| Literature DB >> 35419351 |
Jingru Liang1, Hang Dong2, Fei Xu1, Baowei Li1, Haimei Li1, Limei Chen1, Mei Li1, Yingchu Liu3, Guosheng Jiang1,4, Jinhua Dong1,5.
Abstract
Estrogens are effective for stimulating several functions in living organisms and for regulating cancer development by promoting cell proliferation. Estradiol can disrupt the reproductive and endocrine systems, leading to the development of various diseases. In this study, the monoclonal antibody ESC9 was developed by immunizing mice with a 17β-estradiol (E2) conjugate, preparing an antibody phage display library, and screening monoclonal antibodies from the prepared library. An antibody with the same sequence as that of ESC9 has not been reported previously. The equilibrium dissociation constant between ESC9 and E2 was found to be 43.3 nM. Additionally, we generated an ESC9-derived immunosensor named as the ESC9 Quenchbody (Q-body), which can rapidly and sensitively detect E2. The assay can be completed within 2 min with a limit of detection of 3.9 pg/ml and half-maximal effective concentration of 154.0 ng/ml. Serum E2 levels were measured using the ESC9 Q-body without pretreatment with serum and with a high recovery rate of 83.3-126.7%. The Q-body immunosensor shows potential for clinical applications based on its excellent detection speed and sensitivity.Entities:
Keywords: estradiol; immunosensor; monoclonal antibody; phage display; rapid detection
Year: 2022 PMID: 35419351 PMCID: PMC8995505 DOI: 10.3389/fbioe.2022.818983
Source DB: PubMed Journal: Front Bioeng Biotechnol ISSN: 2296-4185
FIGURE 1Flow chart of antibody library construction and monoclonal antibody selection. VH: variable region of antibody heavy chain; VL: variable region of antibody light chain; CH1: constant region 1 of heavy chain; CL: constant region of light chain.
Primers for preparation of Fab expression vector.
| Primer name | Sequence (5′-3′) | Length (bp) |
|---|---|---|
| InfuAgeIESC9VHback | ACTGCTCTAATGAGACCGGTGAGGTTCAGCTGCAGCAGTCT | 41 |
| OverlapEcoRvMycFor | GTGATATCTCCTTCTAgaTTATTATGCGGCCCCATTCAGAT | 42 |
| OverlapEcoRvESC9VLback | TAGAAGGAGATATCACATGGATATTGTGATGACGCAGGCT | 40 |
| InfuHindIIIESC9VLfor | ACGTTTGATTTCaAGCTTGGTCCCAG | 26 |
| T7 promoter | TAATACGACTCACTATAGGG | 20 |
| T7 terminator | GCTAGTTATTGCTCAGCGG | 19 |
FIGURE 2Cloning of anti-E2 antibody. (A) ELISA of anti-E2 antibody in the sera of mice before and after immunization; (B) Gene amplification product of VH gene (400 bp) and VL gene (slightly smaller than VH gene); (C) ELISA of phage-displayed anti-E2 antibody; (D) ELISA of monoclonal antibodies screened from the phage displayed antibody library. E2: 17β-estradiol; M: DNA Marker (100–2000 bp); VH: variable regions of heavy chain; VL: variable regions of light chain; E2-BSA: conjugate of E2 and bovine serum albumin.
FIGURE 3Expression of antigen-binding fragment of ESC9 monoclonal antibody. (A) Construct of Fab expression vector; (B) SDS-PAGE analysis of purified ESC9 fragment; (C) ELISA of antigen-binding activity of purified Fab; (D) Sensorgram of bio-layer interference analysis of ESC9 Fab binding to E2. C: Cys-tag1; H: His6-tag; F: Flag-tag; CH1: constant region 1 of human IgG1 heavy chain; CL: constant region of antibody light chain.
Kinetic parameters of ESC9 Fab and Q-body for E2-binding.
|
|
|
|
| |
|---|---|---|---|---|
| ESC9-Fab | 1.32 ± 0.003 | 5.72 ± 0.07 | 43.3 ± 0.1 | 0.9908 |
| ESC9 Q-body | 1.26 ± 0.007 | 7.08 ± 0.06 | 56.2 ± 0.5 | 0.9783 |
FIGURE 4Analysis of Q-body sensor. (A) Coomassie Brilliant Blue staining and fluorescent image of separated Q-body in SDS-PAGE; (B) ELISA of antigen-binding activity of E2 Q-body; (C) Sensorgram of bio-layer interference analysis of ESC9 Q-body binding to E2; (D) Fluorescent spectra of Q-body in PBST and denaturing reagent. M: Precision Plus Protein™ Unstained Protein Standards with 1/50 of Precision Plus Protein™ Dual-color Protein Standards (Bio-Rad); PBST: PBS containing 0.5% Tween 20; GdnHCl/DTT: 7 M guanidine hydrochloride and 100 mM dithiothreitol in PBST.
FIGURE 5Detection of E2 with ESC9 Q-body. (A) Scheme for E2 detection with the ESC9 Q-body; (B) Fluorescent spectrum of the ESC9 Q-body for E2 detection; (C) Concentration-dependent relationship curve for the detection of E2 with ESC9 Q-body.
Recovery of spiked E2 in human serum.
| Spiked conc. (ng/ml) | Detected conc. (ng/ml) | Recovery (%) | |
|---|---|---|---|
| Rate | RSD | ||
| 0.1 | 0.083 | 83 | 6.2 |
| 1.0 | 1.27 | 127 | 10.3 |
| 100 | 105 | 105 | 11.4 |