Maryam Aghaei1, Hossein Khanahmad2, Akram Jalali3, Shahrzad Aghaei4, Manizheh Narimani5, Sayed Mohsen Hosseini6, Fatemeh Namdar5, Seyed Hossein Hejazi1,7. 1. Skin Diseases and Leishmaniasis Research Centre, Isfahan University of Medical Sciences, Isfahan, Iran. 2. Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran. 3. Research Center for Molecular Medicine, Hamadan University of Medical Sciences, Hamadan, Iran. 4. Department of Molecular Medicine, School of Advanced Technologies, Shahrekord University of Medical Sciences, Shahrekord, Iran. 5. Department of Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran. 6. Department of Biostatistics & Epidemiology, School of Public Health, Isfahan University of Medical Sciences, Isfahan, Iran. 7. Skin Diseases and Leishmaniasis Research Center, Department of Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
Abstract
Objectives: Leishmaniasis is a complex infection against which no confirmed vaccine has been reported so far. Transgenic expression of proteins involved in macrophage apoptosis-like BAX through the parasite itself accelerates infected macrophage apoptosis and prevents Leishmania differentiation. So, in the present research, the impact of the transgenic Leishmania major including mLLO-BAX-SMAC proapoptotic proteins was assayed in macrophage apoptosis acceleration. Materials and Methods: The coding sequence mLLO-Bax-Smac was designed and integrated into the pLexyNeo2 plasmid. The designed sequence was inserted under the 18srRNA locus into the L. major genome using homologous recombination. Then, mLLO-BAX-SMAC expression was studied using the Western blot, and the transgenic parasite pathogenesis was investigated compared with wild-type L. major in vitro and also in vivo. Results: Western blot and PCR results approved mLLO-BAX-SMAC expression and proper integration of the mLLO-Bax-Smac fragment under the 18srRNA locus of L. major, respectively. The flow cytometry results revealed faster apoptosis of transgenic Leishmania-infected macrophages compared with wild-type parasite-infected macrophages. Also, the mild lesion with the less parasitic burden of the spleen was observed only in transgenic Leishmania-infected mice. The delayed progression of leishmaniasis was obtained in transgenic strain-injected mice after challenging with wild-type Leishmania. Conclusion: This study recommended transgenic L. major including mLLO-BAX-SMAC construct as a pilot model for providing a protective vaccine against leishmaniasis.
Objectives: Leishmaniasis is a complex infection against which no confirmed vaccine has been reported so far. Transgenic expression of proteins involved in macrophage apoptosis-like BAX through the parasite itself accelerates infected macrophage apoptosis and prevents Leishmania differentiation. So, in the present research, the impact of the transgenic Leishmania major including mLLO-BAX-SMAC proapoptotic proteins was assayed in macrophage apoptosis acceleration. Materials and Methods: The coding sequence mLLO-Bax-Smac was designed and integrated into the pLexyNeo2 plasmid. The designed sequence was inserted under the 18srRNA locus into the L. major genome using homologous recombination. Then, mLLO-BAX-SMAC expression was studied using the Western blot, and the transgenic parasite pathogenesis was investigated compared with wild-type L. major in vitro and also in vivo. Results: Western blot and PCR results approved mLLO-BAX-SMAC expression and proper integration of the mLLO-Bax-Smac fragment under the 18srRNA locus of L. major, respectively. The flow cytometry results revealed faster apoptosis of transgenic Leishmania-infected macrophages compared with wild-type parasite-infected macrophages. Also, the mild lesion with the less parasitic burden of the spleen was observed only in transgenic Leishmania-infected mice. The delayed progression of leishmaniasis was obtained in transgenic strain-injected mice after challenging with wild-type Leishmania. Conclusion: This study recommended transgenic L. major including mLLO-BAX-SMAC construct as a pilot model for providing a protective vaccine against leishmaniasis.
One of the complex parasitic diseases in more than 102 countries is leishmaniasis which is caused by various species of Leishmania, a single-cellular kinetoplastid parasite (1-3). About 21 species of Leishmania parasites cause the main forms of leishmaniasis including Cutaneous, Mucocutaneous, and Visceral (2). Leishmania major that causes CL, has a haploid genome (29 -33 Mb in size) (4) including 36 chromosomes and 8272 coding genes involved in the surface glycoconjugates synthesis and pathogen-host interactions like proteolytic enzymes (5). The disease is transmitted by an infected phlebotomine sand-fly when it takes blood and injects mobile promastigotes into the host skin. The tissue macrophages of the host quickly capture the parasite, where Leishmania spp. within 12 to 24 hr differentiates into the non-motile amastigote to survive in macrophage phagolysosomes and once the macrophage collapses, released amastigotes infect new macrophages (6).For disease resolution, macrophages attack Leishmania parasites through toxic oxygenated metabolite products such as anion superoxide (O2-) and also present the Leishmania antigens to the TCD4+ cells. TCD4+ cell with the production of IFN-γ, stimulates nitric oxide production in infected macrophages for killing the Leishmania parasites, effectively (7). In contrast, Leishmania amastigotes inhibit macrophage function through down-regulating MHC class II and enhancing the production of the regulatory cytokine-like TGF-β and IL-10 (8).Another way for the rapid deletion of Leishmania by macrophages is apoptosis (9). Leishmania induces cellular stress responses in macrophages and stress activates JNK and C-JUN/AP-1 signaling pathways (10). As in these signaling pathways, JNK induces c-Jun/AP-1 and enhances the death ligand FasL expression. Thus, cellular responses to stress lead to Fas-mediated apoptosis) the extrinsic apoptotic pathway). In the presence of interferon-γ (IFN-γ), macrophages infected with L. major increase the Fas expression and become sensitive to cytotoxic T cells CD4 expressing FasL (11). Also, FasL and IFN-γ enhance the killing of L. major by macrophages (12).The parasites can delay macrophage apoptosis in different ways like activating Extracellular signal-regulated kinases (ERK1/2) (13) and Phosphoinositide 3-kinases/Acetate kinase (PIK3/ACK) pathways and preventing caspase 3 and 7 processes, inhibiting expression of BAX gene, stimulating anti-apoptotic signals, and secretion of cytochrome C (14).The BAX gene in the 19q13.3-q13.4 of the human genome is known as the first pro-apoptotic protein of the BCL-2 family (15, 16). The main form of BAX (BAX α) with 21 kDa exists at the mitochondrial outer membrane (MOM) for apoptosis induction (15, 16). It is present in the latent form in tissues like the spleen and breast and activates upon apoptosis induction (17). The active BAX interacts with BID and changes conformationally. Then, the oligomerized BAX intercalates into the MOM and opens the voltage-dependent anion channel (VDAC) in mitochondria. Furthermore, it forms an oligomeric pore of the mitochondrial apoptosis-induced channel (MAC) in MOM that results in the lack of mitochondrion membrane potential and extract of apoptogenic agents such as ROS and cytochrome C of the mitochondrial inter-membrane space into the cytosol (18, 19). The Second mitochondrial-derived activator of caspases (SMAC) is also a protein of inter-membrane space of mitochondria that promotes TNF receptor and cytochrome C-dependent activation of apoptosis through prohibiting the impact of Inhibitor of Apoptosis Proteins (IAPs) (20). Afterward, cytochrome C assembles the apoptosome complex by joining to apoptotic peptidase activating factor 1 (APAF1). This complex perpetrates the cell to apoptosis through binding and activating the cascade of caspase (18).Though, caspase 3 and BAX expression increase in cells infected with Leishmania by tumor suppressor p53 during 24 hr (21), research results show that Leishmania prohibits BAX homo-oligomerization resulting in impaired translocation of BAX to mitochondria (21). Also, apoptosis prevention is partly associated with equilibrium of BAX and BCL-2 gene expression. Hence, Leishmania opposites the macrophages’ apoptosis by up-regulating BCL-2 and down-regulating BAX (22).The principal purpose of the current drugs like miltefosine is to induce parasite apoptosis (23) which is used after the appearance of the lesion and has side effects like toxicity to other cells (24). Therefore, new molecular approaches are required for the treatment of leishmaniasis (25). One of the late vaccination strategies is generating transgenic Leishmania. This haploid parasite can endure homologous recombination easily and hence deleting or integrating genes into Leishmania is possible (26). So far, the making of transgenic Leishmania has been done in 3 pathways, consisting of removing genes coding pathogenic factors, generating parasites expressing host immune factors, and parasite labeling (through fluorescence and biochemical reporter genes) for in vitro and in vivo post-infection examination (27).One of Leishmania’s strategies to get away from the immune system of the host is delaying or inhibiting the macrophage apoptosis and also prohibiting pro-apoptotic proteins like BAK and BAX that can promote this natural process in the macrophage. So, the transgenic expression of pro-apoptotic genes through the parasite itself can enhance the percentage of macrophage apoptosis and stimulate less pathology through increased apoptosis of macrophages and without any side effects on the rest of the cells. We hypothesized that expression of BAX-SMAC proteins by transgenic L. major can be applied as an effective method to find the alternative to leishmanization against leishmaniasis.As in this research, transgenic L. major expressing and secreting pro-apoptotic BAX and SMAC proteins of the mouse host was created through homologous recombination, and insertion of mentioned genes in the 18srRNA region of the L. major genome was assayed. We found that this transgenic organism can reduce disease progression and induce protection versus virulent organisms through increasing infected macrophages’ apoptosis. So, this study suggested a new method for protection of susceptible individuals against the leishmaniasis disease.
Materials and Methods
This experimental research was done at the Department of Parasitology and Mycology, Isfahan University of Medical Sciences, Isfahan, Iran between 2015 and 2018, using a grant awarded by Research Vice-Presidency of Isfahan University of Medical Sciences, Isfahan, Iran.The sequence of murine Bax
α gene (AF339055) along with mutated listeriolysin O (mLLO-L461T) (LLO lyses the phagosome membrane in pH≤7, while mLLO acts in pH≥7) and Smac gene (8 a.a) that were placed at the 5ˊ and 3´′ ends of the Bax gene, were codon-optimized. Moreover, the cleavage site of furin was considered between Bax-Smac and mLLO sequences. The mLLO-Bax-Smac sequence with 2292 bp size was ordered from Genecust Company (Luxembourg) for synthesis and cloning into the pUC57 vector in the SalI and KpnI restriction sites. Next, the SalI-mLLO-Bax-Smac-KpnI fragment was sub-cloned into the identical place in the pLEXSY-Neo2 vector, under the Secreted Acid Phosphatase 1 (SAP1) signal sequence, and was ligated with the T4 DNA ligase enzyme (Thermo Fisher, USA) (Figure 1). Then, the ligated vector was transformed into the competent E. coli Top10 (28) and transformed bacteria were selected on ampicillin- Luria- Bertani (LB) agar medium.
Figure 1
Schematic illustration of the pLEXSY-Neo2-mLLO-Bax-Smac expression vector. The mLLO-Bax-Smac fragment was subcloned in the pLEXSY-Neo2 vector in SalI/KpnI restriction sites. Also, the linearized plasmid with the SwaI restriction enzyme will integrate into the 18srRNA region of transfected Leishmania major genome by homologs recombination. Forward (F) and reverse (R) primers were shown
Transformed bacteria containing pLEXSY-Neo2-mLLO-Bax-Smac were cultured in ampicillin -LB broth medium,16 hr at 37 °C and 200 rpm (29). The plasmid DNA was extracted using SolGent (Korea). Next, the plasmid was linearized using the SwaI restriction enzyme (Thermo Scientific, USA) and separated on a 1% agarose gel electrophoresis. Then, a smaller band including the mLLO-Bax-Smac+ flank of up and down of the plasmid backbone fragments was extracted from the agarose using a gel extraction kit (Bioneer, Korea).L. major promastigotes (MRHO/IR/75/ER) were taken from the Department of Parasitology and Mycology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran, and cultured in biphasic NNN medium. Next, the parasites were sub-cultured at 25 °C and in monophasic RPMI 1640 mediums (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) and 100 U/ml penicillin/ streptomycin (Gibco, Pen-Strep15140).To generate transgenic L. major, 1×108 parasites in the logarithmic phase (with OD=2) were harvested and the pellet was washed with cold transfection buffer (4 g NaCl, 2.5 g HEPES [pH 7.5], 0.05 g Na2Hpo4, 0.594 g/l Glucose, and 0.185 g KCl) two times based on the Jena Bioscience protocol (Jena Bioscience, Germany). Then, the pellet was re-suspended in cold transfection buffer (450 μl) and combined with about 20 µg of extracted vector in a 4 mm cuvette and placed on ice for 10 min. Next, parasite transfection was done with the following conditions: 1600 v, 25 µF, 1.2 ms (30). Also, the wild-type L. major was transfected without DNA plasmid (as a negative control). Finally, cuvettes were returned on ice for 10 min and the transfected promastigotes were cultured in the FBS/RPMI1640/Antibiotics (pen/step) liquid media and placed for 48 hr at temperature room.The transfected L. major promastigotes were centrifuged and selected in liquid media containing RPMI 1640, 10% FBS, 100 U/ml penicillin/ streptomycin, and 25 µg/ml Geneticin (Roche, Germany), and the selection was followed for two weeks by adding the Geneticin up to 100 μg/ml (30).The growth rate and viability of the transgenic parasites were determined using the MTT test. Briefly, 1×106 transgenic and wild-type parasites were inoculated in 5 ml of medium) 50:50(. 100 µl culture was harvested daily (up to 7 days) and loaded onto a 96-well plate and 20 µl MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma) added to wells for 2 hr at 25 °C. Then, to lyse cells, 100 μl of dimethyl sulfoxide (DMSO) was added for 30 min at 25 °C and in the dark condition. Finally, the plate at 550 nm was read using an ELISA plate reader (30).To confirm the correct insertion of the mLLO-Bax-Smac cassette into the 18srRNA region of the transfected L. major genome by homologous recombination, genomic DNA of transfected promastigotes was extracted using a Genetbio kit (South Korea). Then, long-range PCR was carried out with forward primer hybridizing to the 18srRNA region upstream on Leishmania genomic DNA and reverse primer hybridizing to the expression cassette. Also, some parts of the mLLO-Bax-Smac segment and ITS-1 (Internal Transcribed Spacer 1 gene as a control) were amplified using primer pairs listed in Table1.
Table 1
Primer information used in PCR
Primer
Primer sequence (5ʹ-3ʹ)
Annealing temp.
Amplicon size (bp)
US18rRNAFLLO-Bax-Smac-R
TCAAGGACTTAGCCATGCATGCTTGTCAATCTCGTCTGCGTG
60 0C
1400
LLO-Bax-Smac-FLLO-Bax-Smac-R
AATGGATTCGGAACTTTGGTCCTTGTCAATCTCGTCTGCGTG
60 0C
523
ITS-1-FITS-1-R
CTGGATCATTTTCCGATTGATACCACTTATCGCACTT
53 0C
340
The wild type and transgenic L. major were cultured in conditioned medium (serum and bicarbonate sodium-free-RPMI 1640 contain 100 U/ml penicillin/streptomycin/gentamicin) at 25 °C for 48 hr. Next, the supernatants were processed in accordance with the Cuervo method with some modification. Briefly, the supernatants were centrifuged in two steps (2000 ×g, 10 minutes, 4 °C and 20,000×g, 1 hr, 4 °C). Then, TCA (trichloroacetic acid) with %10 and %20 concentrations were added, and for 60 min the solutions were incubated on ice. Finally, the pellets were washed with cold acetone at 14000 ×g, 4 °C,15 min, and solved in distilled water (31).Identical amounts of condensed proteins from both parasites were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) 12% and transferred to the nitrocellulose membrane at 80 V and 4 °C for 90 min. Next, the membrane was blocked in skim milk 5% (W/V) for 2 hr at 25 °C and incubated in a diluted mouse anti-(6×His) HRP conjugated antibody (1:1000, Sigma, USA) for 16 hr. Finally, tetramethylbenzidine (TMB) substrate was added to visualize HRP-conjugated IgG bonded to the his-tagged fusion protein (32).To survey the hemolysis by the transgenic L. major and wild-type L. major (as control), the linear culture was done on the blood agar media including defibrinated sheep blood, nutrient agar, ampicillin, rifampicin, and plates were placed for 7 days at 24-26 °C (33).To compare the acceleration of apoptosis in macrophages infected with transgenic and wild–type L. major, the J774 cell line was bought from Pasteur Institute of Iran, Tehran, Iran, and cultured in a medium containing RPMI 1640, FBS 10%, 100 U/ml penicillin/streptomycin at 37 °C and 5% CO2. Then, macrophages were infected with transgenic and wild-type L. major promastigotes in late-stationary-phase, at a cell-to-parasite ratio of 1:10. Afterward, macrophage lysate and supernatants were harvested at 12, 24, and 48 hr post-infection. Next, necrosis and apoptosis percentages of both infected macrophages were assayed using the flow-cytometry method (BD Biosciences kit, Roche) at the mentioned times (34, 35). Also, the 8-hr macrophage culture was fixed with absolute methanol on the slide and stained with Wright-5% Giemsa stain for 3 min and observed by light microscopy (x1,000) (36). This test was performed with triple replications of each well (36).30 Balb/c mice (inbred females, 4-6 weeks old) were bought from the animal breeding facility of Pasteur Institute of Iran and maintained in a conventional animal facility at Isfahan University of Medical Sciences. This research was verified by the Institutional Review Boards (IRB) of Isfahan University of Medical Sciences with IR.MUI.REC.1394.3.791 ethical approval number.To assay the pathogenesis of the transgenic parasites, mice were grouped as 10 wild-type-infected mice (group1), 10 transgenic L. major-infected mice (group2), and also 10 mice infected with both transgenic and wild-type L. major (group 3). Groups 1 and 2 were inoculated with 1×105 stationary phase promastigotes from wild-type and transgenic L. major subcutaneously at the tail base, respectively. Furthermore, group 3 was injected with both types of parasites (1×103+1×103). Disease flow was followed using a vernier caliper to measure ulcer size, twice weekly (30).To evaluate the potency of the transgenic parasites to protect Balb/c mice, un-ulcered mice of 2 and 3 groups (mice infected with transgenic L. major and both transgenic and wild-type parasites, respectively) were re-infected with 1×105 wild-type promastigotes after 4 weeks, and the course of the disease was followed across 4 weeks (30).After four weeks (day 30), the mice in all groups were sacrificed and their spleens were excised. The weighted piece of spleen of each mice (~20 mg) (37) was homogenized in 2 ml of Schneider’s medium (Sigma, Germany) containing gentamicin 0.1% and FBS 20%, in a sterile condition by a tissue grinder. The homogenized tissues were diluted with the same medium from 1 to 10-10 in a 96-well plate and maintained for 7 days at 27 °C. Then, the attendance of motile parasites in wells was surveyed using an inverted microscope (40 magnification). The end titer was the dilution with a minimum of one live promastigote. Finally, the parasite burden/mg of tissue was obtained using the below formula:Parasite burden=-log10(parasite dilution/tissue weight) (38)Data were shown as means±SEM (standard error of the mean) and calculated using ANOVA, Tukey, and Multivariate tests. Also, SPSS 16 software was used for statistical analysis and the P-value<0.05 was considered for significant differences.
Results
In the present study, after subcloning the mLLO-Bax-Smac fragment in pLEXSY-neo2, the correct integration of sequence was confirmed using SalI/KpnI restriction enzymes, as the results showed two 7911bp and 2292bp fragments of the backbone of the plasmid and mLLO-Bax-Smac CDS, respectively. Then, we integrated the expression cassette of the mLLO-Bax-Smac fusion gene of pLEXY-mLLO-Bax-Smac into L. major genome using transfection through homologous recombination. The pLEXSY-neo2 vector is known as a common vector for transferring the gene in the 18srRNA region of the Leishmania genome through 5ʹuss and 3ʹuss and homologous recombination. 18srRNA promoter of Leishmania as well as signal peptide of SAP1 of pLEXSY-neo2, were used for expression and secretion of the fusion gene. Also, His-tag (6× his) was embedded at the C- terminal of fragment encoding mLLO-Bax-Smac (Figure 1).Furthermore, the gene script webserver was used to detect the CAI of the codon-optimized mLLO-Bax-Smac CDS, and increasing CAI from 0.58 to 0.91 showed a suitable index of expression.To generate transgenic Leishmania, the pLEXY recombinant vector was digested using the SwaI restriction enzyme and desired fragment (7880 bp) consisting of pLEXSY-mLLO-Bax-Smac was extracted from gel. Then, Leishmania was successfully transfected with a linear pLEXSY-mLLO-Bax-Smac plasmid, as resistant organisms were grown in a liquid medium including Geneticin up to 100 μg/ml concentration. Furthermore, the results of the MTT test revealed the same growth curve of both the transgenic and wild-type parasites, and integration did not show an impact on the metabolic rate and replication of Leishmania (P= 0.876) (Figure 2).
Figure 2
Comparison of growth curves of transgenic and wild-type Leishmania major was obtained from the MTT test (mean±standard deviation). Both parasites showed similar growth characteristics
Also, the correct integration of the mLLO-Bax-Smac expression cassette into the 18s rRNA ribosomal region of the L. major genome was confirmed after DNA extraction and PCRs analysis of the transfected Leishmania genome. The 1400pb band in long-range PCR showed upstream of the 18srRNA coding region on genomic DNA and some segments of the mLLO-Bax-Smac gene (Figure 3A). Moreover, the PCR analysis using specific primers of the mLLO-Bax-Smac sequence showed a 523 bp band that did not exist in control reactions (Figure 3).
Figure 3
(A): Long-range PCR on extracted genomic DNA of wild-type and transgenic Leishmania major using primers hybridizing to upstream of the 18srRNA locus. Lane M: DNA size marker; Lane 1: Wild-type L. major; Lane 2: 1.4 kbp PCR product showed fragment integration in transgenic L. major. (B): PCR with specific primers for mLLO-Bax-Smac construct on transgenic L. major genomic DNA. Lane M: DNA size marker; Lane 1: 523 bp PCR product in transgenic L. major confirmed both random and homologous integrations. Lane 2: Wild-type parasite; Lane 3: PCR with specific primers for ITS-1 gene on genomic DNA of wild-type L. major (positive control); Lane 4: PCR product without genomic DNA (negative control)
SDS–PAGE using the secretory protein of transgenic L. major showed a band ~23 kDa related to BAX fused to SMAC compared with the protein of wild-type parasite. Next, the Western blotting result showed a single band ~23 kDa related to the expression of BAX-SMAC-6-His fusion protein (Figure 4).
Figure 4
Western blotting analysis of BAX-SMAC-6-His fusion protein. (M): Pre-staining protein Marker (SMO431). (C): Secretory protein of wild-type Leishmania major. (SF): Condensed secretory fraction (with TCA 20%) of transgenic L. major
The linear culture results revealed hemolysis on the blood agar plate of transgenic parasites compared with the wild-type L. major 7 days later (Figure 5).
Figure 5
Hemolysis test on the blood agar culture. (A): Hemolysis caused by LLO expression in transgenic Leishmania major. (B): Absence of hemolysis because of non-expression of LLO in wild-type L. major
The Giemsa staining results of macrophages infected with wild-type and transgenic L. major parasites showed significant infection of the J744 cells (Figure 6). Furthermore, in statistical analysis of flow cytometry data, the mean of apoptosis percentage among 3 groups was different at 12, 24, and 48 hr (P-value<0.000), and revealed accelerated and higher apoptosis rate of macrophages infected with transgenic L. major versus the non-infected macrophages and macrophages infected with wild-type L. major. There was no significant difference between macrophages infected with wild-type L. major and non-infected macrophages at mentioned times (P=0.695, 0.207, and 0.958, respectively) (Figures 7 and 8).
Figure 6
Giemsa staining results of macrophage cells infected with (A): Transgenic Leishmania major and (B): wild-type L. major, 8 hr post-infection. Both images are at the same magnification×1000. Scale-bar represents 20 µm
Figure 7
Dot plots of macrophages infected with (A): wild-type and (B): transgenic Leishmania major at different times (12, 24, and 48 hr post-infection). FACS plots are gated on macrophage cells. X and Y axes are associated with Annexin V (apoptosis) and PI (necrosis), respectively. Plots show the three separate experiments for each group. Left bottom: viable cells; right bottom: early apoptosis; left top: necrosis; right top: late apoptosis
Figure 8
Comparing the mean of apoptosis percentages in the infected macrophages among 3 groups at various times (at 12, 24, and 48 hr). T= Macrophages infected with the transgenic parasite. S= Macrophages infected with wild-type parasite and JJ774A= non-infected macrophages. The macrophages infected with transgenic Leishmania major showed increased mean of apoptosis percentage statistically at all times compared with other groups, although there was not a significant difference between macrophages infected with wild-type L. major and non-infected macrophages
The appearance of lesions at the tail base of all 10 mice of 1 group during 7-10 days after injection confirmed the CL infection with wild-type parasites (Figure 9A), as the mean of ulcer size increased over time. During 40 days of follow-up, no nodules or lesions were observed in 10 mice injected with transgenic parasites (group 2) (Figure 9B). Also, only 3 mice of group 3 (mice injected with both wild-type and transgenic parasites) revealed small and delayed lesions compared with group 1 (Figure 10).
Figure 9
(A): Appearance of the lesion in the tail base of mice infected with wild-type parasite 10 days after injection. (B): lack of lesion or nodule at the tail base of mice infected with transgenic parasite 10 days after injection
Figure 10
Comparison of the ulcer size among three groups during 40 days. S: mice infected with wild-type parasite. T: mice infected with the transgenic parasite. S&T: mice infected with both wild-type and transgenic parasites. The T group did not show any lesions, and the S &T group revealed smaller lesions than the W group
Three weeks after re-infecting with the WT parasites, 3 of the 7 non-ulcered mice of the group injected with both transgenic and wild-type L. major (group 3) developed small nodules (without an ulcer), while none of the mice injected with transgenic parasites (group 2) showed lesions or nodules.The ANOVA test results showed the different parasitic burdens (P-value<0.000) in the spleen of mice infected with the transgenic parasite in comparison with mice infected with wild-type parasites and both wild-type and transgenic parasite. Also, the Tukey test showed a significant difference in spleen parasitic burden between groups 1 and 2 (P-value<0.000), groups 1 and 3 (P-value<0.000), and groups 2 and 3 (P-value<0.000) (Figure 11).
Figure 11
Comparing the mean of spleen parasitic burden among three groups.1: Mice infected with wild-type Leishmania major. 2: Mice infected with transgenic L. major. 3: Mice infected with transgenic and wild-type L. major. Group 2 showed a lower mean of spleen parasitic burden than groups 1 and 3. Furthermore, group 3 showed a lower mean of spleen parasitic burden than group 1
Discussion
Over the years, researchers have found that Leishmania as an intracellular organism can be resolved from the vertebrate host body exactly via induction of the cellular immune system. In this way, some physiologic properties of the macrophages can be used to accelerate this process. It seems that activation of early apoptosis of macrophages and the endosomal escape of intracellular pathogens like Leishmania could be a potent strategy to protect the human host. The first experiment for endosomal escape was performed by Kaufman et al. (39, 40) that developed a ∆ureC hly+ rBCG and evaluated the potency and safety of this transgene organism against tuberculosis.In this study, the mLLO-Bax-Smac fusion gene was inserted in L. major 18srRNA promoter using transfection. Leucine 461 in the LLO gene appears to be responsible for its high activity at pH<7. Replacement of non-polar leucine 461 with polar threonine eliminates the functional dependence of this enzyme on pH<7 by creating additional hydrogen bonds and reducing hydrophobicity, so the mutant enzyme can function in both neutral and acidic pH. Also, the cleavage site of furin was embedded to cut mLLO from BAX-SMAC using host phagosome furin. The designed sequence was codon-optimized based on the codon usage of L. major, as CAI (0.91) supported the efficient expression of mLLo-BAX-SMAC by L. major (41). Moreover, the molecular weight of the designed sequence was estimated at about 84 kDa and the Western blotting detected a band ~23kDa that belonged to BAX-SMAC-6×His. It proposes that probably the furin-like proteases have made incisions in the furin cleavage site of the fusion protein and decreased the protein size from 84 to 23 kDa.Thus, expression of the C-terminal fragment of the fusion protein (BAX-SMAC) confirmed the N-terminal fragment expression (mLLO). Furthermore, the observed hemolysis of transgenic L. major versus wild-type L. major confirmed the mLLO expression.The appearance of 1400 bp and 523 bp bands using PCR also verified proper replacement of the target sequence into the 18srRNA region of L. major via homologous recombination. Field et al. (30) also, constructed the transgenic L. major expressing the CD40L extracellular portion, and similar to our study, they showed the integration in the 18S rRNA gene did not affect the viability, as the growth curve for transgenic parasite was the same as wild-type L. major.Although, according to Jena Bioscience codon optimization increases expression (42), in this research, the secretory protein concentration of transgenic L. major was detected about 1.4 mg/ml which is a relatively low concentration in comparison with previous studies’ amounts like the Kianmehr et al. study (29(. However, in another study on the mLLO-Bax-Smac expression by transgenic L. infantum, we found a similar amount (1.5 mg/ml) of protein expression (27) which could be caused by lower copy number of the gene inserted in the host’s genome. Thus, further optimization of expression conditions such as the culture method probably could enhance the recombinant protein production.Moreover, the flow cytometry results revealed acceleration and increase of apoptosis rate in macrophages infected with transgenic L. major. Statistically, a significant difference was seen in the mean of apoptosis percentages of macrophages infected with transgenic parasites versus the wild-type parasite-infected macrophages at 12, 24, and 48 hr.According to the hemolysis test results, it can be proposed that the mutated LLO protein lyses the endocytic vesicles before developing secondary lysosomes with acidic pH. The study of Glomski et al. (43) revealed bacteria expressing natural and mutated LLO could destruct J774A macrophages within 8 and 5 hr post-infection, respectively. So, a significant difference in the apoptosis rate between transgenic and wild-type L. major parasites could be because of the secreted mutant LLO of the transgenic strain that demolishes the phagosomal membrane and facilitates the accession of the parasite antigens and phagosomal proteases into the cytosol.SMAC as an adjuvant to BAX protein along with BAX-SMAC fusion protein and other lysosomal proteases (like cathepsin) secretes from the phagolysosomes into cytosol which results in caspase activation, internal pathway induction, and enhanced apoptosis of macrophages infected with transgenic L. major. Hence, it could be suggested that apoptosis is not only due to BAX-SMAC protein expression (40). Similar to our study, Esseiva et al. (44) concluded that mammalian BAX expression induces trypanosomatid apoptosis (T. brucei), although contrary to our results the events mentioned in their study were temporary and also reversible.Furthermore, in vivo experiments revealed that integration of mLLO-Bax-Smac fragment into L. major genome affects the biomarkers and capability of the parasite to replicate and also induce infection in sensitive Balb/c mice. Contrary to the mice infected with wild-type parasite which showed lesions at the tail base, no nodules or lesions did appear in the transgenic L. major-infected mice. Probably, the suitable function of mLLO in perforating the phagosomal membrane and facilitating BAX-SMAC transfer into the host cell cytosol causes accelerated and enhanced apoptosis and also apoptotic body formation that finally result in TCD8+ and dendritic cell activation, the process referred to as cross-priming (40, 45). So, T cell-associated cellular immunity inhibits parasitic infection and lesion formation by preventing the promastigote differentiation into amastigote that finally led to a loss of nodule or lesion in this group. Also, only 1/3 of mice infected with both wild-type and transgenic L. major revealed small and delayed lesions in comparison with mice infected with wild-type L. major. Furthermore, the spleen parasitic burden of the control was higher than groups receiving transgenic parasites and transgenic plus wild-type parasites. Similar to our study, researchers (46) by generating transgenic L. major expressing murine chemokine monocyte chemoattractant protein 1 (MCP-1), showed that infection of C57BL/6, BALB/c, or MCP-1 knockout (KO) mice with these transgenic Leishmania caused small lesions with fewer parasites in the infected foot, spleen, and lymph node versus mice infected with the wild-type. Also, Field et al. (30) found that BALB/c mice infected with transgenic L. major encoding CD40L presented fewer lesions with lower parasites than animals infected with wild-type L. major.Also, we did not see any lesion or nodule after re-infecting mice protected with the transgenic parasite, whereas after re-infecting mice infected with wild-type plus transgenic L. major, small nodules were seen. It showed that BAX expressed by transgenic parasites is unable to act with complete efficiency due to the presence of wild-type parasites’ anti-apoptosis mechanisms. In agreement with our results, researchers (47) assayed the immunogenicity in C57BL/6 mice vaccinated with transgenic L. major encoding the thymidine kinase gene of Herpes Simplex Virus type 1 (HSV-TK) and cytosine deaminase gene of Saccharomyces cerevisiae (Se-cd)), as suicide genes. They concluded that the next re-infect in vaccination prevented disease progression which was due to inducible expression of the suicide genes and high level of immunity. Despite the limitations of this study, including long time and cost, this study is the first to make a transgenic L. major that expresses proapoptotic proteins (BAX-SMAC) that could be used as a protective agent or vaccine alternative to leishmanization against CL in endemic areas in the future.Schematic illustration of the pLEXSY-Neo2-mLLO-Bax-Smac expression vector. The mLLO-Bax-Smac fragment was subcloned in the pLEXSY-Neo2 vector in SalI/KpnI restriction sites. Also, the linearized plasmid with the SwaI restriction enzyme will integrate into the 18srRNA region of transfected Leishmania major genome by homologs recombination. Forward (F) and reverse (R) primers were shownPrimer information used in PCRComparison of growth curves of transgenic and wild-type Leishmania major was obtained from the MTT test (mean±standard deviation). Both parasites showed similar growth characteristics(A): Long-range PCR on extracted genomic DNA of wild-type and transgenic Leishmania major using primers hybridizing to upstream of the 18srRNA locus. Lane M: DNA size marker; Lane 1: Wild-type L. major; Lane 2: 1.4 kbp PCR product showed fragment integration in transgenic L. major. (B): PCR with specific primers for mLLO-Bax-Smac construct on transgenic L. major genomic DNA. Lane M: DNA size marker; Lane 1: 523 bp PCR product in transgenic L. major confirmed both random and homologous integrations. Lane 2: Wild-type parasite; Lane 3: PCR with specific primers for ITS-1 gene on genomic DNA of wild-type L. major (positive control); Lane 4: PCR product without genomic DNA (negative control)Western blotting analysis of BAX-SMAC-6-His fusion protein. (M): Pre-staining protein Marker (SMO431). (C): Secretory protein of wild-type Leishmania major. (SF): Condensed secretory fraction (with TCA 20%) of transgenic L. majorHemolysis test on the blood agar culture. (A): Hemolysis caused by LLO expression in transgenic Leishmania major. (B): Absence of hemolysis because of non-expression of LLO in wild-type L. majorGiemsa staining results of macrophage cells infected with (A): Transgenic Leishmania major and (B): wild-type L. major, 8 hr post-infection. Both images are at the same magnification×1000. Scale-bar represents 20 µmDot plots of macrophages infected with (A): wild-type and (B): transgenic Leishmania major at different times (12, 24, and 48 hr post-infection). FACS plots are gated on macrophage cells. X and Y axes are associated with Annexin V (apoptosis) and PI (necrosis), respectively. Plots show the three separate experiments for each group. Left bottom: viable cells; right bottom: early apoptosis; left top: necrosis; right top: late apoptosisComparing the mean of apoptosis percentages in the infected macrophages among 3 groups at various times (at 12, 24, and 48 hr). T= Macrophages infected with the transgenic parasite. S= Macrophages infected with wild-type parasite and JJ774A= non-infected macrophages. The macrophages infected with transgenic Leishmania major showed increased mean of apoptosis percentage statistically at all times compared with other groups, although there was not a significant difference between macrophages infected with wild-type L. major and non-infected macrophages(A): Appearance of the lesion in the tail base of mice infected with wild-type parasite 10 days after injection. (B): lack of lesion or nodule at the tail base of mice infected with transgenic parasite 10 days after injectionComparison of the ulcer size among three groups during 40 days. S: mice infected with wild-type parasite. T: mice infected with the transgenic parasite. S&T: mice infected with both wild-type and transgenic parasites. The T group did not show any lesions, and the S &T group revealed smaller lesions than the W groupComparing the mean of spleen parasitic burden among three groups.1: Mice infected with wild-type Leishmania major. 2: Mice infected with transgenic L. major. 3: Mice infected with transgenic and wild-type L. major. Group 2 showed a lower mean of spleen parasitic burden than groups 1 and 3. Furthermore, group 3 showed a lower mean of spleen parasitic burden than group 1
Conclusion
In this study, the persistent replacement of the mLL0-Bax-Smac gene into the L. major genome was done successfully. Also, secretion and expression of recombinant protein were verified and we found that transgenic L. major could enhance the macrophage apoptosis rate and induce less pathogenicity and more immunization in comparison with wild-type organisms. So, it seems that these findings can be proposed as an experimental model for creating a protective anti-leishmaniasis vaccine.
Authors’ Contributions
MA contributed to the conception of the work, conducting the study, drafting and revising the draft, and approval of the final version of the manuscript. HKh contributed to the conception of the work, conducting the study, and approval of the final manuscript. AJ contributed to conducting part of the experiments. ShA contributed to conducting the study, drafting and revising the draft, and approval of the final version of the manuscript. MN contributed to conducting part of the experiments. SMH analyzed study-obtained data. FN contributed to conducting part of the experiments. SHH directed the study and revised and approved the final version of the manuscript.
Ethical Approval
Experimental protocols of this study as a PhD thesis (No.394791) were approved by the Institutional Research and Ethics Committee of Medical Sciences, Isfahan University of Medical Science, Isfahan, Iran. The code of ethical approval for the study is IR.MUI.REC.1394.3.791.
Funding
The study was performed using a grant awarded by the Vice Presidency of Research of Isfahan University of Medical Sciences, Isfahan, Iran.
Data Access Statement
The data associated with this study are available upon reasonable request.