secondary antibody (Alexa Fluor, Invitrogen). Slides were finally mounted in Fluoromont (Southern Biotech). Images were captured using a digital camera (Hamamatsu ORCA-AG) attached to a motorized fluorescence microscope (Zeiss AxioImager.Z1), and morphometric analyses were made using the software ImageJ. We attempt to analyze all the fibers of the muscle section, but some were excluded from the analysis for reasons of improper labeling (mean: 1474 fibres measured per muscle).

Statistical analysis

Groups were statistically compared using the Prism software v8 (GraphPad, La Jolla, CA, USA). Data were tested for homogeneity of variance using a Brown-Forsythe test. For the first set of experiment, one-way ANOVA was used to analyze the following variables: mRNA expression, absolute and specific maximal force, absolute maximal lengthening force, the ratio of absolute maximal lengthening force to the absolute maximal lengthening force, and muscle weight. Fragility was analyzed by two-way ANOVA, groupes (Mdx, Mdx+W, Mdx+W+P) by lengthening contractions (0, 3, 6, 9), with the repeated measures on lengthening contractions. Unpaired t-test with Welch’s correction was used to analyze the % of MHC-2x and MHC-2a (electrophoresis) and body weight of the mice. For experiment 2, unpaired t-test with Welch’s correction was used for the following variable: mRNA expression, absolute and specific maximal force, absolute maximal lengthening force, and muscle weight. Fragility was analyzed by two-way ANOVA, groupes (Mdx, Mdx+P) by lengthening contractions (0, 3, 6, 9), with the repeated measures on lengthening contractions. Moreover, when significant main effect (ANOVA) was observed, multiple-comparisons were performed with Tukeys test. Finally, when significant interaction was found (ANOVA), differences were tested with Holm-Sidak test. Values are means ± SEM.

Results

Prox1 transfer in voluntary exercised Mdx muscle promotes slower contractile features

In the first set of experiment, we first determined whether Prox1 transfer increased slower contractile features in voluntary exercised Mdx mice. Prox1 transfer into the TA muscle markedly increased the expression of Prox1 (x 37.0) in voluntary exercised Mdx TA muscle (Mdx+W+P) as compared to voluntary exercised Mdx TA muscle (Mdx+W)(p < 0.0001) (Fig 2A), as assessed by qPCR analysis. We also found that the expression of Myh7 coding for MHC-1 (x 15.1)(p < 0.001) was increased in Mdx+W+P muscle as compared to Mdx+W muscle, whereas that of Myh4 coding for MHC-2b was reduced (x 0.6) (Fig 2B) (p < 0.001). In agreement, using gel electrophoresis technique, we found that the relative amounts (percentage of total) of MHC-2b protein were reduced (x 0.8, p < 0.01) whereas that of MHC-2x protein was increased (x 1.6, p < 0.01), respectively (Fig 2C) in Mdx+W+P muscle as compared to Mdx+W muscle. In contrast, there was no difference between Mdx+W+P and Mdx+W muscles in the expression of a marker of oxidative capacity, Sdha, a gene encoding a complex of the mitochondrial respiratory chain (Fig 2B).

Fig 2

Effect of Prox1 transfer on the expression of Prox1 and markers of fibre type specification in voluntary exercised mdx mice (first set of experiment).

(A) Prox1 expression in Mdx+W+P and Mdx+P muscle. N = 6–8 per group. (B) Expression of genes encoding fibre type specific contractile proteins in Mdx+W+P and Mdx+P muscle. N = 6–8 per group. (C) Relative amounts of MHC-2x and MHC-2b proteins in Mdx+W+P and Mdx+P muscle. N = 3 per group. Mdx+W+P: voluntary exercised mdx muscle that received Prox1 transfer into the muscle. Mdx+W: voluntary exercised mdx muscle. Mdx: mdx muscle. a2, a3, a4: significant different from Mdx, p < 0.01, p < 0.001, p < 0.0001, respectively. b2, b3, b4: significant different from Mdx+W, p < 0.01, p < 0.001, p < 0.0001, respectively.

These data indicate that intramuscular delivery of AAV-Prox1 induced a fast to slow contractile transition in the TA muscle of voluntary exercised Mdx mice.

Prox1 transfer in voluntary exercised Mdx muscle further improves muscle fragility

The first set of experiment revealed that the immediate isometric force drop following lengthening contractions in Mdx+W muscle was reduced as compared to Mdx muscle (p < 0.0001) (Fig 3A). Interestingly, Prox1 transfer in voluntary exercised Mdx muscle further reduced the isometric force drop following lengthening contractions (Fig 3A). In fact, the isometric force drops following the 6th (p < 0.05) and 9th (p < 0.01) lengthening contractions were lower in Mdx+W+P muscle as compared to Mdx+W muscle (Fig 3A), indicating that Prox1 transfer improved (reduced) fragility in voluntary exercised Mdx muscle.

Fig 3

Effect of Prox1 transfer on fragility (susceptibility to contraction induced-muscle damage) and related gene expression in voluntary exercised mdx mice (first set of experiment).

(A) Force drop following lengthening contractions (Fragility) in Mdx+W+P and Mdx+P muscle. n = 6–8 per group. (B) Expression of genes encoding ion channels, related to excitability in Mdx+W+P and Mdx+P muscle. N = 6–8 per group. (C) Expression of genes, related to NADPH oxidase 2 (NOX2) in Mdx+W+P and Mdx+P muscle. N = 6–8 per group. (D) Expression of genes encoding utrophin (Utrn) and desmin (Des) in Mdx+W+P and Mdx+P muscle. N = 6–8 per group. Mdx+W+P: voluntary exercised mdx muscle that received Prox1 transfer into the muscle. Mdx+W: voluntary exercised mdx muscle. Mdx: mdx muscle. a1, a4: significant different from Mdx, p < 0.05, p < 0.0001, respectively. b1, b2: significant different from Mdx+W, p < 0.05, p < 0.01, respectively.

The fast to slower contractile conversion described above can explained, at least in part, the improved fragility in Mdx+W+P muscle. Moreover, we tested the possibility that Prox1 transfer also improved fragility via the modifications of the expression of genes coding membrane ions channels. The expression of Trpc1 encoding for transient receptor potential cation channel subfamily C member 1 (x 2.1) was increased in Mdx+W+P muscle as compared to Mdx+W muscle (p < 0.01) (Fig 3B). No difference between Mdx+W+P and Mdx+W muscles was observed concerning the expression of Scn4a, Cacna1s, Slc8a1 and Chrna1 (Fig 3B). Then, we determined whether the reduced isometric force drop following lengthening contractions induced by Prox1 transfer was associated to change (decrease) in NOX2 pathway. We found no change in the expression of PrxII, Gp91phox, P47phox and Rac1 (Fig 3C) in Mdx+W+P muscle as compared to Mdx+W muscle (Fig 3C). We also determined whether Prox1 transfer increased Utrn and Des expression. The expression of Utrn was not increased in Mdx+W+P muscle as compared to Mdx+W muscle, whereas that one of Des increased (x 1.2) in Mdx+W muscle, although not significantly (p = 0.052) (Fig 3D).

Thus, the improved TA muscle fragility induced by Prox1 transfer in voluntary exercised mice was associated with the modification of expression of MHC-2b and MHC-2x proteins and several genes involved in different aspects of muscle function and structure (Myh7, Myh4, Trpc1).

Prox1 transfer in voluntary exercised Mdx muscle reduced absolute isometric maximal force

In addition, the first set of experiment revealed that Prox1 transfer combined to voluntary running and voluntary running alone did not affect specific maximal isometric force before lengthening contractions (Fig 4A). However, absolute maximal isometric force was reduced in Mdx+W+P muscle (x 0.6) as compared to Mdx+W muscle (p < 0.01) (Fig 4B). Similarly, absolute maximal lengthening force was lower (x 0.6) in Mdx+W+P muscle (157.2 g ± 7.5) compared to Mdx+W muscle (240.0 g ± 10.8) muscle (p < 0.01). In addition, the ratio of absolute maximal lengthening force to the absolute maximal isometric force was not different between Mdx+W+P muscle (1.9 ± 0.1) and Mdx+W muscle (1.8 ± 0.1).

Fig 4

Effect of Prox1 transfer on absolute (P0) and specific (sP0) maximal forces, muscle weight and gene expression of atrophy markers in voluntary exercised mdx mice (first set of experiment).

(A) Specific maximal force in Mdx+W+P Mdx+W+P and Mdx+P muscle. n = 6–8 per group. (B) Absolute maximal force in Mdx+W+P and Mdx+P muscle. n = 6–8 per group. (C) Muscle weight in Mdx+W+P and Mdx+P muscle. n = 6–8 per group. (D) Fibre diameters (min feret) in Mdx+W+P and Mdx+P muscle. n = 3–4 per group. (E) Representative image of muscle cross-section. Fiber outline was visualized by antilaminin antibody (green). Scale bar = 200μm. (F) Expression of genes related to atrophy in Mdx+W+P and Mdx+P muscle. N = 6–8 per group. Mdx+W+P: voluntary exercised mdx muscle that received Prox1 transfer into the muscle. Mdx+W: voluntary exercised mdx muscle. Mdx: Mdx muscle. a1, a2, a3, a4: significant different from Mdx, p < 0.05, p < 0.01, p < 0.001, p < 0.0001, respectively. b2, b3, b4: significant different from Mdx+W, p < 0.01, p < 0.001, p < 0.0001, respectively.

The reduced absolute maximal isometric force was related to a lower muscle weight (x 0.7)(p < 0.001) (Fig 4C) and reduced fibre diameters (p < 0.01) (Fig 4D and 4E) in Mdx+W+P muscle as compared to Mdx+W muscle. Numerous genes encoding proteins are involved in muscle atrophy, growth and maintenance [34, 35]. The ubiquitin-proteasome system plays a key role in triggering muscle atrophy when the expressions of Murf1 and Mafbox are increased. Quantitative real-time PCR revealed that the expressions of these genes were not increased in Mdx+W+P muscle as compared to Mdx+W muscle (Fig 4F). We then analyzed another atrophic mechanism, autophagy, which involves a battery of genes including Lc3 which could contribute to the degradation of muscle proteins [36]. We did not find any change in Lc3 expression in Mdx+W+P muscle (Fig 4F). Similarly, Gadd45, Hdac4, Fn14, Redd1, Redd2, Mstn, Fst, Igf1, and Smox genes also did not seem to participate to the atrophic state of Mdx+W+P muscle (Fig 4F). For example, Mstn, the negative regulator of muscle growth, was down-regulated in Mdx+W+P muscle as compared to Mdx+W muscle (p < 0.001) (Fig 4F).

Thus, the reduction in maximal isometric force induced by Prox1 transfer in voluntary exercised Mdx muscle was related to decreased muscle weight and increased expression of Mstn.

Prox1 transfer in sedentary Mdx muscle promotes slower contractile features but does not reduce muscle fragility

A second set of experiment was performed to compare the effect of Prox1 transfer on fragility between voluntary Mdx mice and sedentary Mdx mice. Similarly to voluntary exercised Mdx muscle, Prox1 transfer in sedentary Mdx muscle (Mdx+P muscle) increased the expressions of Prox1 (x 27.3)(p < 0.0001) (Fig 5A), Myh7 (x 6.2)(p < 0.05) (Fig 5B), and reduced that one of Myh4 (x 0.7)(p < 0.05) (Fig 5B) compared to sedentary Mdx muscle. In contrast to voluntary exercised Mdx muscle, Prox1 transfer increased the expression of Tnni1 (x 2.4)(p < 0.01), reduced the expression of Sdha (x 0.8) (Fig 5B) (p < 0.01) and did not change the relative amounts of MHC-2b and MHC-2x proteins (Fig 5C) in Mdx+P muscle as compared to Mdx muscle. Overall, intramuscular delivery of AAV-Prox1 also induced a fast to slow contractile conversion in the TA muscle of sedentary Mdx mice, but without consequence at the MHC protein level.

Fig 5

Effect of Prox1 transfer on the expression of Prox1 and markers of fibre type specification in sedentary mdx mice (second set of experiment).

(A) Prox1 expression in Mdx+P and Mdx muscle. N = 6–11 per group. (B) Expression of genes encoding fibre type specific contractile proteins in Mdx+P and mdx muscles. N = 6–11 per group. (C) Relative amounts of MHC-2x and MHC-2b proteins in Mdx+P and Mdx muscle. N = 3 per group. Mdx+P: Mdx muscle that received Prox1 transfer into the muscle. Mdx: Mdx muscle. a1, a2, a4: significant different from Mdx, p < 0.05, p < 0.01, p < 0.0001, respectively.

In contrast to voluntary exercised Mdx muscle, we found in the second set of experiment that the isometric force drop following lengthening contractions was not significantly reduced by Prox1 transfer in sedentary Mdx muscle because there was no significant difference between Mdx+P muscle and Mdx muscle (Fig 6A). Similarly to voluntary exercised Mdx muscle, Prox1 transfer in Mdx+P muscle increased Trpc1 expression (p < 0.01) (Fig 6B), but to lesser extent (x 1.4), did not alter the expression of PrxII, Gp91phox, P47phox and Rac1 (Fig 6C), and increased not significantly Des expression (p = 0.059) (Fig 6D). In contrast to voluntary exercised Mdx muscle, the expression of Cacn1s and Chrna1 was increased in Mdx+P muscle compared to Mdx muscle (p < 0.01) (Fig 6B).

Fig 6

Effect of Prox1 transfer on fragility (susceptibility to contraction induced muscle damage) and related gene expression, absolute (P0) and specific (sP0) maximal forces, muscle weight and gene expression of atrophy markers in voluntary exercised mdx mice (first set of experiment) in sedentary mdx mice (second set of experiment).

(A) Force drop following lengthening contractions in Mdx+P and Mdx muscle. n = 5–8 per group. (B) Expression of genes encoding ion channels, related to excitability in Mdx+P and Mdx muscle. N = 6–11 per group. (C) Expression of genes, related to NADPH oxidase 2 (NOX2) in Mdx+P and Mdx muscle. N = 6–11 per group. (D) Expression of genes encoding utrophin (Utrn) and desmin (Des) in Mdx+P and Mdx muscle. N = 6–11 per group. (E) Specific maximal force in Mdx+P and Mdx muscle. n = 5–8 per group. (F) Absolute maximal force in Mdx+P and Mdx muscle. n = 5–8 per group. (G) Muscle weight in Mdx+P and Mdx muscle. n = 5–9 per group. (H) Expression of genes related to atrophy in Mdx+P and Mdx muscle. n = 6–11 per group. (I) Fibre diameters (min feret) in Mdx+P and Mdx muscle. n = 3 per group. a1, a2, a3, a4: significantly different from Mdx, p < 0.05, p < 0.01, p < 0.001, p < 0.0001, respectively.

Thus, Prox1 transfer in sedentary Mdx muscle does not reduced fragility, did not change the expression of MHC-2b and MHC-2x, whereas it altered the expression of several genes involved in different aspects of muscle function (Myh7, Myh4, Tnni1, Sdha, Trpc1, Cacn1s and Chrna1).

Prox1 transfer in sedentary Mdx muscle also reduced absolute isometric maximal force

Similarly to voluntary exercised Mdx muscle, we found in the second set of experiment that Prox1 transfer in Mdx+P muscle did not change specific maximal isometric force (Fig 6E), reduced absolute maximal isometric force (x 0.7)(p < 0.05) (Fig 6F), reduced muscle weight (x 0.8) although not significantly (p = 0.08) (Fig 6G), and decreased the expression of Mstn (p < 0.0001) (Fig 6H). Moreover, it decreased absolute maximal lengthening force in Mdx+P muscle (205.9 g ± 18.8) as compared to Mdx muscle (257.0 g ± 15.3), although not significantly (p = 0.07). In contrast to voluntary exercised Mdx muscle, Prox1 transfer did not change the fibre diameter (Fig 6I). Furthermore, it decreased the expression of Mafbox (p < 0.001), Reed2 (p < 0.05) and Smox (p < 0.01), whereas it increased the expression Gadd45 (p < 0.01), Fn14 (p < 0.001), and Fst (p < 0.05) in Mdx+P muscle (Fig 6H).

Discussion

Prox1 transfer improved fragility in voluntary exercised Mdx mice

The present study confirms previous studies [9, 19] showing that voluntary exercise alleviates the great susceptibility to lengthening contraction-induced force drop, a major dystrophic feature, in fast anterior crural muscles (TA and extensor digitorum longus) of mdx mice, such as Dmd based preclinical therapy [5]. For the first time, we demonstrate that Prox1 transfer further improves fragility in voluntary exercised mdx mice. Importantly, the muscle was protected from damaging lengthening muscle contractions by Prox1 transfer only when mdx mice performed voluntary exercise. This improved fragility observed in exercised mdx mice treated with Prox1 transfer might be very interesting if it is assumed that fragility causes the exhaustion of the muscle stem cells during successive degeneration/repair cycles [17]. Prox1 transfer might reduce the progressive muscle wasting in exercised dystrophic muscle because of the promotion of less fragile fibres.

This beneficial effect of Prox1 transfer in exercised mdx mice could be explained by a lower work and stress during lengthening [3]. However, we found that absolute maximal lengthening force (presumably work) is reduced in exercised mdx mice, in proportion to the absolute maximal isometric force. We previously observed no strong association between fragility and lengthening force in mdx mice, when muscle is maximally activated and for a constant stretch [19]. Indeed, fragility was increased by inactivity and reduced by voluntary exercise in mdx mice whereas absolute maximal lengthening force was respectively reduced and unchanged [19].

The reduced fragility induced by Prox1 transfer in exercised mdx mice is associated with the promotion of slower contractile features (increased and reduced expression of Myh7 and Myh4 respectively, reduced and increased relative amounts of MHC-2b and MHC-2x proteins respectively). This relation between improved fragility and slower contractile features is in line with the 2 following points. First, slow muscle appears less fragile than fast muscle in mdx mice [4, 37]. Second, exercise and pharmacological or genetic activation of signaling pathways, such as calcineurin, PPAR-β, PGC1-α, and AMPK, that promote a slower and more oxidative gene program, improve fragility in mdx mice [9, 18, 19, 23, 27–29, 38]. It was previously demonstrated that Prox1 promotes slower features, and activates the NFAT-calcineurin pathway [31], a signaling pathway known to play an important role in fibre type specification [39].

It is also possible that Prox1 transfer improves fragility in voluntary exercised mdx mice by a preserved excitability, as voluntary exercise and Dmd based therapy [5, 9]. In our experiments, reduced excitability, i.e. plasmalemma electrical dysfunction leading to defective generation and propagation of muscle potential action, largely contributes to the immediate force drop following lengthening contractions in mdx mice [5, 9], in agreement with other studies [7, 8]. Membrane ion channels are likely damaged following by lengthening contractions and Prox1 transfer possibly interferes with this process. It remains to be determined whether the upregulation of the membrane ion stretch-activated channel Trpc1 induced by Prox1 transfer in voluntary exercised mdx mice contributes to this improvement of excitability. However, a higher level of TRPC1 or activity of stretch-activated channels are generally associated with a worst dystrophic phenotype and fragility [40, 41]. In line with the present study, it was previously reported that the improved TA mdx muscle excitability and fragility induced by voluntary exercise and calcineurin pathway activation were also related to the changes in expression of genes encoding membrane ion channels [9].

Previous studies suggest that increased NOX2 activity is related to fragility in mdx mice [13, 14]. However, our results show that Prox1 transfer in exercised mdx muscle does not reduce the expression of Nox2 subunits (Gp91phox, P47phox and Rac1), which are shown to produce an elevated level of ROS in mdx mice [14]. Moreover, we found no increased expression of the gene encoding the antioxidant enzyme PrxII, whose overexpression improves fragility in mdx mice [13]. Finally, we found that the improvement of the fragility in response to Prox1 transfer is not associated with significantly increased expression of Utr and Des in exercised mdx mice, two genes contributing to fragility in mdx mice [15, 16].

Of note, Prox1 transfer alone does not significantly improve fragility in sedentary mdx mice. It is not excluded that the increase in the number of sedentary mdx mice per group change this conclusion but the potential beneficial effect would nevertheless be less important. The difference cannot be attributed to the fact that Prox1 was not highly overexpressed in sedentary mdx mice treated with Prox1 transfer. However, some changes induced by Prox1 transfer are notably different between exercised and sedentary mdx mice: absolute maximal lengthening force (x 0.6 versus none significant change), MHC-2b (x 0.8 versus none), MHC-2x (x 1.6 versus none), Myh7 (x 15.1 versus x 6.2), and Trpc1 (x 2.1 versus x 1.4). Thus, our study interestingly indicates that voluntary exercise potentiates a possible gene-based therapy, at least in the preclinical field.

Prox1 transfer reduces maximal force production in exercised mdx mice

Although Prox1 transfer improves fragility in voluntary exercised mdx muscle, we found that it has a detrimental effect on absolute maximal isometric force (and maximal lengthening force), without change in specific maximal isometric force. The reduced maximal isometric force is related to a reduced muscle weight and fibre diameter and is associated to the downregulation of Mstn, a negative regulator of muscle growth in mdx muscle [42]. The same effects were also observed in sedentary mdx mice, although less marked. In line with the reduced muscle weight induced by Prox1 transfer, several genetic or pharmacological treatments promoting slower and more oxidative fibres has been shown to induce muscle atrophy/reduced weight in sedentary mdx mice [27, 28, 30], for reasons still largely unknown. It remains to be determined whether the injection of the AAV itself also contributes to the muscle weight reduction (independently of the overexpression of Prox1).

Conclusions

Combined to voluntary exercise, Prox1 transfer using an AAV further improves (reduced) the immediate isometric force drop following lengthening contractions. This beneficial effect on fragility in exercised mdx mice is associated to the reduction in maximal lengthening force, the promotion of slower contractile features, and the change in Trpc1 expression. However, Prox1 transfer also reduces absolute maximal isometric force production. Thus, Prox1 transfer combined to chronic exercise has effects, some of which are beneficial for the mdx dystrophic muscle. Is this knowledge could be exploited for therapeutic advantage?

MHC electrophoresis.

(PDF)

Click here for additional data file.

Force record set 1.

(PDF)

Click here for additional data file.

Force record set 2.

(PDF)

Click here for additional data file.

Fibre diameters set 1.

(PDF)

Click here for additional data file.

Fibre diameters set 2.

(PDF)

Click here for additional data file.

mRNA.

(PDF)

Click here for additional data file.

(PDF)

Click here for additional data file.

Force and weight.

(PDF)

Click here for additional data file.

(PNG)

Click here for additional data file.

Diameters set 2.

(PNG)

Click here for additional data file.

13 Aug 2021

PONE-D-21-17707

The beneficial effect of chronic muscular exercise on muscle fragility is increased by Prox1 gene transfer in dystrophic mdx muscle

PLOS ONE

Dear Dr. Ferry,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Sep 27 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:  http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols . Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at  https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols .

We look forward to receiving your revised manuscript.

Kind regards,

Atsushi Asakura, Ph.D

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: In this study, Monceau et al. investigated the effect of Prospero-related homeobox factor

1 gene (Prox1) transfer on fragility in chronically exercised or sedentary mdx mice. The authors concluded that Prox1 transfer reduced the force drop following lengthening contractions in exercised mdx mice, but not in sedentary mdx mice. Whereas, absolute maximal force and muscle weight were reduced by Prox1 transfer, especially in exercised mdx mice. In addition, based on the reduced muscle weight, the authors focused on atrophic genes.

Major concerns

1. The authors concluded the no effect of Prox1 transfer on the fragility and muscle weight in second experiments. In fact, there is no significant difference, but the data show the tendency to decrease. Is there a possibility that addition of mice changes the conclusion? The results of absolute maximal lengthening force (line 393-394) are also not significant, but actually the force was 20% decreased in Mdx+P group.

2. Lines 409-410; The present study confirms previous studies (8,18) showing that voluntary exercise alleviates the great susceptibility to contraction induced injury, a major dystrophic feature, in fast anterior crural muscles (TA and extensor digitorum longus) of mdx mice,

Lines 497-499; Combined to voluntary exercise, Prox1 transfer further improves (reduced) fragility, whereas the single Prox1 transfer approach in sedentary mdx mice failed to induce a

significant effect on the susceptibility to exercise-induced muscle injury.

Is muscle fragility really equal to susceptibility to muscle injury? In this study, there is no data indicating the reduced injury area in Mdx+W+P mice.

3. The authors texted some genes related with muscle atrophy. However, in this study, there is no evidence indicating the decreased myofiber size. The decreased muscle size, but not muscle weight is primary criteria for muscle atrophy.

Minor concerns

1. Line 273; Please correct Figure 1C to Figure 2C.

2. Line 273-276; Immunohistological analyses revealed that these changes were not associated with the modification in the percentages of MHC-1, MHC-2a and MHC-2x expressing fibres because they were not different between Mdx+W+P muscle and Mdx+W muscle (Figures 2D and 2E).

Line 283-284; These data indicate that intramuscular delivery of AAV-283 Prox1 induced a substantial fast to slow contractile transition in the TA muscle of voluntary exercised Mdx mice.

It is unclear the definition of ‘substantial fast to slow contractile transition’ without the no changes of myofiber composition.

3. To reviewer’s knowledge, Prox1 is well known as the marker and regulator for lymphangiogenesis. Reviewer recommends to add some description about the role of Prox1 in lymphangiogenesis.

Reviewer #2: The authors investigated the effects of 1-month voluntary wheel-running exercise and/or Prospero-related homeobox factor 1 gene (Prox1) transfection in dystrophic mdx TA muscle. Prox1 transfection induced a fast-to-slow transition of the myosin isoform and reduced the lengthening-contraction-associated force decline in the TA. One month of running exercise was also found to partially attenuate the lengthening-contraction-associated force decline in the TA. This exercise-associated effect was enhanced by Prox1 transfection. The authors concluded that the Prox1-atransfection combined with voluntary exercise improves the fragility of the mdx muscle. While their results are fairly interesting, this manuscript has several concerns to address.

The authors report that the muscle weight was decreased by Prox1 transfection and/or 1-month voluntary wheel running. The authors should report the body weight, together with the muscle weight relative to the body weight, of each experimental group. These are important physiological parameters to evaluate the effects of Prox1 transfection and exercise.

While the muscle weight was decreased by Prox1 transfection and/or voluntary running, no significant difference was found in the mean fiber diameters of the respective fiber types among the experimental groups. What explains these discrepant results? Did these treatments decrease the number of muscle fibers?

Prox1 transfection and/or voluntary exercise partially attenuated the lengthening-contraction-associated force decline in the TA. The relative reduction may be inversely related with the level of absolute maximal force. Do these results suggest that the lower level of maximal tension elicits the beneficial effects of Prox1 transfection and voluntary exercise on the fragility of the mdx TA muscle? Though the authors discuss this issue, they should take the added step of offering a clear explanation. The amplitude of the absolute maximal force had a large impact on the relative percentage of force reduction. Therefore, the authors should also evaluate the lengthening-associated force reduction using the absolute force.

Figure 2

An image of the mdx muscle should be provided.

Judging from the images, the combination of Prox1 and voluntary exercise drastically increased the population of type 2x fibers, and decreased the populations of type 2a and 2b fibers, compared to the exercised-alone group. These changes are somewhat smaller than those shown in Figure 2C. What explains the difference?

All of the evaluations in this study were carried out using the TA muscle. The fiber type distribution of the TA muscle is region-specific. The authors state that they counted all fibers in a cross-section of the mid-belly region of the TA. Figure 2D, on the other hand, shows only a limited portion of the TA muscle.

The cause of the lengthening-associated force reduction remains unclear. The intracellular Ca2+ level has an impact on the force generation. The authors should provide a record of the force curve with a baseline level (namely, the changes in the resting tension during successive contractions). Further, they should evaluate the molecules that handle intracellular Ca2+, such as those associated with the functions　sarcoplasmic reticulum (ryanodine receptor, Ca2+ pump), T-tubes (DHP receptor, caveolin), parvalbumin, and Na+-Ca2+ exchanger.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

20 Sep 2021

Response to Reviewers

Academic Editor

• A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. AUTHORS’RESPONSE:This was done.

• A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. AUTHORS’RESPONSE: This was done.

• An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. AUTHORS’RESPONSE: This was done.

Journal requirements

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

AUTHORS’RESPONSE: We checked Plos One’s style requirements.

2. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

AUTHORS’RESPONSE: Supporting information files concerning minimal data set were uploaded.

Reviewer #1:

In this study, Monceau et al. investigated the effect of Prospero-related homeobox factor

1 gene (Prox1) transfer on fragility in chronically exercised or sedentary mdx mice. The authors concluded that Prox1 transfer reduced the force drop following lengthening contractions in exercised mdx mice, but not in sedentary mdx mice. Whereas, absolute maximal force and muscle weight were reduced by Prox1 transfer, especially in exercised mdx mice. In addition, based on the reduced muscle weight, the authors focused on atrophic genes.

Major concerns

1. The authors concluded the no effect of Prox1 transfer on the fragility and muscle weight in second experiments. In fact, there is no significant difference, but the data show the tendency to decrease. Is there a possibility that addition of mice changes the conclusion? The results of absolute maximal lengthening force (line 393-394) are also not significant, but actually the force was 20% decreased in Mdx+P group. AUTHORS’RESPONSE: Yes, it is possible. We have added this notion in the Discussion.

2. Lines 409-410; The present study confirms previous studies (8,18) showing that voluntary exercise alleviates the great susceptibility to contraction induced injury, a major dystrophic feature, in fast anterior crural muscles (TA and extensor digitorum longus) of mdx mice,

Lines 497-499; Combined to voluntary exercise, Prox1 transfer further improves (reduced) fragility, whereas the single Prox1 transfer approach in sedentary mdx mice failed to induce a

significant effect on the susceptibility to exercise-induced muscle injury.

Is muscle fragility really equal to susceptibility to muscle injury? In this study, there is no data indicating the reduced injury area in Mdx+W+P mice. AUTHORS’RESPONSE: The drop in maximal force following eccentric contractions is a marker recognized as relevant, emerging as a robust phenotype of murine dystrophy. This notion is underlined in the Introduction. It may give information different from that of histological markers. Indeed, it is possible to found a dramatic drop in maximal force for a few days although histological lesions are only minor.

3. The authors texted some genes related with muscle atrophy. However, in this study, there is no evidence indicating the decreased myofiber size. The decreased muscle size, but not muscle weight is primary criteria for muscle atrophy. AUTHORS’RESPONSE: This notion was added in the Discussion. The weight of the muscle is related to the volume of the muscle (weight = volume x density).

Minor concerns

1. Line 273; Please correct Figure 1C to Figure 2C. AUTHORS’RESPONSE: This is now revised.

2. Line 273-276; Immunohistological analyses revealed that these changes were not associated with the modification in the percentages of MHC-1, MHC-2a and MHC-2x expressing fibres because they were not different between Mdx+W+P muscle and Mdx+W muscle (Figures 2D and 2E).

Line 283-284; These data indicate that intramuscular delivery of AAV-283 Prox1 induced a substantial fast to slow contractile transition in the TA muscle of voluntary exercised Mdx mice.

It is unclear the definition of ‘substantial fast to slow contractile transition’ without the no changes of myofiber composition. AUTHORS’RESPONSE: The notion of a substantial rapid to slow transition is now revised.

3. To reviewer’s knowledge, Prox1 is well known as the marker and regulator for lymphangiogenesis. Reviewer recommends to add some description about the role of Prox1 in lymphangiogenesis. AUTHORS’RESPONSE: The importance of Prox1 for lymphatic vessels is now added (Introduction).

*************************************************************************************************************

Reviewer #2:

The authors investigated the effects of 1-month voluntary wheel-running exercise and/or Prospero-related homeobox factor 1 gene (Prox1) transfection in dystrophic mdx TA muscle. Prox1 transfection induced a fast-to-slow transition of the myosin isoform and reduced the lengthening-contraction-associated force decline in the TA. One month of running exercise was also found to partially attenuate the lengthening-contraction-associated force decline in the TA. This exercise-associated effect was enhanced by Prox1 transfection. The authors concluded that the Prox1-atransfection combined with voluntary exercise improves the fragility of the mdx muscle. While their results are fairly interesting, this manuscript has several concerns to address.

The authors report that the muscle weight was decreased by Prox1 transfection and/or 1-month voluntary wheel running. The authors should report the body weight, together with the muscle weight relative to the body weight, of each experimental group. These are important physiological parameters to evaluate the effects of Prox1 transfection and exercise. AUTHORS’RESPONSE: One leg is injected with Prox1 while the other leg is injected with PBS (Figure 1). One leg is injected with Prox1 while the other leg of the same mouse is injected with PBS (Figure 1). The body weights of the mice are therefore not different between the M + W + P and M + W groups. Ditto for groups M + P and M (Figure 1). Body weights is therefore not an interesting measured parameter. Body weights corresponding to M+W+P and M+W muscles were approximatively 30 g (28.g to 30.5 g), this was added in Materials and Methods.

While the muscle weight was decreased by Prox1 transfection and/or voluntary running, no significant difference was found in the mean fiber diameters of the respective fiber types among the experimental groups. What explains these discrepant results? Did these treatments decrease the number of muscle fibers? AUTHORS’RESPONSE: One possibility is that the number of fibers is decreased. Unfortunately, we could not measure this parameter with much precision because of the unsatisfactory quality of some cross sections of the muscle (part of the cross sections). Anyway, the possibility of a decrease in the number of fibers in 4 weeks is low because this type of phenomenon has not yet been described in previous studies. A second possibility is that the density of the muscle has changed (weight = volume x density). This latter notion is now added in the revised Discussion).

Prox1 transfection and/or voluntary exercise partially attenuated the lengthening-contraction-associated force decline in the TA. The relative reduction may be inversely related with the level of absolute maximal force. Do these results suggest that the lower level of maximal tension elicits the beneficial effects of Prox1 transfection and voluntary exercise on the fragility of the mdx TA muscle? Though the authors discuss this issue, they should take the added step of offering a clear explanation. The amplitude of the absolute maximal force had a large impact on the relative percentage of force reduction. Therefore, the authors should also evaluate the lengthening-associated force reduction using the absolute force. AUTHORS’RESPONSE: AUTHORS’RESPONSE: We added a clearer explanation in Discussion as suggested. Results concerning the reduction of maximal force are already presented in Results: “Similarly, absolute maximal lengthening force was lower (x 0.6) in Mdx+W+P muscle (157.2 g ± 7.5) compared to Mdx+W muscle (240.0 g ± 10.8) muscle (p < 0.01). In addition, the ratio of absolute maximal lengthening force to the absolute maximal isometric force was not different between Mdx+W+P muscle (1.9 ± 0.1) and Mdx+W muscle (1.8 ±329 0.1).”

Figure 2

An image of the mdx muscle should be provided. AUTHORS’RESPONSE: This is now added in supporting information files. We added all the images of muscles.

Judging from the images, the combination of Prox1 and voluntary exercise drastically increased the population of type 2x fibers, and decreased the populations of type 2a and 2b fibers, compared to the exercised-alone group. These changes are somewhat smaller than those shown in Figure 2C. What explains the difference? AUTHORS’RESPONSE: 1) When we measured all the images using immunohistochemistry, there are no differences in the number of fibers expressing neither MHC-2b nor MHC-2a between Mdx+W+P muscle and Mdx+W muscle, as shown in Figure 2E. We also found no significant difference between these two groups concerning the number of fibres expressing MHC-2x. 2) The variability between muscles and portions of muscle can explained the difference between Figure 2E and Figure 2D. So, based on the reviewer's remarks, we decided to delete Figure 2D. All the images of the muscles are now shown in supporting information files. 2) The discrepancy between the Figure 2C and Figure 2E could be explained by the fact that Figure 2C considers the co-expression of MHC, unlike Figure 2E. A second explanation could come from the fact that Figure 2C is more quantitative while Figure 2E is more qualitative. In the revised manuscript, we modified the notion of a substantial fast to slow transition since the effect of Prox1 on the populations on the different types of fibres is modest compared to what expected, and more complicated.

All of the evaluations in this study were carried out using the TA muscle. The fiber type distribution of the TA muscle is region-specific. The authors state that they counted all fibers in a cross-section of the mid-belly region of the TA. Figure 2D, on the other hand, shows only a limited portion of the TA muscle. AUTHORS’RESPONSE: We agree with the reviewer. We deleted the Figure 2D. The full images are now shown in supporting information files.

The cause of the lengthening-associated force reduction remains unclear. The intracellular Ca2+ level has an impact on the force generation. The authors should provide a record of the force curve with a baseline level (namely, the changes in the resting tension during successive contractions). AUTHORS’RESPONSE: We found no change in the baseline level. Force records are now shown supporting information files.

Further, they should evaluate the molecules that handle intracellular Ca2+, such as those associated with the functions　sarcoplasmic reticulum (ryanodine receptor, Ca2+ pump), T-tubes (DHP receptor, caveolin), parvalbumin, and Na+-Ca2+ exchanger. AUTHORS’RESPONSE: We agree with the reviewer, the study of the functions of the proteins involved in excitation would be very interesting, but this goes well beyond the scope of this study. Previous studies (cited in the manuscript) show that treatments (gene therapy aimed at restoring dystrophin expression, voluntary exercise) that improve muscle fragility in mdx mice improve muscle excitability, through mechanisms not still well known

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. AUTHORS’RESPONSE: The new Fig2 was uploaded to the PACE tool.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

6 Dec 2021

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Atsushi Asakura, Ph.D

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: No

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: (No Response)

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: (No Response)

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Related to major comment #1

Authors’ response; Line 462; It is nevertheless not excluded that the addition of mice changes this conclusion.

Additional experiment should be performed to confirm the possibility.

Related to major comment #2

Reviewer’s question means that the impact of Prox1 on susceptibility to muscle injury, because the authors described this concerns in line 409-410 (revised 403-404) and 497-499 (revised 492-494). Without the results of histological analyses, the authors can not mention the impact of Prox1 on susceptibility to muscle injury. The description in lines 492-494 also needs to be correct as sedentary group did not exercise.

Related to major comment #3

Reviewer disagrees with the authors’ response because number of myofiber also affect the muscle wight. As there is not difference in the data of diameter, the data of myofiber size should be included.

Reviewer #2: The authors made a few slight modifications to their manuscript in response to my previous comments. Regrettably, their responses and revisions do not go far enough. While the authors added supplemental data, their other revisions were minimal. The quality of the cross-sectional images of the muscle is a particular concern.

The authors’ responses and explanations on the discrepancy between their results on the muscle weights and fiber CSAs were insufficient. Both increases in number of muscle fibers and density of muscle fibers are unlikely. This finding can be attributed to technical errors during the fixation, the sectioning, and/or the staining procedures. Judging from the supplemental data (S4-S9), the very low quality of the images prevented the authors from accurately determining the fiber CSAs. These poor images reflect the low quality of the data in this study overall.

As mentioned, the quality of the immuno-stained images is too low. As a reviewer, I am unable to judge the MHC type of each fiber. I believe that types 2a and 2b are co-expressed in many types of fibers. The authors should carry out staining on new sections and then show not only merged images but also separate images stained with each type of MyHC.

Figures 3 and 4:

The authors should show the body weights of the mdx mice. They should also evaluate the difference in body weights between the mdx group and Prox1-transferred mdx group with or without exercise. Why, moreover, did the muscle weight decrease by ~25% following the Prox1 gene transfer only during the 4-week experimental period? And why did the weights of the mdx mice with both Prox1 and exercise decrease by ~50% compared to the mdx control during the 4-week experimental period? Was this reduction of muscle weight attributable to atrophy? Were physiological factors responsible for the abnormal changes in muscle weight induced by Prox1?

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

7 Jan 2022

1) Responses to Editor comments:

Dear Academic Editor,

This manuscript is a revised version of the manuscript : PONE-D-21-17707

The beneficial effect of chronic muscular exercise on muscle fragility is increased by Prox1 gene transfer in dystrophic mdx muscle. We have previously shown that chronic exercise improves the fragility of a murine dystrophic muscle. In this study, we wanted to determine if the transfer of Prox1 into a exercised dystrophic muscle causes further improved fragility.

We have changed the manuscript according to most of the suggestions of reviewers. We paid particular attention to the conclusions, as requested. Unfortunately, it is not possible to do a third set of experimentation as reviewer #1 would like, with so many muscles in each group at the same time (to avoid experimental bias). In our opinion, this does not diminish much in the interest of our study because the main objective was not to study in detail the effect of the transfer of Prox1 in sedentary mdx mice (since we mainly study the effect of Prox1 transfer on muscle fragility in exercised mdx mice). Likewise, the main objective is not to determine the mechanisms which are responsible for the reduction in muscle weight observed in exercised mdx mice treated with Prox1 transfer, as reviewer # 2 would have liked.

For us, what is important in the results of this preclinical study is that a transfer of the Prox1 gene via AAV improves the fragility of an exercised dystrophic muscle but also decreases the absolute maximal force, i.e., increases muscle weakness. Thus, the potential clinical benefit of the transfer of Prox1 into murine exercised dystrophic muscle is real but more questionable than expected.

We also revised the Funding statement: 'The author(s) received no specific funding for this work."

We hope that all the attention we have given to the corrections will be considered satisfactory.

Very best regards

Pr. Arnaud Ferry

2) Responses to Reviewers comments: see below.

Reviewer #1:

Related to major comment #1

Authors’ response; Line 462; It is nevertheless not excluded that the addition of mice changes this conclusion.

AUTHOR RESPONSE. Major comment #1. Previously, to consider the comment of the reviewer we had indeed added in the Discussion this :“It is nevertheless not excluded that the addition of mice changes this conclusion”. In the revised manuscript we added: “but the potential beneficial effect would nevertheless be less important” (see below).

Additional experiment should be performed to confirm the possibility.

AUTHOR RESPONSE. “Additional experiment should be performed to confirm the possibility”. The principal purpose of the present study was to determine whether Prox1 transfer, i.e., Prox1 transfer, reduced muscle fragility in voluntary exercised mdx mice, since voluntary running only partly reduced the susceptibility to exercise-induced muscle injury, so it would be interesting to combined the effects of exercise with those of another treatment, i.e., Prox1 transfer. Thus, the main aim is not to study the effect of the transfer of Prox1 in sedentary mdx mice. This study already includes 2 sets of experiments. In our opinion, these 2 sets of experiments already bring important preclinical results in exercised mdx mice, which meets our objectives. However, we agree that it may be of interest in the future to better study the effect of Prox1 transfer in mdx mice, although the effect appears to be more modest. In fact, the p-value is high (p = 0.3989) in the second set of experiment. In order to find a significant difference (p = 0.05) between the 2 groups (sedentary mice treated or not with Prox1), we estimate (calculate) the number of muscles in each of the 2 groups to be more than 20. Unfortunately, it not possible to perform and analyze a such study. It is not possible to do such a third set of experiment, with so many muscles in each group at the same time. Indeed, it would take too much production of mice (only one sex is studied) and viral vector. In addition, the difference of 8.623% between the 2 groups (Mdx + P and Mdx) is small, of no great physiological consequence, even if it had to be found statistically significant using 40 more muscles.

Related to major comment #2

Reviewer’s question means that the impact of Prox1 on susceptibility to muscle injury, because the authors described this concerns in line 409-410 (revised 403-404) and 497-499 (revised 492-494). Without the results of histological analyses, the authors can not mention the impact of Prox1 on susceptibility to muscle injury. The description in lines 492-494 also needs to be correct as sedentary group did not exercise.

AUTHOR RESPONSE: “Muscle injury”. The immediate drop force following lengthening contractions we used is a very widely accepted way to determine the susceptibility to exercise-induced muscle damage (see Introduction). Below are three examples: 1) “Lack of dystrophin renders skeletal muscle susceptible to injury, particularly eccentric contraction (ECC)-induced strength loss.” (Skeletal Muscle. 2020; 10: 3.), 2) “Susceptibility to ECC contraction-induced strength loss has therefore become a standard outcome measure in preclinical studies to assess disease severity and the efficacy of potential therapies for DMD.” (Med Sci Sports Exerc. 2020 Feb;52(2):354-361) and 3) “Whether whole muscles are studied in vitro, in situ, or in vivo, the overwhelming evidence indicates that whole skeletal muscles of mdx mice show a greater susceptibility to contraction-induced injury than muscles of control mice. The most compelling data indicate a 20% greater force deficit for EDL muscles of mdx mice compared with those of control mice with both studied in situ.”(Am J Physiol Cell Physiol. 2000 Oct;279(4):C1290-4.). It is this notion which is defined at the beginning of the Introduction of our manuscript, and which we use in our manuscript. Moreover, in a recent study, we found no histological structural change following immediate lengthening contractions in mdx mice (Roy et al 2016, Skeletal Muscle. 2016 Jul 20;6:23.). This last notion was also added in the revised manuscript (Introduction), in order to better define what fragility is. Moreover, we have considered the reviewer's remark in our revised manuscript (Abstract, Discussion, conclusion…). In particular, we have removed the notion of injury.

AUTHOR RESPONSE. “The description in lines 492-494 also needs to be correct”. Mdx mice (sedentary Mdx mice) did not perform chronic voluntary running (see Material and Methods) but their TA muscles performed 9 lengthening contractions. Please, but do not confuse the single session of 9 lengthening contractions in response to nerve electric stimulation with chronic voluntary running in a wheel. The 9 lengthening contractions are performed to evaluate the “Susceptibility to ECC contraction-induced strength loss”, fragility.

Related to major comment #3

Reviewer disagrees with the authors’ response because number of myofiber also affect the muscle wight. As there is not difference in the data of diameter, the data of myofiber size should be included.

AUTHOR RESPONSE. “the data of myofiber size should be included”. The data of myofiber size were already included in the manuscript R-1 (Figures 4D and 6H). However, the data of diameter are now deleted in the R-2 manuscript because Reviewer #2 have criticisms regarding the quality of the immunostained image. This is the reason why we prefer to not show data concerning the number of fibers in the previous version of the manuscript, which requires a perfect quality of muscle cross section images, which is difficult to obtain in dystrophic mice with many muscle tissue alterations (very small fibres and cells, splitted fibers, branched fibers…), in addition to the absence of dystrophin which did not allow a good staining of the contours of the fibers. For example, half of the fibers were branched in young adult mdx mice (Front Physiol. 2021 Dec 7;12:771499.). Thus, we deleted all histological data in the revised manuscript. This is not too regrettable as the effect of the transfer of Prox1 on fibre size/number is clearly not the main objective of the study. The main objective is to study the effect of the transfer of Prox1 on the muscle fragility of exercised mdx mice. In order to improve this understanding, we have focused less on muscle weight reduction in the revised manuscript.

Reviewer #2:

The authors made a few slight modifications to their manuscript in response to my previous comments. Regrettably, their responses and revisions do not go far enough. While the authors added supplemental data, their other revisions were minimal. The quality of the cross-sectional images of the muscle is a particular concern.

The authors’ responses and explanations on the discrepancy between their results on the muscle weights and fiber CSAs were insufficient. Both increases in number of muscle fibers and density of muscle fibers are unlikely. This finding can be attributed to technical errors during the fixation, the sectioning, and/or the staining procedures. Judging from the supplemental data (S4-S9), the very low quality of the images prevented the authors from accurately determining the fiber CSAs. These poor images reflect the low quality of the data in this study overall.

AUTHOR RESPONSE. “the very low quality of the images prevented the authors from accurately determining the fiber CSAs”. We agree with the reviewer, the quality of the immune-stained images is not good, probably due to the freezing/preservation of the muscles and structural alterations in dystrophic muscle. We regularly encounter difficulties to obtain nice images in dystrophic mice with many muscle tissue alterations (very small fibres and cells, splitted fibers, branched fibers, fibrosis…), in addition to the absence of dystrophin which did not allow a good staining of the contours of the fibers. For example, half of the fibers were branched in young adult mdx mice (Front Physiol. 2021 Dec 7;12:771499.). As suggested by the reviewer, we deleted all histological data. This is not too regrettable as the effect of the transfer of Prox1 on fibre size/number is clearly not the main objective of the study. The main objective is to study the effect of the transfer of Prox1 on the muscle fragility of exercised mdx mice. In order to improve this understanding, we have focused less on muscle weight reduction in the revised manuscript.

As mentioned, the quality of the immuno-stained images is too low. As a reviewer, I am unable to judge the MHC type of each fiber. I believe that types 2a and 2b are co-expressed in many types of fibers. The authors should carry out staining on new sections and then show not only merged images but also separate images stained with each type of MyHC.

AUTHOR RESPONSE.” I believe that types 2a and 2b are co-expressed in many types of fibers”. We found that very few MHC-2a and MHC-2b are co-expressed (Mdx: 0-10 fibres per TA muscle cross-section; Mdx+W: 1-18 fibres; Mdx+W+P: 2-3 fibres). We also made separate images. To take this remark (low quality of the image) into account, we have deleted all data concerning immunohistology. This is not harmful because we have other markers of fast to slow conversion of fiber type.

Figures 3 and 4:

The authors should show the body weights of the mdx mice. They should also evaluate the difference in body weights between the mdx group and Prox1-transferred mdx group with or without exercise.

AUTHOR RESPONSE. “Difference in body weights”. The range of the body weights of mdx mice (set 1) were already shown. We now shown the mean values �  SEM of the 2 groups (29.9 �  0.321 versus 31.4 �  0.23 g, see Materials and methods). There a 4.9% difference in body weight between the 2 groups (mdx group and Prox1-transferred mdx group with or without exercise). The mdx group was not intramuscularly injected, did not voluntary run and was studied 3-4 weeks later (The mdx group was studied later, due to sanitary confinement).

Why, moreover, did the muscle weight decrease by ~25% following the Prox1 gene transfer only during the 4-week experimental period? And why did the weights of the mdx mice with both Prox1 and exercise decrease by ~50% compared to the mdx control during the 4-week experimental period? Was this reduction of muscle weight attributable to atrophy? Were physiological factors responsible for the abnormal changes in muscle weight induced by Prox1?

AUTHOR RESPONSE. “Why, moreover, did the muscle weight decrease by 25%”. As described in the experimental design (Figure 1), the muscles treated or not with Prox1 come from the same mice. Therefore, they were subjected to the same physiological factors. The only difference is the injection of AAV-Prox1. Either it is Prox1 itself which is responsible for the reduction in muscle weight, or it is the injection of the AAV itself (independent of the overexpression of Prox1). This was now indicated in the text of the revised manuscript (see Discussion). What we do know is that a decrease in muscle weight of sedentary Mdx is also observed following various treatments inducing a change in the type of fibers (see Discussion). We agree with the reviewer that it would be interesting to better analyze the effects of Prox1 transfer on muscle weight. Unfortunately, we have no clear explanation concerning the reduction in the weight of the muscles treated with AAV-Prox1. However, for us, what is important in the results of this preclinical study, with regard to the objective of this study, is that a transfer of the Prox1 gene improves the fragility of the exercised dystrophic muscle, but also decreases the absolute maximal force. Thus, the potential clinical benefit of the transfer of Prox1 into exercised dystrophic muscle is real but more questionable than expected.

AUTHOR RESPONSE. “why did the weights of the mdx mice with both Prox1 and exercise decrease by ~50%”. Concerning the reduced muscle weight of Mdx+W+P compared to Mdx mice we noted these differences between the 2 groups of mice: 1) the Mdx group was not intramuscularly injected with AAV-Prox1, 2) Mdx mice did not voluntary run and 3) Mdx mice were studied 3-4 weeks later (the Mdx group was studied later, due to sanitary confinement). That makes a lot of differences that make a possible explanation even more complicated.

Submitted filename: Response 2.docx

Click here for additional data file.

11 Feb 2022

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Atsushi Asakura, Ph.D

Academic Editor

PLOS ONE

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

25 Mar 2022

Dear Academic Editor,

We have changed the manuscript according to the suggestions. We selected good quality cross-section images of the muscles, and performed new histological measurements which are now shown.

We hope that all the attention we have given to the corrections will be considered satisfactory.

Very best regards

Pr. Arnaud Ferry

Submitted filename: Response to reviewers 4.docx

Click here for additional data file.

6 Apr 2022

The beneficial effect of chronic muscular exercise on muscle fragility is increased by Prox1 gene transfer in dystrophic mdx muscle

PONE-D-21-17707R3

Dear Dr. Ferry,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Atsushi Asakura, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

8 Apr 2022

PONE-D-21-17707R3

The beneficial effect of chronic muscular exercise on muscle fragility is increased by Prox1 gene transfer in dystrophic mdx muscle

Dear Dr. Ferry:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Atsushi Asakura

Academic Editor

PLOS ONE