| Literature DB >> 35431996 |
Yazhe Ma1,2,3, Yuntao Fu1,2,3, Youcheng Wang1,2,3, Mei Yang1,2,3, Yajun Yao1,2,3, Shanqing He1,2,3, Dishiwen Liu1,2,3, Zhen Cao1,2,3, Xi Wang1,2,3, Yanhong Tang1,2,3, Qingyan Zhao1,2,3, Congxin Huang1,2,3.
Abstract
Previous studies have indicated that ganglionated plexi (GP) function influences atrial fibrillation (AF) vulnerability, and intermediate-conductance calcium-activated potassium channels (SK4) have a close relationship with cardiomyocyte automaticity and the induction of AF. However, the effects of the SK4 inhibitor on GP function and AF vulnerability are unknown. Eighteen beagles were randomly divided into a control group (n = 6), rapid atrial pacing (RAP) group (n = 6), and triarylmethane-34 (TRAM-34, an SK4 inhibitor) group (n = 6). TRAM-34 (0.3 ml, 15 mmol/L) and saline were locally injected into GPs in the TRAM-34 group dogs and dogs from the other groups, respectively. After that, dogs in the RAP and TRAM-34 groups were subjected to RAP, and the neural activity of anterior right GP (ARGP) and atrial electrophysiology were measured. The levels of inflammatory cytokines and function of macrophages in the ARGP were measured in the three groups. At 10 min after TRAM-34 injection, ARGP activity and atrial electrophysiology did not significantly change. The atrial pacing shortened effective refractory period (ERP) values at all sites and increased the AF vulnerability and ARGP neural activity, while TRAM-34 reversed these changes. The levels of CD68 + cells, induced nitric oxide synthase (iNOS), interleukin (IL)-1β, IL-6, and tumor necrosis factor (TNF)-α in the ARGP tissues were higher in the RAP group and TRAM-34 group than they were in the control group. Furthermore, the levels of the CD68 + cells, iNOS, and inflammatory cytokines in the ARGP tissues were higher in the pacing group than those in the TRAM-34 group. Based on these results, administration of TRAM-34 into the atrial GP can suppress GP activity and AF vulnerability during atrial pacing. The effects of TRAM-34 might be related to macrophage polarization and the inflammatory response of GP.Entities:
Keywords: atrial fibrillation; ganglionated plexi; inflammatory cytokine; intermediate-conductance calcium-activated potassium channels; macrophage polarization
Year: 2022 PMID: 35431996 PMCID: PMC9010666 DOI: 10.3389/fphys.2022.837412
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.755
FIGURE 1Experimental flow chart. Abbreviations: BS, baseline; RAP, rapid atrium pacing; M, measurement.
FIGURE 2ARGP activity at baseline and after rapid atrial pacing in the three groups. (A) ARGP activity at baseline, after 3 h, and after 6 h in the three groups; (B): Microelectrodes were inserted into the ARGP; (C,D) The frequency and the amplitude of ARGP in the three groups. The frequency and amplitude of ARGP activity was increased after rapid atrial pacing. TRAM-34 injection inhibited the increased ARGP activity. ***p < 0.01vs the control group and TRAM-34 group; ###p < 0.01vs the control group.
Primer sequences and amplicon sizes of genes validated by TaqMan™ RT-PCR.
| Gene Name | Accession No | Primer sequence (5′-3′) | Amplicon Size, bp | |
|---|---|---|---|---|
| GAPDH | NM_001003142.2 | sense | GAAGGTCGGAGTGAACGGATT | 249 |
| antisense | CATTTGATGTTGGCGGGATC | |||
| inos | NM_001313848.1 | sense | ACCAATACAGGCTCGTGCAG | 265 |
| antisense | GGGCTGTCTACTACTCGCTCC | |||
| Arg-1 | XM_532053.6 | sense | GGCAGAAGTCAAGAAGAACGG | 266 |
| antisense | CTTTGGCAGATAGGCAAGGAG | |||
bp, base pairs.
FIGURE 3Results of electrophysiological measurements. (A–F) ERP changes at RAA, LAA, RSPV, RIPV, LSPV, and LIPV during 6-h stimulation. *p < 0.05 vs baseline (G) Mean AF duration, and (H) Mean AF inducibility changes in the Control, RAP, and TRAM-34 groups. *p < 0.05 vs baseline; # p < 0.05 vs the RAP group. Abbreviations: RAA, right atrial appendage, LAA, left atrial appendage RSPV, right superior pulmonary vein, RIPV, right inferior pulmonary vein, LSPV, left superior pulmonary vein, LIPV, left inferior pulmonary vein, ERP, effective refractory period, AF, atrial fibrillation.
FIGURE 4Representative picture of AF induction in the three groups. In the control group, the burst pacing didn’t induce AF (A). In the TRAM-34 group, after 6 h pacing, the burst pacing didn’t induce AF (B). In the RAP group, after 6 h pacing, the burst pacing induced AF last for 21.3 s (C,D).
FIGURE 5Levels of CD68+, iNOS, and arg1 in the ARGP in the three groups. Representative images and quantitative analysis of immunofluorescence staining for CD68+ (red) in the ARGP (A,B) (n = 6, 40X). Quantitative analysis of RT-PCR of iNOS and arg1 in ARGP (C,D). RAP increased the secretion of inflammation cytokines and promoted macrophage polarization from M2 to M1 compared to that in the control group. However, TRAM-34 can attenuate this effect. ***p < 0.01vs the control group and TRAM-34 group; ###p < 0.01vs the control group.
FIGURE 6Levels of inflammatory cytokines in the three groups. Western blotting and quantitative analysis of IL-1β, TNF-α, and IL-6 in ARGP (A–C). ***p < 0.01 vs the control group and TRAM-34 group; ###p < 0.01vs the control group.