Literature DB >> 35417489

Retinoid-X receptor agonists increase thyroid hormone competence in lower jaw remodeling of pre-metamorphic Xenopus laevis tadpoles.

Brenda J Mengeling1, Lara F Vetter1, J David Furlow1.   

Abstract

Thyroid hormone (TH) signaling plays critical roles during vertebrate development, including regulation of skeletal and cartilage growth. TH acts through its receptors (TRs), nuclear hormone receptors (NRs) that heterodimerize with Retinoid-X receptors (RXRs), to regulate gene expression. A defining difference between NR signaling during development compared to in adult tissues, is competence, the ability of the organism to respond to an endocrine signal. Amphibian metamorphosis, especially in Xenopus laevis, the African clawed frog, is a well-established in vivo model for studying the mechanisms of TH action during development. Previously, we've used one-week post-fertilization X. laevis tadpoles, which are only partially competent to TH, to show that in the tail, which is naturally refractive to exogenous T3 at this stage, RXR agonists increase TH competence, and that RXR antagonism inhibits the TH response. Here, we focused on the jaw that undergoes dramatic TH-mediated remodeling during metamorphosis in order to support new feeding and breathing styles. We used a battery of approaches in one-week-old tadpoles, including quantitative morphology, differential gene expression and whole mount cell proliferation assays, to show that both pharmacologic (bexarotene) and environmental (tributyltin) RXR agonists potentiated TH-induced responses but were inactive in the absence of TH; and the RXR antagonist UVI 3003 inhibited TH action. Bex and TBT significantly potentiated cellular proliferation and the TH induction of runx2, a transcription factor critical for developing cartilage and bone. Prominent targets of RXR-mediated TH potentiation were members of the matrix metalloprotease family, suggesting that RXR potentiation may emphasize pathways responsible for rapid changes during development.

Entities:  

Mesh:

Substances:

Year:  2022        PMID: 35417489      PMCID: PMC9007347          DOI: 10.1371/journal.pone.0266946

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

An organism’s acquired ability to respond both qualitatively and quantitatively to a physiological signal, defined as competence, is distinguished between endocrine signaling during development, which tends to lead to irreversible, organizational effects, from that of healthy adult tissues, which controls the functioning of tissues and organs to maintain homeostasis. Thyroid hormone (TH) action regulates many aspects of vertebrate development including cartilage growth and skeletogenesis [1-4]. Over developmental time, the vertebrate organism traverses from low to high TH competence [5]. Vertebrate development depends upon appropriate timing and concentrations of TH for good biological outcomes. During human development, adverse outcomes arise from both insufficient and excessive TH [1, 6–10]. However, analysis of the effects of TH on mammalian development are confounded by maternal effects due to the nature of intrauterine growth. Amphibian metamorphosis, the process through which free-living larval tadpoles develop into adult frogs provides an accessible and dramatic model for direct investigation of the role TH plays during vertebrate development [11-14]. Metamorphosis is initiated and maintained through the action of TH [15-18]. The African clawed frog, Xenopus laevis, is an effective laboratory model for assessing the role of TH throughout development, and its metamorphosis has been shown to model the essential perinatal surge in TH signaling in humans [11, 14]. In all vertebrates, TH acts through the thyroid hormone receptors (TRs), which are DNA-binding, ligand-regulated transcription factors of the nuclear receptor (NR) superfamily [19, 20]. THs are identical across all taxa, and the TRs are highly conserved between X. laevis and humans [12, 13]. Two isoforms of TR are expressed from two different genes, TRα and TRβ. In X. laevis tadpoles, TRα is expressed before synthesis of THs commences [21], whereas TRβ expression is induced after the nascent thyroid gland begins to synthesize THs through TH binding to TRα; it is a direct target gene of TRs [22, 23]. 3,3’,5-triiodo-L-thyronine (T3) is the TH with the highest affinity for the TRs [24-26]. TRs heterodimerize with another NR, the retinoid-X receptors (RXRs) [27]. RXRs bind several natural ligands, including 9-cis retinoic acid, and they can dimerize with many different NRs in addition to TRs [28]. The TR-RXR heterodimer shows higher affinity for DNA, especially in the presence of T3, than the TR-TR homodimer [29]. In most adult tissues and cells, RXR ligands are unable to affect the action of the TR-RXR heterodimer [30, 31]. Pituitary cells are an exception, wherein RXR ligands do affect the ability of TR to control the hypothalamus-pituitary-thyroid (HPT) axis [32]; the biological reasons for this are not understood. In fact, the pharmaceutical RXR agonist used in this study, bexarotene (brand name Targretin, Bex), produces severe hypothyroidism in patients given the drug, which limits its use as a chemotherapeutic [33-35]. However, given the inability of RXR ligands to affect TR function in peripheral tissues, such as the liver—a major site of TR function—the TR-RXR heterodimer is generally considered to be an example of a “non-permissive” RXR heterodimer, meaning that only the ligand for the TR, T3, can induce activation. Due to the importance of TH signaling for proper development, man-made chemicals that disrupt TR action have the potential to produce adverse outcomes [36]. Tributyltin (TBT) is a pervasive environmental pollutant from its use as an antifoulant in marine paints that was the first described endocrine disruptor, when it was discovered that exposure to TBT caused marine gastropods to develop imposex phenotypes, where female gastropods develop male secondary sex characteristics [37, 38]. Mechanistic work determined that TBT functioned through the mollusk RXR, and that treating marine gastropods with either 9-cis retinoic acid or TBT produced the same imposex phenotype [39-41]. In our rat pituitary reporter cell line, TBT behaved like Bex, strongly suggesting that it was functioning as an RXR agonist [42, 43]. These results left open the question as to whether RXR agonists in a developing organism would behave like RXR agonists in most adult tissues (i.e. RXR agonists have no effect on TR action) or in our pituitary reporter cell line (i.e. RXR agonists could modulate TR function). In order to understand the role of disruptors of TR and RXR on developmental TH action, we developed a suite of quantitative assays to assess function and possible disruption of TH action in 1-week post-fertilization (1wk-PF) tadpoles (NF 48) [44]. 1wk-PF tadpoles express TRα, but they do not yet have an active thyroid gland; therefore, they are TH negative and are considered pre-competent [21]. Addition of T3 to their rearing water activates many metamorphic pathways, but the addition of T3 does not make their TH competence complete. For example, tail resorption, the last step of metamorphosis, is minimal even under supraphysiological doses of exogenous T3 [45]. We found that co-treatment of Bex or TBT with T3 significantly potentiated the action of T3 in the tail [43, 46]. In effect TBT/Bex increased T3 competence in the tail to near metamorphic levels. At the transcriptomic level, we found that TBT acted identically to Bex, solidifying that the mechanism of TBT action on TH function was at the level of RXR agonism [46]. Amphibian metamorphosis affects almost every tissue system and cell fate decision. Some larval tissues are resorbed like tail and gills, some adult tissues are formed de novo like limbs, and other larval tissues are remodeled like the lower jaw (LJ). Although both retinoic acids (RAs) and TH are important for appropriate craniofacial and jaw development, with RAs acting through retinoic acid receptors (RARs), another NR family member that heterodimerizes with RXRs, they function at different times. RAR signaling is necessary early for neural crest cell specification and migration [47-49]. TH action is required for correct maturation and ossification [1], which occurs late in development. In tadpoles these processes are separated by several weeks, with jaw cartilages having been formed by 98 h-PF (NF-45) [50], and ossification of the jaw occurring late in metamorphosis (approximately two months PF) [51, 52]. At the time of our assaying the effects of RXR ligands on TH action, 1-wk-PF (NF-48), the tadpoles have entered a multi-week period of isometric growth [51], wherein further morphological changes do not occur without exogenous intervention. During metamorphosis, TH induces the jaw to remodel to facilitate the transition from an herbivorous tadpole to a carnivorous adult frog. Visible jaw morphological changes start at NF 59, which is approximately 45 days post-fertilization (PF) under ideal rearing conditions [52, 53]. Thomson describes three phases of Meckel’s cartilage (MC) development in the LJ: 1) a lag phase (NF 57–59) with low levels of cell proliferation, 2) a division phase (NF 60–62) of rapid cell division, and 3) a synthesis phase (NF 62–66) wherein the matrix content of the cartilage increases significantly [54, 55]. Rose showed that tadpoles prior to NF 57 (~41 days PF) respond to the TH but the beak-like morphological changes that result are not seen in a natural metamorphosis [53]. Between NF 48 and NF 57 significant, non-TH-induced isometric growth occurs to the cartilages of the lower jaw, and this growth appears to be essential for producing appropriate morphology upon TH administration. Bearing this in mind, we investigated whether RXR ligands were able to potentiate the T3-induced changes that are possible at NF 48, where we have an extant suite of quantitative assays to monitor potential disruption of T3 action, and when the jaw is developmentally quiet [44]. We found that both Bex and TBT potentiated T3-induced proliferation, the activation of runx2, a transcription factor necessary for maturation of cartilage and bone ossification, and the matrix metalloproteases mmp11 and mmp13l. In addition, the RXR antagonist UVI 3003 (UVI) [56] prevented T3-induced morphological changes, inhibited proliferation, and it selectively inhibited gene transcription. Finally, Bex and TBT still potentiated T3 action in the LJ in tadpoles at NF 54, which are considered prometamorphic and fully competent to respond to THs.

Materials and methods

Reagents

3,3’,5-triiodo-L-thyronine (T3, T6397-100MG) and tributyltin chloride (TBT, T50202-5G) were purchased from MilleporeSigma (Burlington, MA) and Bexarotene (Bex, 5819/10 and UVI 3003 (UVI, 3303/10) were purchased from Tocris Biosciences (Bio-Techne, Minneapolis, MN). All treatment ligands were dissolved or diluted in dimethyl sulfoxide (DMSO, Thermo Fisher Scientific, Waltham, MA). oLH (ovine luteinizing hormone) was purchased through the National Hormone and Peptide Program (Los Angeles, CA), pregnant mare serum gonadotropin was purchased from Thermo Fisher Scientific, and tricaine methanesulfonate was purchased from Western Medical Supply (Arcadia, CA).

Animal husbandry

The laboratory has an approved University of California Davis Institutional Animal Care and Use protocol that covers the husbandry and mating of adult Xenopus laevis frogs and ligand exposure of larval tadpoles. Wild-type X. laevis frogs were mated and embryos cultured as described [44].

Tadpole precocious metamorphosis morphology assay

NF 48 (1-week post-fertilization) tadpoles were treated, fixed for photography, and dorsal head photos taken using a Leica DFC3000 G camera on a Leica MZLFIII microscope as described [43, 44]. Treatment concentrations, unless otherwise indicated, were 10 nM T3, 30 nM Bex, 1 nM TBT, and 600 nM UVI, based upon previous results. The angle of the lower jaw was measured using the FIJI [57] distribution of ImageJ [58]. GraphPad Prism 9 (GraphPad Software, La Jolla, CA) was used to generate box and whisker plots, where boxes represent the 25th to 75th percentiles with the bar at the median, and whiskers are maximum and minimum values. For statistical analyses, each animal counted as an individual, and 2 clutches (ten tadpoles/clutch) were assayed independently to control for clutch-to-clutch variability. NF 54 tadpoles were treated as NF 48 animals except that the volume/tadpole of rearing water was increased to 50 ml, and treatments were stopped at three days rather than five, due to the extreme gill resorption in the T3 + Bex animals. Three independent clutches of NF 54 tadpoles were used with 4–5 tadpoles per clutch.

Alcian blue staining of cartilage

NF-48 tadpoles treated and fixed as for morphology, were stained with Alcian blue to visualize cartilage based on guidelines for whole mount Xenopus [59]. In brief, fixed tadpoles were bleached overnight in 50% ethanol/3% hydrogen peroxide and then transferred through an ethanol series up to 100% ethanol. Dehydrated tadpoles were stained for 2–3 h in 0.2% Alcian blue 8GX (Sigma-Aldrich, A5268)/70% ethanol/30% glacial acetic acid. Samples were washed 2–3 times in 70% ethanol/30% glacial acetic acid, and then allowed to destain over night. Tadpoles were rehydrated through a decreasing ethanol series, then cleared in 0.25% trypsin/30% saturated borax for 30 min at room temperature, and then stored at 4°C in PBS/0.02% sodium azide. Alcian blue stained tadpoles were photographed using a Leica MZ16F microscope and a Leica DFC 500 camera.

Immunohistochemistry of lower jaws for proliferation

The lower jaws from tadpoles fixed as for morphology were removed as follows: a straight cut was made just posterior to the olfactory epithelium and anterior to the eyes. The upper and lower jaw were separated, and two diagonal cuts were made on the outer rim of the jaw to separate the cartilage from the excess tissue. LJs were treated as described for immunohistochemical analysis of phospho-Histone H3 reactivity [44, 60]. Anti-phospho-Histone H3 (Ser10) was from EMD Millepore (06–570, 1/300 dilution), and goat anti-rabbit IgG (H+L) conjugated with Alexa Fluor 488 was from Molecular Probes (A11008, 1/400 dilution). Positive cells were counted from blinded images using the Cell Counter tool of Fiji and normalized to the area counted to control for changes in jaw size with treatment.

Gene expression

Tadpoles were treated with ligands for 48 hours as for morphology and as described [43, 46], using a 2-way ANOVA design: vehicle (DMSO), T3, RXR ligand, and T3 + RXR ligand. Lower jaws were isolated from unfixed tadpoles as for immunohistochemistry. Pools of 15 LJs from a single clutch were used for total RNA extraction. LJ tissue was disrupted and homogenized by bead beating with two 0.125-inch stainless steel beads for 1 minute in a Mini-Beadbeater-16 (Biospec Products, Bartlesville, OK). Total RNA was extracted using the RNeasy Plus Mini Kit per the manufacturer’s instructions (Qiagen, Germantown, MD). Total RNA was quantified using a NanoDrop (Thermo Fisher Scientific, Waltham, MA). One microgram of total RNA was used to synthesize cDNA with the High-Capacity Reverse Transcription Kit (Thermo Fisher Scientific), and 0.5 μl of cDNA from a 20-μl reaction was used in a 10-μl reaction using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) in a Roche LightCycler 480. The X. laevis rpl8 gene was used as a normalizer. Statistics were performed using 2-way ANOVA analysis with a Sidak’s multiple comparison test (MCT) in GraphPad Prism 9. Sequences for the primers used for quantitative PCR are given in Table 1.
Table 1
GeneForwardReverseProduct Size (bp)Allele specificity
aurkb AACATGGCCGCTTTGATGAG ATGTCTCTGTGGATGACTTTCCTTTC 100both
mmp11.L GCCGGCTCATGTTTCTTACC GCAGTTCTACTGATCCCATTGC 129L
mmp13l GAAGAAGCCAGGACCTTGGAT CAAATTGCAGAGCTCCGTTGA 133both
rpl8 GGTTGCATTCCGTGATCCTTA GCTGAGCTTTCTTGCCACAGT 107both
runx2 GCCGCAACTTGCCTTATGTC GGCTCAAAGGCAAGCGATTT 112S
thibz TGAACCTCAACCAATGCCTCA CCAGAAGCACCTCCCTTAAACC 150both
thrb GTGCCAGGAAGGTTTCCTCTT GGTCGGTGACTTTCATCAGCA 100both

Transgenic tadpole luciferase reporter assay

NF 54 tadpoles, sorted at 1wk-PF for GFP+ expression in the eye lens, were staged by assessing morphology of the hind limb, according to the normal scale by Nieuwkoop and Faber [61], and then treated through their rearing water for two days as previously described [46]. Treatment concentrations were 10 nM T3 and 2 nM TBT. No mortality arose from the treatments over the treatment period. After treatment, tadpoles were anesthetized in 0.1% MS-222 (Western Medical) buffered with 0.1% sodium bicarbonate. The LJs were excised and minced on ice prior to freezing and then processed and assayed as described [44]. Each animal was treated as an individual for statistical purposes (n = 9 per treatment) from two independent clutches (4 animals in one clutch and 5 in the other). Two-way ANOVA using clutch and treatment as covariates with Tukey’s MCT to compare treatments was used from GraphPad Prism 9.

Results

RXR agonists potentiate T3-induced morphological changes to the lower jaw, and an RXR antagonist abrogates T3 effects

Using our precocious metamorphosis assay system, we treated X. laevis 1wk-PF tadpoles (NF 48) for five days by exposure through their rearing water with vehicle or 10 nM T3 in the presence or absence of RXR ligands. This treatment period did not result in animal mortality under any of the treatment conditions. Previously, we found that 30 nM Bex and 1 nM TBT produced maximal, non-toxic responses, and so we used them here [43, 46]. The dorsal head photos in Fig 1 show representative animals from each treatment regimen. Vehicle treatment resulted in normal tadpole morphology (Fig 1A), and treatment with the RXR ligands in the absence of T3 (Fig 1B–1D) did not result in morphological changes. Treatment with 10 nM T3 (Fig 1E) resulted in visible gill resorption and decreased the angle of the LJ. Co-treatment with either RXR agonist, Bex or TBT, potentiated the T3-inductions of gill resorption and the angle of Meckel’s-infrarostral (IR) cartilages of the LJ (Fig 1F and 1G). However, co-treatment with the RXR antagonist UVI 3003, abrogated the effect of T3 on both morphologic phenotypes.
Fig 1

RXR agonists potentiate T3-induced changes to lower jaw morphology, while an RXR antagonist abrogates T3 action.

a-h: Representative dorsal head photos of tadpoles treated for five days starting at 1wk-PF (as indicated: DMSO, 10 nM T3, and 30 nM Bex, 1 nM TBT, 600 nM UVI with or without T3). i-k: Quantification of changes to the LJ angle. Boxes represent 25th-75th percentiles with the line at the median (n = 10–15 from 2–3 clutches), and whiskers represent the min and max values. Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001). l: Effect of Bex and TBT on T3-induced LJ angle changes as a function of time. Data points represent means from 20 animals from two different clutches; error bars delineate the 95% confidence intervals, indicating statistical significance. m: Treatment with 30 nM Bex augments LJ angle narrowing as a function of T3 dose. Statistics are the same as in the time course, although the clutches were different.

RXR agonists potentiate T3-induced changes to lower jaw morphology, while an RXR antagonist abrogates T3 action.

a-h: Representative dorsal head photos of tadpoles treated for five days starting at 1wk-PF (as indicated: DMSO, 10 nM T3, and 30 nM Bex, 1 nM TBT, 600 nM UVI with or without T3). i-k: Quantification of changes to the LJ angle. Boxes represent 25th-75th percentiles with the line at the median (n = 10–15 from 2–3 clutches), and whiskers represent the min and max values. Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001). l: Effect of Bex and TBT on T3-induced LJ angle changes as a function of time. Data points represent means from 20 animals from two different clutches; error bars delineate the 95% confidence intervals, indicating statistical significance. m: Treatment with 30 nM Bex augments LJ angle narrowing as a function of T3 dose. Statistics are the same as in the time course, although the clutches were different. In order to quantify the effects of T3 and the RXR ligands on Meckel’s and IR cartilages, we measured the angle of the LJ (Fig 1I–1K) from independent clutches of tadpoles, using ten animals per clutch. The inset photos (Fig 1A, 1E and 1F) show the change in angle that was measured. This facile and highly reproducible measurement, which is very useful for screening purposes, was validated through cartilage staining (see below). Protrusion of the Meckel’s and IR cartilages caused a decrease in the LJ angle. Fig 1I shows that in the presence of T3, 30 nM Bex significantly potentiated the decrease in the LJ angle (compare red boxes). 2-way ANOVA analysis indicated significance for the interaction between T3 and Bex (p < 0.0001). As with our study on the effects of RXR agonists on T3-induced tail resorption, 1 nM TBT behaved almost identically to 30 nM Bex; the interaction between T3 and TBT was significant (p < 0.0001). In contrast, co-treatment of T3 and the RXR antagonist UVI prevented T3 action, and the LJ angle was not significantly changed from vehicle-treated tadpoles (Fig 1K); however, due to the strong abrogation of the T3-induction by UVI, the interaction between T3 and T3+UVI was still significant by 2-way ANOVA (p < 0.0001). Fig 1L shows the LJ angle measurement as a function of treatment time. Again, co-treatment of either Bex or TBT with T3 caused an identical response that showed an acceleration of the LJ cartilage protrusion. Tadpoles treated for four days with T3 plus RXR agonist had the same decrease in LJ angle as tadpoles treated for five days with T3-alone. Over a T3-dose curve (Fig 1M), the T3-induced decrease in LJ angle was significant starting at 5 nM T3 (error bars represent the 95% confidence interval), and all doses of T3 in the presence of Bex showed a significantly reduced LJ angle compared to T3-alone, such that 5 nM T3 plus Bex/TBT produced the same LJ angle as 15 nM T3, which is the dose that produces the maximal change in LJ angle. The angle of the LJ measurement provides a straightforward method to determine whether a treatment compound can disrupt TH signaling in the LJ; however, it doesn’t allow us to make statements at the level of the cartilages that provide the structure of the LJ. Therefore, we stained the cartilage with Alcian blue in 1wk-PF, whole tadpoles treated for five days with T3 in the presence or absence of Bex and TBT. Cartilage staining in tadpoles treated with only Bex or TBT was indistinguishable from vehicle-treated (DMSO) tadpoles. Fig 2A–2D shows representative ventral-side heads for each treatment stained with Alcian blue to visualize the cranial cartilages. In the vehicle-treated (DMSO, Fig 2A) the four cartilages visible from the ventral side are all present and distinct: the IR, Meckel’s (MC), the ceratohyal (CH), and the branchial arches (BA) of the gills. The IR and MC appear as two distinct cartilages. After treatment with T3 (Fig 2B), the BA are partially resorbed, and the IR and MC appear fused. Co-treatment of either Bex (Fig 2C) or TBT (Fig 2D) potentiates T3 action to the extent that BA resorption appears complete, while the LJ cartilages remain deeply stained. We found that T3-alone or in combination with either Bex (Fig 2E) or TBT (Fig 2F) did not result in an increase in the length of the MC; this agrees with a previous report of exogenous TH induction of metamorphosis [53]. In addition, measurement of the LJ angle from the stained MC and IR (Bex, Fig 2G and TBT, Fig 2H) gave results nearly identical to those from the unstained DH photo (Fig 1I and 1J), validating the use of the more facile measurement of fixed, unstained tadpole LJ angles.
Fig 2

RXR agonists potentiate T3-induced remodeling of LJ cartilage and resorption of gill cartilage.

Representative ventral head photos of tadpoles treated for five days starting at 1wk-PF with vehicle (DMSO, a), 10 nM T3 (b), 10 nM T3 + 30 nM Bex (c), or 10 nM T3 + 1 nM TBT (d) and then stained with Alcian blue to visualize cartilage. MC, Meckel’s cartilage; IR, infracostal cartilage; CH, ceratohyal cartilage; and BA, branchial arches. e-f: Meckel’s cartilage lengths do not change with treatment. g-h: Changes in LJ angle measured from the end of the MC to the middle of the IR to the end of the opposite MC. Box plots are as in Fig 1 (n = 10 from 2 clutches of five per treatment. Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001).

RXR agonists potentiate T3-induced remodeling of LJ cartilage and resorption of gill cartilage.

Representative ventral head photos of tadpoles treated for five days starting at 1wk-PF with vehicle (DMSO, a), 10 nM T3 (b), 10 nM T3 + 30 nM Bex (c), or 10 nM T3 + 1 nM TBT (d) and then stained with Alcian blue to visualize cartilage. MC, Meckel’s cartilage; IR, infracostal cartilage; CH, ceratohyal cartilage; and BA, branchial arches. e-f: Meckel’s cartilage lengths do not change with treatment. g-h: Changes in LJ angle measured from the end of the MC to the middle of the IR to the end of the opposite MC. Box plots are as in Fig 1 (n = 10 from 2 clutches of five per treatment. Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001).

RXR agonists potentiated, and the antagonist inhibited, T3-induced cellular proliferation in Meckel’s and IR cartilage

In young tadpoles, exogenous T3 administration triggers cell proliferation in several tissues, including the LJ [60]. We excised LJs after four days of treatment for whole mount immunohistochemistry (IHC) of the mitotic marker phosopho-Ser10 Histone 3 (pH3) to assess the effects of T3 and RXR ligands on cellular proliferation in Meckel’s-IR cartilage. 1wk-PF tadpoles were treated for four days instead of five to facilitate LJ removal; T3-induced changes to the overall head structure make removing the LJ more difficult after five days of treatment. Proliferative cells were counted from blinded images over the area of MC-IR (Fig 3A). Fig 3B–3F show representative photos of different ligand treatment combinations from which proliferative cells were counted and normalized to the area counted. For quantification, each combination of T3 and RXR ligand were assayed with two independent clutches, and for each clutch, RXR ligand effects were significant. Fig 3G–3I shows the two clutches combined for each group. Vehicle-treated LJs had few proliferative cells (Fig 3G–3I). In contrast, treatment with 10 nM T3 increased the number of mitotic cells at least 15-fold for each treatment group. Co-treatment of either 30 nM Bex (Fig 3G) or 1 nM TBT (Fig 3H) RXR agonists with T3 resulted in a significant increase in the number of proliferating cells in the MC-IR cartilage. Since the RXR agonists induced a significant increase in proliferative cells, we expected that co-treatment of the RXR antagonist UVI with T3 would result in a decrease in proliferative cells. Fig 3I shows that UVI significantly inhibited cellular proliferation in the MC-IR. Aurora kinase B (aurkb) is the kinase that performs the phosphorylation of Ser10 of H3. T3 induced aurkb mRNA expression (Fig 3J–3L). However, neither Bex (Fig 3J) nor TBT (Fig 3K) significantly increased that induction, and UVI inhibition of aurkb was not significantly different from T3-alone (p = 0.081) (Fig 3L). These results suggest that a significant increase in aurkb message levels are not necessary for producing the increase in H3-phosphorylation-positive cells seen in T3-RXR agonist co-treatment, and that RXR antagonist inhibition of proliferation doesn’t require a significant decrease in aurkb expression. Taken together, the data suggest that proliferation is either being controlled by a different mechanism than simply altering aurkb expression, or that significant changes in aurkb message are not required for significant changes in Aurkb kinase activity.
Fig 3

RXR agonists potentiate T3 action on cellular proliferation in the LJ of 1wk-PF tadpoles.

a: MC-IR region used for quantitation of proliferation. b-f: Representative photos of the effects of different treatments on proliferation using phopho-Ser10-H3 reactivity. g-i: Quantification of proliferation in the presence and absence of T3 and RXR ligands normalized to the area counted. Boxes and statistics are as in Fig 1 (n = 20–30 jaws from 2–3 clutches). j-l: RXR ligands do not significantly affect the T3-induced expression of aurora kinase B mRNA (aurkb). Bars represent the mean of 3–6 independent clutches, and statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001; **, p < 0.01; *, p < 0.05).

RXR agonists potentiate T3 action on cellular proliferation in the LJ of 1wk-PF tadpoles.

a: MC-IR region used for quantitation of proliferation. b-f: Representative photos of the effects of different treatments on proliferation using phopho-Ser10-H3 reactivity. g-i: Quantification of proliferation in the presence and absence of T3 and RXR ligands normalized to the area counted. Boxes and statistics are as in Fig 1 (n = 20–30 jaws from 2–3 clutches). j-l: RXR ligands do not significantly affect the T3-induced expression of aurora kinase B mRNA (aurkb). Bars represent the mean of 3–6 independent clutches, and statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001; **, p < 0.01; *, p < 0.05).

RXR agonist potentiation of gene expression is gene specific

Our previous work examining the role of RXR ligands to perturb T3-mediated gene expression in the tails of 1-wk-PF tadpoles after a 48-hour induction, showed that the bona fide TR target gene for TRβ, thrb, was modestly, but significantly, potentiated by the RXR agonists and inhibited by the antagonist when assayed at the transcriptomic level using Tag-Seq. However, over a time course assayed by RT-qPCR, the same two-day time point showed no significant potentiation and inhibition by the agonists and antagonist, respectively [46]. Using RT-qPCR to assess thrb expression in the LJ after two days of treatment, we found significant activation by T3 (white bars in Fig 4A), but neither Bex nor TBT potentiated that induction (slashed bars in Fig 4A, Bex, TBT). UVI also did not inhibit the T3 induction (slashed bar in Fig 4A, UVI). TH-bZIP is a transcription factor that is one of the most strongly TH-induced genes during metamorphosis. It is encoded by the thibz gene, and it is another TR direct target gene, having at least two TREs in the promoter region [62]. In the LJ, T3 strongly induced thibz expression (Fig 4B, white bars), but the RXR agonists did not potentiate the signal (Fig 4B, slashed bars, Bex, TBT). However, UVI did significantly reduce the T3 induction of thibz (Fig 4B, slashed bar, UVI). In the tail, we found the same outcome: the RXR agonists did not affect thibz expression, but the RXR antagonist significantly did [43, 46]. These results strongly suggest that the RXR agonists and antagonist are not always operating reciprocally.
Fig 4

RXR ligands have gene-specific effects on T3-induced differential gene expression.

Left column: The effect of RXR agonist Bex on T3-induced gene expression. Middle column: The effect of environmental RXR agonist TBT on T3-induced genes. Right column: The effect of RXR antagonist UVI on T3-induced genes. Striped bars indicate the presence of the RXR ligand, and white bars show induction in the absence of the RXR ligand. Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001; **, p < 0.01; *, p < 0.05).

RXR ligands have gene-specific effects on T3-induced differential gene expression.

Left column: The effect of RXR agonist Bex on T3-induced gene expression. Middle column: The effect of environmental RXR agonist TBT on T3-induced genes. Right column: The effect of RXR antagonist UVI on T3-induced genes. Striped bars indicate the presence of the RXR ligand, and white bars show induction in the absence of the RXR ligand. Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001; **, p < 0.01; *, p < 0.05). During metamorphosis, matrix metalloprotease activity is essential for both tissue resorption and tissue remodeling. We and others have shown the importance of stromelysin-3 (mmp11) and collagenase-3 (mmp13l) expression [63-65]. We found in the LJ that mmp11 was strongly activated by T3 (white bars in Fig 4C). Co-treatment with 30 nM Bex increased mmp11 expression, although this result did not reach statistical significance (p = 0.068), using the maximal number of biological replicates (n = 6) recommended for pooled, outbred animal tissues. However, co-treatment of T3 with 1 nM TBT did result in significantly potentiation of mmp11 expression (n = 3, p = 0.0004). Furthermore, UVI inhibited the T3 induction of mmp11 significantly (n = 4, p = 0.001). In the experiments using Bex, even though T3 on its own activated the mmp13l gene 20.8-fold (S.E.M. = 4.95) (white bars in Fig 4D), this activation did not reach statistical significance (p = 0.0589), like it does in the tail. However, co-treatment with Bex increased mmp13l activation to significance (p < 0.0001) compared to both vehicle and T3-only treatments (slashed bar in Fig 4D, Bex). This situation held true for co-treating T3 with TBT (slashed bar in Fig 4D, TBT): T3-alone activation of mmp13l was not significant (p = 0.65), while T3 + TBT treatment was significantly potentiated (p < 0.0001) compared to both vehicle and T3-alone (slashed bar in Fig 4D, TBT). In contrast, in the experiments using UVI, the 7.3-fold activation by T3-alone did reach statistical significance (p = 0.0008, n = 4), but UVI did not significantly inhibit T3 induction of the gene (p = 0.14). Runx2 is a transcription factor that is required for the transition from proliferating chondrocytes to hypertrophic chondrocytes in the maturation of cartilage for the development of a bony skeleton [66-68]. In non-amniote animals like fish and amphibia, it is required earlier for rostral cartilage formation [69, 70]. Due to the extensive changes to jaw cartilage during metamorphosis, we investigated whether T3 regulated its expression. In the LJ, T3 induced expression of runx2 approximately 7-fold (white bars in Fig 4E), and this induction was significantly potentiated through co-treatment of either Bex or TBT with the T3 (slashed bars in Fig 4E, Bex, TBT). In addition, UVI co-treatment significantly inhibited runx2 induction by T3 (slashed bar in Fig 4E, UVI).

RXR agonists potentiate T3-action in TH-competent (NF 54) tadpoles

While 1wk-PF tadpoles are considered only partially competent to respond to THs, tadpoles at NF 54 (approximately 26 days PF) are considered fully competent to respond to THs and to be entering metamorphosis [21, 45, 63]. We raised tadpoles to NF 54, using hind limb development to determine the developmental stage [61], and then treated them with 10 nM T3 in the presence and absence of 30 nM Bex to investigate whether the RXR agonist could still potentiate the action of T3 in a fully competent tadpole. Tadpoles were treated for three days with compounds (a longer treatment time was not possible due to the extreme gill resorption in T3 plus Bex animals), and then we measured the LJ angle. Fig 5A (white boxes) shows that T3-alone caused a small but significant decrease in the lower jaw angle. As in NF 48 tadpoles, Bex-only treatment had no effect on the lower jaw morphology—tadpoles were indistinguishable from vehicle-treated. Bex co-treatment with T3 significantly potentiated the decrease in the LJ angle at this later stage of growth (Fig 5A), suggesting that the ability to increase the competence for T3 in the lower jaw was still possible, even for these presumed fully competent animals.
Fig 5

RXR agonists potentiate T3 action in the LJ in pro-metamorphic NF 54 tadpoles.

a. Bex potentiates the T3-induced decrease in the LJ angle in NF 54 tadpoles treated for three days. Boxes and statistics are as in Fig 1 (n = 14 jaws from 3 clutches). Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001; *, p < 0.05). b. TBT potentiates T3-inducible, integrated luciferase reporter expression in the LJ of NF 54 tadpoles.

RXR agonists potentiate T3 action in the LJ in pro-metamorphic NF 54 tadpoles.

a. Bex potentiates the T3-induced decrease in the LJ angle in NF 54 tadpoles treated for three days. Boxes and statistics are as in Fig 1 (n = 14 jaws from 3 clutches). Statistics show results from Sidak’s multiple comparison test in conjunction with 2-way ANOVA (****, p < 0.0001; ***, p < 0.001; *, p < 0.05). b. TBT potentiates T3-inducible, integrated luciferase reporter expression in the LJ of NF 54 tadpoles. Previously we developed a transgenic line of X. laevis frogs that express firefly luciferase (Luc) under the regulation of the X. laevis thibz TH response elements (TREs) [43, 44], where Luc activation follows morphological changes in terms of response to T3 and RXR ligands. The single-copy reporter construct uses only the TRE elements from the thibz gene just upstream of a minimal promoter from the MMTV (mouse mammary tumor virus) long terminal repeat [71], in which the response elements for the glucocorticoid receptor were replaced with the TREs from the thibz gene. In NF 48 tadpoles, assaying the entire head for Luc activation is required in order to generate a signal robust enough for statistics. At NF 54 we are able to analyze individual tissues, so we treated NF 54 tadpoles for 2 days with 10 nM T3 in the presence and absence of 2 nM TBT, and then we excised the lower jaws as we did for gene expression analysis. Luc activity was determined in the LJ samples and was normalized to the protein concentration of each sample. We assayed two clutches independently using two different TRE-Luc-bearing F2 male frogs to generate embryos with two different wild-type female frogs. TRE-Luc F2 males, even though they arise from the same founder female, display different levels of Luc activation by T3 that are nonetheless consistent within a clutch. Fig 5B shows the results of both clutches individually, showing the different levels of T3 activation between the two clutches. For clutch 2, a TBT-only treatment was also included and showed no activation. Using a 2-way ANOVA analysis of the combined data from both clutches where treatment and clutch were covariates, clutch was a significant source of variance (p = 0.0005), as was treatment (p < 0.0001). Using a Tukey multiple comparisons test post hoc on the combined clutch data, TBT significantly potentiated the T3 activation of the Luc reporter (p = 0.0092). This result indicates that the RXR agonists at this high-TH-competence stage could further increase the competence of LJ tissue for T3 at the beginning of natural metamorphosis.

Discussion

In this report we have expanded upon our earlier findings concerning the ability of RXR agonists to function as a competence factor for TH signaling during vertebrate development [43, 44, 46]. The poor biological outcomes that arise from insufficient or inappropriate TH during development have demonstrated the need for assessing the ability of man-made chemicals present in the environment to aberrantly accelerate or inhibit those signaling pathways. In order to look at TH disruption in vivo and during development, we have used amphibian metamorphosis of the African clawed frog, Xenopus laevis. Metamorphosis performs two reciprocal functions: 1) development of adult tissues and organs required for life as a frog, and 2) removal of larval tissues no longer needed by the adult frog. Limb formation and growth is an example of development of new tissues, and jaw development is an example of remodeling that must occur for the herbivorous tadpole to become a carnivorous frog. The other side of the metamorphic coin involves the resorption of larval tissues that are no longer required in the frog, such as gills and the tail. Naturally, removal of larval tissues must occur after the adult tissues have developed and become functional. For example, tail resorption is the last step in metamorphosis because it must occur after limb development is complete and the limbs are functional for locomotion. Under natural development, it takes approximately two months to go from a fertilized egg through a larval tadpole to a juvenile frog, with the metamorphic transition from tadpole to frog taking approximately 4.5 weeks under ideal conditions [13, 18, 21, 61]. Our studies here employed a precocious metamorphosis assay, to determine whether a disruptor of TH signaling, which we have previously described disrupting larval tissue resorption phenotypes [43, 46], can also disrupt a larval-to-adult remodeling function, namely, cartilage development in the LJ. By using 1wk-PF tadpoles, we examined tadpoles where the larval jaw cartilages were formed, and the tadpoles had entered a period of isometric growth [51, 52]. This allowed us to focus on the effects of RXR ligands on T3-mediated metamorphic phenotypes as RAR-RXR-mediated specification and differentiation of the cartilage was complete [50]. In this assay system, T3 and the potential disrupting chemicals are taken up by the tadpole through administration in the rearing water. Although the LJ of the 1wk-PF tadpole is not able to support completely normal metamorphic changes to the LJ [53], we found that the LJ can respond to T3 administration with reproducible morphological and molecular readouts. Previously, we reported that both the pharmaceutical RXR agonist Bex and the environmental RXR agonist TBT disrupted TH signaling in 1wk-PF tadpoles by significantly potentiating the ability of T3 to drive gill and tail resorption. Furthermore, the RXR antagonist UVI abrogated T3 action. Bex and TBT functioned identically in a global transcriptomic analysis of T3 signaling in the tail [46], indicating that TBT was functioning as a bona fide RXR agonist [39, 40, 72–76]. Here, we show that the RXR agonists potentiate T3 action in the LJ by accelerating the rate of change and by increasing the potency of each T3 dose. As in the tail, TBT and Bex behaved nearly identically in the LJ independent of the experimental readout. In addition, the RXR antagonist abrogated the morphological changes induced by T3. We also measured the ability of the agonists and antagonist to disrupt T3-induced cellular proliferation. TBT and Bex both significantly potentiated proliferation, and UVI inhibited proliferation. However, when examining differential gene expression profiles, the agonists and antagonist did not always give reciprocal results. For example, T3 induction of the thibz gene was unaffected by the RXR agonists, but was significantly inhibited by the antagonist. This was also seen in tail expression of thibz [46]. These data show that the RXR agonists and the antagonist do not always behave in a reciprocal manner at all molecular or cellular targets; therefore, more than one molecular mechanism may be in play. The T3-induced proliferation did not result in an increase in length of the MC, even when proliferation was potentiated by the RXR agonists. This indicates that the decrease in the LJ angle accompanying T3 exposure did not arise from growth of the MC. A better fit to the morphology patterns observed with RXR agonists and antagonist modulation of the LJ T3 response is the expression patterns of the matrix metalloproteases we tested. Both mmp11 and mmp13l expression levels were potentiated by RXR agonists and inhibited by UVI. The Alcian blue staining of the cranial cartilages did show a metamorphic pattern in that the LJ cartilage was remodeled, including apparent fusion of the IR with the MC, and the cartilage of the BA (gills) was resorbed. The transcription factor runx2, which in mice is required for formation of ossified bones [77], was also significantly activated by T3 exposure, and that activation was potentiated by the RXR agonists and inhibited by UVI. In Xenopus and zebrafish, runx2 is required earlier for cranial cartilage formation [69, 70]. We believe this is the first example of T3 activating runx2 expression. In human thyroid cancer and breast cancer cells, TRβ suppressed the expression of runx2 in the presence of TH, acting as a tumor suppressor [78, 79]. An advantage of using 1wk-PF tadpoles for characterizing disruptors of TH signaling is the size uniformity of the tadpoles. We normally don’t have to normalize to the vehicle-treated control in each clutch, as we didn’t in Fig 1. However, as the tadpoles age, this size uniformity disappears, making morphological measurements more intrusive, as the animals must be housed separately and anesthetized and photographed before treatment for individual comparisons to after treatment changes. An advantage of assaying the LJ angle, is that it does not scale with tadpole head size; therefore, tadpoles can be group housed and measured only after fixation at the end of treatment. This provides a facile assay for TH disruption over developmental time, which in the case of RXR ligands, as they affect TH competence, could change as the animal develops and intrinsically increases in TH competence. That said, we also chose NF 54 to assess whether the RXR agonists could still potentiate T3 action in the LJ because that is when plasma T3 is first detectable, and therefore, NF 54 is often considered the dividing line between premetamorphic and metamorphic tadpoles [21]. However, NF 54 is nearly three weeks before metamorphic morphological changes in the jaw become apparent at NF 59 [53], and it is approximately two weeks before exogenous T3 leads to normal metamorphic development in the LJ. Therefore, TH competence in the LJ may still not be complete at NF 54 so that the cartilages can continue to develop in their normal T3-independent fashion until they are in the form that can remodel appropriately to an adult jaw. In addition, we found that TBT was able to potentiate the T3-induction of the TRE-driven luciferase reporter in NF 54 tadpoles at the threshold of metamorphosis. When we assayed whole heads for both gene expression and Luc activity in 1-wk-PF tadpoles, the T3-induction of both the gene and the reporter were potentiated by TBT [43]; in tails we found that the agonists did not potentiate the thibz gene [46], which is what we found here in the LJ. We do not know where in the genome the single copy reporter has integrated, and it is formally possible that surrounding genomic context or differences between the endogenous promoter and the reporter promoter outside of the TREs may be driving the different outcomes. Most importantly, we find that the activity of the TRE-Luc reporter most consistently follows the morphological phenotypes in terms of responding to T3 and the RXR agonists and, therefore, is a good surrogate for gene expression data. From our data at NF 54 we can conclude that, as prometamorphosis proceeds, the animal may be vulnerable to inappropriate RXR ligand activity from the environment. Ordinarily, endogenous retinoids can be controlled by the P450 retinoid-degrading enzymes [80, 81], yet organotins, or other as yet unknown chemicals in the environment that activate RXR, evade this buffer, and, therefore, still pose a unique and challenging problem for the exquisitely timed process of metamorphosis.

This file contains the underlying data for all figures in the manuscript.

(XLSX) Click here for additional data file. 5 Oct 2021
PONE-D-21-28036
Retinoid-X Receptor Agonists Increase Thyroid Hormone Competence in Lower Jaw Remodeling of Pre-Metamorphic Xenopus laevis tadpoles
PLOS ONE Dear Dr. Mengeling, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.
 
Aside from addressing the specific comments of the two reviewers, I found reviewer #2's comments particularly compelling.  There is a need for major revision, more appropriate recognition of the body of literature related to the topic, and what appears to be a need for extensive revision and new levels of analysis and perhaps experimental observations.  Whether the necessary changes can be made in a timely manner is not clear to me, and the authors might consider withdrawing the  manuscript to provide time for a more extensive reworking.
 
Please submit your revised manuscript by Nov 19 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:
A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Michael Klymkowsky, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf. 2. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. "Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 3. We note that you have included the phrase “data not shown” in your manuscript. Unfortunately, this does not meet our data sharing requirements. PLOS does not permit references to inaccessible data. We require that authors provide all relevant data within the paper, Supporting Information files, or in an acceptable, public repository. Please add a citation to support this phrase or upload the data that corresponds with these findings to a stable repository (such as Figshare or Dryad) and provide and URLs, DOIs, or accession numbers that may be used to access these data. Or, if the data are not a core part of the research being presented in your study, we ask that you remove the phrase that refers to these data. 4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Thyroid hormone (TH) signaling plays important roles during vertebrate development and it’s prone to interference from endocrine disruptors. The manuscript entitled “Retinoid-X Receptor Agonists Increase Thyroid Hormone Competence in Lower Jaw Remodeling of Pre-Metamorphic Xenopus laevis tadpoles” reports two retinoid-X receptor agonists, pharmacologic bexarotene (Bex) and environmental tributyltin (TBT), potentiated TH-induced responses in both one-week-old tadpoles that had limited TH-competence and prometamorphic tadpoles at stage NF54 that had full TH-competence. The authors used TH-induced lower jaw remodeling in Xenopus laevis as a model to investigate if Bex and TBT could potentiate TH-induced response in morphology, cellular proliferation and gene expression, respectively, and found that both Bex and TBT increased TH-induced changes of lower jaw angling, cellular proliferation in Meckel’s cartilage, and certain gene expression such as mmp11, mmp13, and runx2, etc. in one-week-old tadpoles. Consistent with these observations, they also showed that UVI 3003, a retinoid-X receptor antagonist, produced opposite phenotypes morphologically and at gene expression level. These phenotypes were partially reproduced in prometamorphic tadpoles at stage NF54. They concluded that the retinoid-X receptor agonists could potentiate TH-induced tissue remodeling in Xenopus laevis, a natural TH-dependent phenomena during frog metamorphosis, though the retinoid-X receptor agonists themselves alone didn’t induce significant morphological or molecular gene expression changes. The manuscript was well-organized and well-written and its publication would benefit readers in the related research field. Below are some issues for consideration. 1. The data showed that both Bex and TBT increased TH-induced cell proliferation in Meckel’s cartilage but UVI didn’t cause change in cell proliferation, though it slightly decreased aurkb expression in the Meckel’s cartilage tissue (Fig. 2). Did the author normalize the counts of proliferating cells to anything, such as the area of the Meckel’s cartilage tissues or total cells in the tissues? Apparently, UVI inhibited the TH-induced lower jaw remodeling, therefore the head of tadpoles treated with TH and UVI looked more like the control tadpoles treated with vehicle only, which had larger heads (Fig. 1). Did they also have larger Meckel’s cartilage tissues? If so, normalization is necessary. 2. TH-induced endogenous thibz expression was not significantly increased from either Bex or TBT treatment in combination with TH (Fig.3b) in one-week-old tadpoles, however, the authors evaluated transgenic firefly luciferase gene expression (Luc) under the control of a thibz promoter and exhibited that TBT increased TH-induced Luc activities in lower jaws of NF54 tadpoles (Fig. 4b). Both the gene expression data and the luciferase activity data were generated from lower jaws, it would be useful to explain the discrepancy of the data? Was the endogenous thibz expression also enhanced under the same treatment in the transgenic animals? What was the rationale for performing the transgenic studies here? 3. In Fig. 2, the combinatory Bex or TBT treatment increased TH-induced cellular proliferation in Meckel’s cartilage, but UVI didn’t caused changes in TH-induced cellular proliferation, assayed by immunostaining of phosphorylated Ser10 of H3 (Fig. g-i). Interestingly, the expression of aurkb gene, which encodes the Aurora kinase B responsible for phosphorylating Ser10 of H3, didn’t change from such combinatory Bex or TBT treatment with TH. Any explanation for the increase in phosphorylated Ser10 of H3 without any change in aurkb? Is the Aurora kinase B the only kinase for phosphorylating Ser10 of H3? 4. Some typos to be corrected: “Sequences for the primers…..given S1 Table.” (page 9, line 198) to be “Sequences for the primers…..given in S1 Table.”; “Interestingly, RXR agonist s and …..” (page 18, line 430) to be “Interestingly, RXR agonists and …..”; “Meckels cartilage” (page 6, line 127, and other places) to be “Meckel’s cartilage”. Reviewer #2: In this paper Dr Mengeling and co-authors, analyze the effects of treating NF48 or NF54 X. laevis tadpoles with T3 in the presence or not of RXR agonists (bexarotene or tributylin) or agonists UVI3003. They focus specifically on lower jaw morphology and on the effects on cell proliferation and on the expression of selected genes on lower jaw. They conclude that RXR agonists increase TH competence in lower jaw remodeling of X.l. tadpoles. The conclusion reached of the paper is not innovative, they showed essentially the same conclusion in their 2018 paper in ‘Endocrinology’ “: RXR Ligands Modulate Thyroid Hormone Signaling Competence in Young Xenopus laevis Tadpoles. Here they focus more specifically on what they call the “angle of Meckels cartilage” which they measure on pictures of whole tadpoles heads. This measure is very superficial, the authors should have analyzed, at a minimum, tadpole cartilage skeletons and described the effects on all skeletal components as, for example, in : Baltzinger M, et al. Dev Dyn. 2005 Dec;234(4):858-67.or Vieux-Rochas M, et al. Birth Defects Res B Dev Reprod Toxicol. 2010. A description of the phenotype is needed e.g. is there any unilateral or bilateral fusion between the Quadrate, the Ceratohyal (Ch) and/or Meclels Cartilage? Can you relate this to specific effects described in the (vast) literature on craniofacial development? Do different treatments result in different phenotypes? No considerations are made on the mechanisms of of action of TRs or RARs, RXR…on craniofacial morphogenesis, on endodermal or epidermal signals to neural crest cells, on CNCCs migration etc . Actually, no considerations at all is made on the potential mechanism, all the vast literature on receptor involvement in the mechanisms of craniofacial morphogenesis is completely ignored. As this paper does not really provide any novel information and considering the superficiality of the analysis and discussion I am not suggesting the paper to be published. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 14 Mar 2022 Responses to Reviewer 1: 1. Normalization to the size of the cartilage area counted was a very good idea for our proliferation data (previously Figure 2, now Figure 3). We have done this, and our revised results now show significant inhibition of T3-induced proliferation by the RXR antagonist UVI. 2. We have provided an explanation of the differences between the endogenous thibz gene promoter and the promoter in the TRE-Luc reporter in both the results (lines 462-466) and the discussion (lines 576-590). We also explain in the discussion our rationale for using the Luc reporter as it performs as an excellent surrogate to general gene expression changes with treatment (i.e., potentiation or inhibition of T3-action by RXR agonists or antagonist, respectively), and its activity follows morphological changes associated with the treatments. 3. We discuss in the results (lines 363-370) the discrepancy between non-significant changes in aurkb message expression and significant changes in Aurkb kinase activity. The simplest explanation is that Aurkb kinase activity isn’t directly tied to its message level at the level of change we see in the kinase activity. 4. We corrected all typos that we found in the text. Response to Reviewer 2: We have added a figure (current Figure 2) of Alcian blue cartilage staining of the tadpole head from the ventral side so the reader can visualize the cranial cartilages and how they change in response to T3 and the RXR agonists (lines 219-228, 316-341, 534-536). We measured the length of the Meckel’s cartilage, and we show that its length does not change with treatment. We also validated our LJ angle measurement using dorsal head photos of fixed tadpoles (Figure 1) by measuring the angle formed by the Meckel’s and infrarostral cartilages, showing that both sets of measurement agree with each other. In the introduction (lines 156-167) we briefly explain the timing of the roles of retinoic acids and THs in cranial development, specifying that one advantage of assaying at 1-week post-fertilization is it’s a time when the jaw cartilages are already formed from the action of retinoic acids, but that T3 action of cartilage maturation and bone ossification has not occurred. Therefore, we are perturbing the system at a “quiet” time of isometric growth and not morphological change in the jaw. We also better explain the non-natural changes T3 induces at this stage, and how we are still able to use it as a readout of T3 action and disruption. We did not discuss the specification and migration of the neural crest, because in our system that has already occurred before we start treatments, and therefore, cannot be perturbed by such. To keep the introduction at a reasonable length, we shortened it in other paragraphs, as the tracking shows. Submitted filename: Response to Reviewers.docx Click here for additional data file. 31 Mar 2022 Retinoid-X Receptor Agonists Increase Thyroid Hormone Competence in Lower Jaw Remodeling of Pre-Metamorphic Xenopus laevis tadpoles PONE-D-21-28036R1 Dear Dr. Mengeling, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Michael Klymkowsky, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Thyroid hormone (TH) signaling plays important roles during vertebrate development and it’s prone to interference from endocrine disruptors. The manuscript entitled “Retinoid-X Receptor Agonists Increase Thyroid Hormone Competence in Lower Jaw Remodeling of Pre-Metamorphic Xenopus laevis tadpoles” reports two retinoid-X receptor agonists, pharmacologic bexarotene (Bex) and environmental tributyltin (TBT), potentiated TH-induced responses in both one-week-old tadpoles that had limited TH-competence and prometamorphic tadpoles at stage NF54 that had full TH-competence. The authors used TH-induced lower jaw remodeling in Xenopus laevis as a model to investigate if Bex and TBT could potentiate TH-induced response in morphology, cellular proliferation and gene expression, respectively, and found that both Bex and TBT increased TH-induced changes of lower jaw angling, cellular proliferation in Meckel’s cartilage, and certain gene expression such as mmp11, mmp13, and runx2, etc. in one-week-old tadpoles. Consistent with these observations, they also showed that UVI 3003, a retinoid-X receptor antagonist, produced opposite phenotypes morphologically and at gene expression level. These phenotypes were partially reproduced in prometamorphic tadpoles at stage NF54. They concluded that the retinoid-X receptor agonists could potentiate TH-induced tissue remodeling in Xenopus laevis, a natural TH-dependent phenomena during frog metamorphosis, though the retinoid-X receptor agonists themselves alone didn’t induce significant morphological or molecular gene expression changes. The manuscript was well-organized and well-written and its publication would benefit readers in the related research field. The changes and responses are satisfactory in the revised version. Reviewer #2: The inclusion of the analysis of tadpole cartilage skeletons has greatly improved the quality of the paper. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 4 Apr 2022 PONE-D-21-28036R1 Retinoid-X receptor agonists increase thyroid hormone competence in lower jaw remodeling of pre-metamorphic Xenopus laevis tadpoles Dear Dr. Mengeling: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Michael Klymkowsky Academic Editor PLOS ONE
  80 in total

1.  Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts.

Authors:  T Komori; H Yagi; S Nomura; A Yamaguchi; K Sasaki; K Deguchi; Y Shimizu; R T Bronson; Y H Gao; M Inada; M Sato; R Okamoto; Y Kitamura; S Yoshiki; T Kishimoto
Journal:  Cell       Date:  1997-05-30       Impact factor: 41.582

2.  Transcription from the thyroid hormone-dependent promoter of the Xenopus laevis thyroid hormone receptor betaA gene requires a novel upstream element and the initiator, but not a TATA Box.

Authors:  J Wong; V C Liang; L M Sachs; Y B Shi
Journal:  J Biol Chem       Date:  1998-06-05       Impact factor: 5.157

3.  Unique response pathways are established by allosteric interactions among nuclear hormone receptors.

Authors:  B M Forman; K Umesono; J Chen; R M Evans
Journal:  Cell       Date:  1995-05-19       Impact factor: 41.582

4.  Thyroid hormone-induced gene expression program for amphibian tail resorption.

Authors:  Z Wang; D D Brown
Journal:  J Biol Chem       Date:  1993-08-05       Impact factor: 5.157

5.  Gene expression changes at metamorphosis induced by thyroid hormone in Xenopus laevis tadpoles.

Authors:  Biswajit Das; Liquan Cai; Mark G Carter; Yu-Lan Piao; Alexei A Sharov; Minoru S H Ko; Donald D Brown
Journal:  Dev Biol       Date:  2006-02-03       Impact factor: 3.582

6.  Activation of RXR-PPAR heterodimers by organotin environmental endocrine disruptors.

Authors:  Albane le Maire; Marina Grimaldi; Dominique Roecklin; Sonia Dagnino; Valérie Vivat-Hannah; Patrick Balaguer; William Bourguet
Journal:  EMBO Rep       Date:  2009-03-06       Impact factor: 8.807

Review 7.  Generating retinoic acid gradients by local degradation during craniofacial development: One cell's cue is another cell's poison.

Authors:  Aditi Dubey; Rebecca E Rose; Drew R Jones; Jean-Pierre Saint-Jeannet
Journal:  Genesis       Date:  2018-01-25       Impact factor: 2.487

8.  Thyroid Hormone Receptor-β (TRβ) Mediates Runt-Related Transcription Factor 2 (Runx2) Expression in Thyroid Cancer Cells: A Novel Signaling Pathway in Thyroid Cancer.

Authors:  Frances E Carr; Phillip W L Tai; Michael S Barnum; Noelle E Gillis; Katherine G Evans; Thomas H Taber; Jeffrey H White; Jennifer A Tomczak; Diane M Jaworski; Sayyed K Zaidi; Jane B Lian; Janet L Stein; Gary S Stein
Journal:  Endocrinology       Date:  2016-06-02       Impact factor: 4.736

Review 9.  Role of thyroid hormones in craniofacial development.

Authors:  Victoria D Leitch; J H Duncan Bassett; Graham R Williams
Journal:  Nat Rev Endocrinol       Date:  2020-01-23       Impact factor: 43.330

10.  Transcriptome analysis of Xenopus orofacial tissues deficient in retinoic acid receptor function.

Authors:  Stacey E Wahl; Brent H Wyatt; Stephen D Turner; Amanda J G Dickinson
Journal:  BMC Genomics       Date:  2018-11-03       Impact factor: 3.969

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.