Histidine is essential for growth of Komagataella phaffii cultured in YPA medium.

Komagataella phaffii (a.k.a. Pichia pastoris) requires histidine for optimal growth when cultured in a medium containing yeast extract, peptone (YP), and acetate (YPA). We demonstrate that HIS4-deficient, K. phaffii strain GS115 exhibits a growth defect on YP-media containing acetate, but not on other carbon sources. K. phaffii X33, a prototroph, grows better than K. phaffii GS115 (his4), a histidine auxotroph in YPA. Normal growth of GS115 is restored either by the expression of HIS4 or by culturing in YPA containing ≥0.6 mM histidine. In the presence of histidine, expression of several genes is altered, including those encoding key subunits of mitochondrial ATP synthase, transporters of amino acids and nutrients, as well as biosynthetic enzymes. Thus, histidine should be included as an essential component for optimal growth of K. phaffii histidine auxotrophs cultured in YPA.

histidinol dehydrogenase

yeast nitrogen base

medium containing yeast extract and peptone

YP + acetate

YPA + histidine

The ability of the respiratory yeast Komagataella phaffii (a.k.a. Pichia pastoris) to metabolize methanol has been exploited successfully to develop alcohol oxidase 1 (AOXI) promoter‐based expression systems [1, 2]. Usually, recombinant strains of K. phaffii are cultured in media containing glucose or glycerol for achieving high cell density, and then transferred to methanol for induction. During the growth phase, metabolic intermediates in the form of yeast extract and peptone are often provided in the medium to enhance the growth rate further. K. phaffii can also grow on ethanol, and ethanol is used for high cell density fermentation [3]. However, acetate does not support robust growth and therefore is not used for high‐density fermentation [4]. Recent studies have highlighted the importance of acetate in the biomanufacturing of acetate‐derived compounds [5]. This has led researchers to tweak the acetate utilization and related processes in yeasts to achieve tolerance to higher acetate levels. For example, screening for acetate‐sensitivity kinases led to the identification of HRK1, a kinase involved in the regulation of plasma membrane H (+)‐ATPase Pma1 in K. phaffii. Overexpression of HRK1 resulted in high growth in presence of 30 mM (~0.2%) acetate leading to a 55% increase in the product derived from acetyl Co‐A as compared to the wildtype strain [6]. However, there are still efforts to maximize the acetate utilization in K. phaffii.

Acetate, a weak acid, is the precursor of acetyl Co‐A and is found in abundance in nature. Only a few yeasts, such as Saccharomyces cerevisiae and K. phaffii are tolerant of acetate [6, 7]. Acetate utilization in yeasts begins with the internalization of acetate through the membrane transporters, followed by its ligation to Co‐A by acetyl Co‐A synthetases 1 and 2 (ACS1, ACS2) with ATP as the phosphate group donor. Acetyl Co‐A, thus formed, has many fates inside the cell. It can be channelized into the tricarboxylic acid cycle or the glyoxylate cycle, utilized for fatty acid biosynthesis or acetylation of proteins, including histones [5]. Acetate metabolism of K. phaffii is regulated by transcription factors such as Mxr1, Cat8‐1, and Cat8‐2 [3, 8].

For biomanufacturing of desired products, the gene(s) of interest is expressed in the host strain, using an expression vector harboring an appropriate selection marker. In K. phaffii, several auxotrophic strains have been developed for this purpose by exploiting the genes involved in the biosynthesis of histidine, methionine, arginine, adenine, uracil, lysine, tyrosine, proline, and phenylalanine such as HIS4, MET2, ARG4, ADE1, URA3, LYS2, TYR1, PRO3, and PHA2, respectively [9, 10, 11, 12]. Of these, the histidine auxotroph GS115, harboring a defective his4 gene encoding histidinol dehydrogenase, is widely used for heterologous protein production [9].

In this study we demonstrate that wildtype K. phaffii strain (X33), but not histidine auxotroph (GS115), grows efficiently in a complex medium containing 1% yeast extract, 2% peptone (YP), and 2% acetate (YPA), suggesting a role for HIS4‐mediated histidine biosynthesis for adequate growth. Optimal growth of GS115 can also be achieved by adding ≥0.6 mM histidine to YPA (YPAH). Histidine induces significant changes in the gene expression profile, as evident from high‐throughput genome‐wide RNA sequencing. Key histidine‐responsive genes identified in this study include those involved in ATP synthesis, transport of amino acids and nutrients, and biosynthetic pathways.

Materials and methods

Growth media and culture conditions

K. phaffii cells were maintained in nutrient‐rich YPD agarose plates (1% yeast extract, 2% peptone, and 2% dextrose). A single colony was grown overnight in YPD at 30°C in an orbital shaker at 180 rpm followed by washing with sterile distilled water (twice) and transferred to desired media containing YP (1%yeast extract, 2% peptone) and a carbon source (2%) such as dextrose (YPD), acetate (YPA), glycerol (YPG). Media were supplemented with L‐histidine (20–100 μg·mL−1), L‐methionine (20‐100 μg·mL−1) or L‐glutamate (20‐100 3, μg·mL−1) or ammonium sulfate (0.5%) when required. The minimal medium consisted of 0.67% yeast nitrogen base (YNB) with amino acids and an appropriate carbon source (2%). Escherichia coli TOP10 was used for plasmid isolation. Bacterial and yeast transformations were done using the CaCl2 method and electroporation (Gene Pulsar, Bio‐Rad, Hercules, CA, USA), respectively. Yeast extract was procured from Thermo Fisher, Bangalore, India (#212750) or Himedia, Mumbai, India (#RM027). Peptone was purchased from Thermo Fisher (#211677) or Himedia (#RM001).

Antibodies and other reagents

Mouse anti‐Myc antibodies were purchased from Merck Millipore (Bangalore, India). Restriction enzymes and T4 DNA ligase were purchased from New England Biolabs (Ipswich, MA, USA). DNA polymerases were purchased from GeNei (Bangalore, India). Oligonucleotides were purchased from Sigma‐Aldrich, India.

Growth kinetics

A single colony grown till late log phase was pelleted and washed twice with autoclaved milliQ (Millipore, Bedford, MA, USA) water under sterile conditions, resuspended in water, and inoculated into specific media at an initial A600 of 0.07 and grown at 30 °C at 180 rpm in an orbital shaker. A600 was measured at regular intervals.

Spot plate assay

Cells were grown in YPD till A600 = 2.0–4.0 and 1.0 O.D., and cells were suspended in 1 mL water for serial dilution preparation. One μl from each serial dilution was spotted on YNBD His‐ or His+ plates and incubated at 30 °C for 2–3 days.

Western blotting

Cells were lysed using the glass‐bead lysis method. Proteins were quantified using Bradford reagent, resolved on SDS polyacrylamide gels, and transferred to PVDF membrane as described [4]. Blots were probed with primary and secondary antibodies using standard protocols.

RNA‐sequencing and data analysis

Total RNA was isolated from GS115 and X33 cultured in YPA and GS115 cultured in YPAH5x in duplicate for 24 h by Qiagen (Chatsworth, CA, USA) RNeasy kit according to the manufacturer’s protocol. RNA Seq was performed using Illumina HiSeq at Clevergene (Bangalore, India). Differentially expressed genes were analyzed as described previously [4]. Genes with absolute log2‐fold change ≥2 and adjusted P‐value < 0.05 were considered significant. The expression profile of differentially expressed genes across the samples is presented in volcano plots and heatmaps. The three‐letter gene names were obtained by submitting the Uniref100 IDs to UniProtKB. However, in this process there was some data loss, as all proteins could not be mapped. The transcriptome datasets generated in the current study are available at the NCBI with the accession number GSE174633.

Generation of GS115‐HIS4

The pIB3 vector harboring HIS4 as a selection marker (Addgene, plasmid # 25452) [13] was linearized with SalI, transformed into GS115 for integration into the HIS4 locus. Colonies were selected on YNBD His‐ plates.

pGAP‐HIS4 was constructed by cloning the HIS4 into pGAPZA (Thermo Fisher, Bangalore, India) downstream of the GAPDH promoter in‐frame with the vector‐encoded c‐Myc epitope. HIS4 was amplified from pIB3 using the forward primer (1–23 bp of HIS4) 5′‐CCGGAATTCATGACATTTCCCTTGCTACCTGC‐3′ (F) and the reverse primer (complementary to C‐2508–2529 bp of HIS4) 5′ATAAGAATGCGGCCGCTAATAAGTCCCAGTTTCTCCATACGA‐3′ (R). EcoRI and NotI sites are underlined. The PCR product was digested with EcoRI and NotI, and cloned into pGAPZA to obtain pGAP‐HIS4, which was transformed into P. pastoris GS115, a histidine auxotroph. Cells were plated onto YPD + Zeocin plates and Zeo colonies were selected. Expression of Myc‐tagged His4 (His4Myc) was confirmed by western blotting using anti‐Myc epitope antibodies and histidine prototrophy was confirmed by plating on YNBD (His‐) plates.

Generation of GS115‐H670A

The specific point mutations in the HIS4 were generated by site‐directed mutagenesis. pGAP‐HIS4 was used as a template and reactions were carried out using the QuikChange (Agilent, Palo Alto, CA, USA) Site‐Directed Mutagenesis Kit. For introducing the H670A mutation, the following primer pair was used: 5′‐CTGTCTCAAGCTGAAGCTGGTATTGATTCCCAG‐3′ and 5′‐CTGGGAATCAATACCAGCTTC AGCTTGAGACAG‐3′. For mutating H737 to alanine, the following primer pair was used: 5′‐CAGTACGCTCCTGAAGCCTTGATCCTGCAAATC‐3′ and 5′‐GATTTGCAGGATCAAGGCTT CAGGAGCGTACTG‐3′. The PCR product was digested with DpnI followed by transformation in E. coli. H670A and H737A mutations were confirmed by DNA sequencing. Constructs were then transformed into GS115 and screened on YPD + Zeocin plates. Expression of Myc‐tagged His4 was confirmed by western blotting using anti‐Myc epitope antibodies and the phenotype was examined by plating on YNBD (His‐) plates.

The yeast strains used in this study are listed in Table 1.

Table 1

List of K. phaffii strains used in this study.

Strain	Description	References
GS115	his4	[39]
X33	HIS4	Invitrogen
GS115‐HIS4	GS115, HIS4	This study
GS115‐HIS4Myc	GS115, Zeor(PGAPDH‐HIS4‐Myc)	This study
GS115‐H670AMyc	GS115, Zeor(PGAPDH‐HIS4H670A‐Myc)	This study
GS115‐H737AMyc	GS115, Zeor(PGAPDH‐HIS4H737A‐Myc)	This study
JC239	met2	[10]
BY4741	MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0	[40]

Results

HIS4 is essential for optimal growth of K. phaffii cultured in YPA

K. phaffii has emerged as an important host for the expression of several heterologous proteins and a model organism for fundamental research [14, 15]. K. phaffii expression vectors generally contain auxotroph markers (e.g., HIS4, MET2, ADE1, ARG4) or antibiotic selectable markers (e.g., Zeocin, geneticin (G418) and blasticidin S). Expression vectors containing auxotrophic markers such as HIS4 and MET2 are transformed into the auxotrophs GS115 (his4) and JC239 (met2), respectively, while vectors conferring resistance to drugs are transformed into the prototrophic strains such as X33 [12, 16]. If GS115 is cultured in minimal media, histidine needs to be supplemented for growth. However, histidine supplementation is not required when GS115 is cultured in nutrient‐rich media containing 1% yeast extract and 2% peptone (YP) and an appropriate source of carbon. In general, auxotrophic yeast strains defective in amino acid biosynthesis do not exhibit growth defects when cultured in nutrient‐rich media. An exception to this rule was observed when the histidine auxotroph GS115 exhibited a growth defect when cultured in YP containing 2% acetate (YPA) but not YP, YP containing 2% glucose (YPD) or 2% glycerol (YPG), as well as YNB containing 2% acetate and 130 µm histidine (YNBA) (Fig. 1A). This differential growth of histidine auxotroph and prototroph could be attributed to the selection marker HIS4, as both the strains differ only at the HIS4 locus.

Fig. 1

Analysis of the growth of K. phaffii prototroph and histidine auxotrophs in YPA. (A) Analysis of growth of K. phaffii GS115 and X33 in different media, as indicated. Error bars in each figure indicate SD, n = 3. YNB with amino acids was used for the preparation of YNBA. Histidine concentration in YNBA is 20 mg·L−1 or 130 µm. (B) Map of pIB3 and pGAP‐His4 vectors. In pIB3 vector (# 25452, Addgene), K. phaffii HIS4 is expressed from its own promoter. In pGAP‐His4 vector, HIS4 was amplified from pIB3 with a C‐terminal Myc tag and cloned downstream of the glycerladehyde‐3‐phosphate dehydrogenase (GAP) promoter of pGAPZA (ThermoFisher). AOX, alcohol oxidase; GAP, TT, transcription termination sequence; ori, origin of replication; CYC1, cytochrome c1; PTEF1, promoter of transcription elongation factor 1; PEM7, EM7 promoter for the expression of bleomycin/zeocin resistance gene (BleoR) in E. coli and K. phaffii. Plasmid maps were drawn using SnapGene software (from Insightful Science; available at snapgene.com). (C) Western blot analysis of lysates of K. phaffii cultured in YPD using Anti‐Myc antibodies. M, molecular weight markers (kDa). (D) Spot assay of different K. phaffii strains as indicated in histidine‐sufficient (His+) and ‐deficient (His‐) YNBD media. (E) Growth curves of different K. phaffii strains cultured in YPA, as indicated (n = 3).

To examine the role of HIS4 in the growth of GS115 in YPA, pIB3 and pGAP‐His4 vectors were transformed into GS115. pIB3 is a promoter‐less K. phaffii vector containing HIS4 as a selection marker, while pGAP‐His4 was generated by cloning HIS4 with a C‐terminal Myc tag (His4) downstream of GAPDH promoter of the pGAPZA vector (Fig. 1B). Expression of His4Myc in the GS115‐His4 strain was confirmed by western blotting with anti‐Myc tag antibodies (Fig. 1C). The phenotype of the various strains was examined by spot assay. As expected, GS115 exhibited histidine auxotrophy, while GS115‐His4 and GS115‐His4 became prototrophs (Fig. 1D). To assess the effect of HIS4 expression on the growth of GS115 in YPA, GS115, GS115‐His4, and GS115‐His4 were cultured in YPA. The results indicate that, like X33, GS115‐His4 and GS115‐His4 grew better than GS115, suggesting that expression of HIS4 either from its promoter or from the GAPDH promoter reversed the growth defect of GS115 cultured in YPA (Fig. 1E), indicating that histidine biosynthesis might be essential for the growth of K. phaffii in YPA.

Histidinol dehydrogenase activity of HIS4 is essential for the growth of K. phaffii in YPA

His4 is a trifunctional protein, catalyzing second, third, and the last reactions of the histidine biosynthetic pathway (Fig. 2A), with amino acids 1–275 encoding for phosphoribosyl‐AMP‐cyclohydrolase activity (His4A), 276–357 encoding for phosphoribosyl‐AMP‐phosphohydrolase activity (His4B), and residues 358–843 coding for the histidinol dehydrogenase activity (His4C) [17]. It is worth mentioning that the histidine biosynthetic pathway is involved not only in histidine production but also in the generation of 5‐aminoimidazole‐4‐carboxamide ribonucleotide (AICAR), which is an essential precursor for purine biosynthesis (Fig 2A). To understand whether His4 is affecting the growth of GS115 in YPA by modulating histidine production or purine generation, the histidinol dehydrogenase activity of His4 was specifically abrogated. The catalytically active residues of histidinol dehydrogenase have been experimentally characterized in Salmonella typhimurium as His261 and His326 [18, 19, 20] and by sequence alignment, the corresponding residues of His4 in K. phaffii are identified as H670 and H737 (Fig. 2B). We mutated H670 and H737 to alanine, expressed them as Myc tagged proteins in GS115, and confirmed their expression by western blotting using anti‐Myc antibodies (Fig. 2C). GS115 expressing mutant enzymes exhibited histidine auxotrophy when cultured in YNBD (His‐) agar plates, as expected (Fig. 2D). The growth kinetics of GS115, X33, GS115‐His4 in YPA medium indicates that strains carrying only the wildtype His4 but not the mutant enzymes restored growth of GS115 in YPA (Fig. 2E), indicating that His4C, catalyzing the conversion of histidinol to histidine, is essential for the growth of K. phaffii in YPA.

Fig. 2

Analysis of the role of HIS4 in the growth of K. phaffii in YPA. (A) Predicted histidine biosynthetic pathway of K. phaffii. Numbers in parentheses indicate amino acid residues of the trifunctional enzyme, HIS4 contributing to three different enzymatic activities (HIS4A, HIS4B, HIS4C). (B) Alignment of amino acid sequences of HIS4 of K. phaffii, S. typhimurium, and S. cerevisiae. Histidine residues essential for HIS4C activity are underlined. UniProt IDs are shown in parentheses. Numbers indicate amino acid residues. (C) Western blot analysis of lysates of GS115 expressing Myc‐tagged HIS4 and HIS4 mutants using anti‐Myc tag antibodies. M, molecular weight markers (kDa). (D) Spot assay of various K. phaffii strains as indicated in histidine‐sufficient (His+) and ‐deficient (His‐) YNBD media. (E) Growth curves of different K. phaffii strains cultured in YPA, as indicated. Error bars in each figure indicate SD (n = 3).

Supplementation of YPA with histidine reverses the growth defect of K. phaffii GS115

The results thus far indicate that conversion of histidinol to histidine by His4C is essential for the growth of K. phaffii in YPA. This led us to investigate the effect of supplementation of YPA with histidine on the growth of GS115. GS115 is generally cultured in shake flasks in minimal media supplemented with 20 mg·L−1 or 130 µm of histidine, and hence 130 µm histidine is referred to as 1x in this study. To study the effect of histidine on the growth of K. phaffii, GS115 and X33 were cultured in YPA supplemented with 1x (YPAH1x), 2x (YPAH2x), 5x (YPAH5x), or 10x (YPAH10x) histidine, and their growth rates were compared. Histidine addition resulted in a significant increase in the growth rate of GS115, and peak growth rates were achieved at 5x concentration (Fig. 3A). Hence, YPAH5x was used for further studies. It should be noted that histidine supplementation of YPA enhanced the growth of GS115 but not X33 (Fig. 3A).

Fig. 3

Effect of supplementation of amino acids alone or amino acids and ammonium sulphate on the growth of K. phaffii and S. cerevisiae cultured in YPA and YPD. (A–C) Growth curves of K. phaffii GS115, X33, and JC239, as well as S. cerevisiae BY4741 strains in YPA supplemented with different concentrations of histidine (YPAH) or methionine (YPAM). 1x histidine/methionine is 130 µm (20 mg·L−1). Error bars in each figure indicate SD (n = 3). (D) Schematic representation of histidine catabolism by the histidine utilization pathway [21, 22]. HAL, Histidine ammonia lyase. (E) Growth curve of K. phaffii GS115 in YPA supplemented with different concentrations of glutamate (YPAG). 1x glutamate is 130 µm (20 mg·L−1). (F and G) Growth curves of K. phaffii GS115 and X33 strains cultured in YPA, YPAH5x, or YPD media in the presence or absence of 0.5% ammonium sulphate. Error bars in each figure indicate SD (n = 3).

Next, we assessed the growth of JC239, a methionine auxotroph, in the absence and presence of excess methionine or histidine in YPA. The results, however, indicate that the addition of 5x methionine or 5x histidine to YPA did not affect the growth of JC239 (Fig. 3B). Further, S. cerevisiae BY4741, a histidine auxotroph, was cultured in YPA and YPAH5x. The results indicate that histidine does not affect the growth of S. cerevisiae BY4741 (Fig. 3C), suggesting that histidine‐mediated growth is a unique property of K. phaffii histidine auxotroph.

Histidine is metabolized to urocanate and ammonia and subsequently to glutamate and formate in bacteria and mammals via the histidine utilization pathway [21, 22] (Fig. 3D). It is possible that a metabolite derived from histidine such as urocanate rather than histidine per se facilitates the growth of K. phaffii cultured in YPA. The K. phaffii genome does not encode histidine ammonia‐lyase, which catalyzes the conversion of histidine to urocanate. However, histidine may be converted to glutamate by a yet‐to‐be‐discovered pathway in K. phaffii. Glutamate, thus generated from histidine catabolism, can enter the TCA cycle via its conversion to α‐ketoglutarate catalyzed by glutamate dehydrogenase and contributes to ATP generation, gluconeogenesis, and growth. If this were to be accurate, glutamate should enhance the growth of GS115 as efficiently as histidine. However, growth of GS115 was not enhanced when cultured in YPA containing 5x (YPAG5x) or 10x glutamate (YPAG10x) (Fig. 3E), suggesting that glutamate derived from histidine is unlikely to be the growth promoter of GS115. To examine whether ammonium derived from histidine catabolism is contributing to growth, we cultured K. phaffii cultured in YPA supplemented with ammonium sulfate (AS). Surprisingly, AS inhibited the growth of GS115 in YPAH5x as well as X33 in YPA (Fig. 3F), but not in YPD (Fig. 3G). Taken together, these results indicate that neither glutamate nor ammonium derived from histidine catabolism is contributing to the growth of K. phaffii metabolizing acetate in the presence of yeast extract and peptone.

Identification of histidine responsive genes of K. phaffii

In the present study, growth promotion of K. phaffii was observed not only by histidine added to the culture medium but also by histidine biosynthesized intracellularly, thus ruling out the involvement of signaling pathways mediated by cell surface proteins. We reasoned that histidine‐mediated growth of K. phaffii cultured in YPA may involve the regulation of expression of genes via a yet‐to‐be‐discovered intracellular signaling pathway. Since signal transduction pathways ultimately culminate in the regulation of gene expression, we examined whether intracellular biosynthesis of histidine or histidine acquired from the culture medium can alter the gene expression profile of K. phaffii. A genome‐wide, high‐throughput RNA‐Seq was carried out with RNA isolated from GS115 and X33 cultured in YPA as well as GS115 cultured in YPAH5x (Table S1). The raw data files have been submitted to the GEO database with an accession number GSE174633. GS115 cultured in YPA (GS115‐YPA) was used as a control for comparing the transcriptomes, and a P‐value <0.05 and log2‐fold change of ±2 was set as the threshold. The results indicate that histidine taken up by GS115 cultured in YPA (GS115‐YPAH5x) or synthesized intracellularly in X33 (X33‐YPA) alters the transcriptome of K. phaffii (Fig. 4A–C).

Fig. 4

Effect of histidine on K. phaffii transcriptome. (A–C) Heat map and Volcano plots depicting overall change in the mRNA profile in the presence of histidine. (D,E) Venn diagrams representing the number of genes in each sector. b and e depict shared differentially expressed genes in both the test conditions, whereas a, c, d, f depict exclusive down‐ or upregulated genes. (F,G) Topmost downregulated genes are presented in heat maps. (H,I) Topmost upregulated genes are presented in heat maps. Asterisks depict the shared genes in histidine synthesized vs. histidine‐ supplemented conditions. Even though GS115/X‐33 was used for RNAseq, gene names are derived from CBS7435, since the CBS7435 genome sequence has been analyzed more carefully and annotated manually.

Interestingly, the overall changes in the transcriptome of X33‐YPA are similar to that of GS115‐YPAH5x. Among the 236 and 148 genes downregulated in X33‐YPA and GS115‐YPAH5x,, respectively, 126 are downregulated in both (Fig. 4D). Similarly, among the 137 and 142 genes upregulated in X33‐YPA and GS115‐YPAH5x,, respectively, 75 are upregulated in both (Fig. 4E). Also, five of the ten most downregulated genes and eight among the ten most upregulated genes are shared between GS115‐YPAH5x and X33‐YPA (Fig. 4F–I). Thus, histidine responsive genes, which are activated or repressed in K. phaffii histidine auxotroph (GS115) cultured in YPAH (GS115‐YPAH5x) as well as K. phaffii prototroph (X33) cultured in YPA (X33‐YPA) may have a key role in promoting the growth of P. pastoris cultured in YPA. Further analysis of histidine‐responsive genes differentially expressed in both GS115‐YPAH5x and X33‐YPA (b and e of Fig. 4D,E) revealed that 14 genes described as nuclear‐encoded subunits of mitochondrial F1F0 ATP synthase, involved in oxidative phosphorylation (Fig. 5A, top panel), are upregulated in GS115‐YPAH5x as well as X33‐YPA. Further, ARC1, annotated as a protein that binds tRNA and methionyl‐ and glutamyl‐tRNA synthetases (https://www.uniprot.org/uniprot/P46672), is downregulated in GS115‐YPAH5x and X33‐YPA. When ARC1 is downregulated, methionyl‐tRNA synthetase localizes to the nucleus and activates the transcription of several genes involved in oxidative phosphorylation, including those encoding mitochondrial F1F0 ATP synthase [23, 24]. Another set of genes upregulated in both GS115‐YPAH5x and X33‐YPA include those annotated as general amino acid, proline, methionine, arginine, and dicarboxylic amino acid permeases and transporters such as iron transporter, copper transporter, siderophore ion transporter, and ferrioxamine B transporter (Fig. 5B). Genes that are downregulated in both GS115‐YPAH5x and X33‐YPA include those encoding enzymes involved in the biosynthesis of amino acids and micronutrients (Fig. 5C). Overall, these results suggest that enhanced oxidative phosphorylation, facilitation of nutrient import, and inhibition of biosynthetic reactions are likely to result in an increase in intracellular ATP levels leading to the robust growth of K. phaffii in YPA.

Fig. 5

Identification of histidine‐responsive gene groups. (A) Genes ≥2‐fold upregulated in either X33‐YPA or GS115‐YPAH5x encoding for ATP synthase subunits. Bottom panel depicts ~1‐‐fold downregulation of gene involved in repression of ATP synthase subunit expression, ARC1. (B) Genes ≥2‐fold upregulated in either X33‐YPA or GS115‐YPAH5x encoding for transporters and nutrient uptake permeases (C). Genes ≤ −2 downregulated in either X33‐YPA or GS115‐YPAH5x encoding for enzymes for amino acid and micronutrient biosynthesis. Heat map illustrates expression levels of genes, along with its description and annotation. Even though GS115/X‐33 was used for RNAseq, gene names are derived from CBS7435 since CBS7435 genome sequence has been analyzed more carefully and annotated manually.

Discussion

A serendipitous observation that prototrophic (X33) and histidine auxotrophic (GS115) strains of K. phaffii exhibit differential growth when cultured in YPA medium led to the identification of histidine‐responsive genes, hitherto unreported in any yeast species. The nexus between histidine auxotrophy and growth defect in cells cultured under nutrient‐rich conditions is rather puzzling, since yeast auxotrophs rarely exhibit a phenotype when cultured in yeast extract and peptone, a rich source of amino acids and other metabolic intermediates. Thus, defects in amino acid biosynthetic pathways do not affect the growth of auxotrophs under these culture conditions, as observed in the case of GS115 and X33 cultured in YPD, YPG, and YP. The fact that histidine auxotrophy affects growth only in cells cultured in YPA motivated us to investigate this phenomenon further. We first demonstrated that K. phaffii GS115 lacking HIS4 does not grow as efficiently as X33 in YPA, and expression of HIS4 in GS115 reverses the growth defect. Analysis of mutations that affect HIS4C indicated that disruption of histidinol dehydrogenase activity of HIS4, required for the conversion of histidinol to histidine, the last step of histidine biosynthesis, is responsible for the growth defect of GS115. Thus, disruption of the biosynthesis of histidine but not purine causes a growth defect in K. phaffii when cultured in YPA. Subsequent studies indicated that histidine, the endproduct of the histidine biosynthetic pathway, is required for optimal growth of K. phaffii in YPA. Histidine‐dependent growth in YPA is unique to K. phaffii and is not observed in S. cerevisiae BY4741, a histidine auxotroph, carrying a deletion in HIS3.

Histidine transamination results in the generation of glutamate through the action of ARO8 in Candida glabrata [25] whereas it is deaminated to generate glutamate and ammonia in bacteria and mammals [22]. While glutamate can enter the TCA cycle and contribute to ATP generation, ammonia serves as the inorganic nitrogen donor. A role for histidine‐derived glutamate and ammonium in the growth of K. phaffii in YPA is unlikely, since neither facilitates growth in YPA. Thus, histidine mediates the growth of K. phaffii only in the presence of an organic source of nitrogen, such as amino acids. Whether ammonium sulfate interferes with the regulation of histidine‐responsive genes in cells cultured in YPA remains to be investigated.

Histidine/histidine derivatives are known to have pleiotropic functions in different organisms. For example, imidazole propionate derived from histidine of gut microbiota in individuals with type 2 diabetes functions as a signaling molecule involved in activating mammalian Target of Rapamycin 1 [26]. Histidine is involved in the regulation of glucagon prehormone, and preproglucagon mRNA in the pancreas [27]. Histidine supplementation is used as therapy in multiple diseases due to its antioxidant and antiinflammatory properties, proton‐buffering power, metal ion chelation, protection against glycation, and lipooxidation [28, 29, 30]. In S. cerevisiae, histidine maintains copper homeostasis [31] and affects biofilm‐forming Flor yeast's growth by completely inhibiting the biofilm formation by nonspecific interactions [32]. Histidine uptake in a few bacteria has been associated with the maintenance of pH and redox potential. For example, in Lactobacillus buchneri, histidine is imported via histidine/histamine antiporter, and once inside the cell, histidine gets decarboxylated to form histamine, which has an additional positive charge. Excretion of this histamine results in a net positive charge in the medium. This proton motive force has been attributed to generate ATP by the F1F0 ATPase [33, 34]. However, this mechanism is unlikely to operate in K. phaffii, since its genome does not encode histidine decarboxylase required to synthesize histamine from histidine. Specific aminoacyl tRNA synthetases function as amino acid sensors and regulate cell signaling, apoptosis, or inflammation [35, 36]. Whether histidyl tRNA synthetases can function as histidine sensors and regulate growth in K. phaffii is a topic of future study.

The fact that imidazole propionate derived from histidine of gut microbiota in individuals with type 2 diabetes functions as a signaling molecule involved in activating mammalian Target of Rapamycin [26] prompted us to investigate whether histidine can alter gene expression of P. pastoris cultured in YPA by RNA seq. We have identified several genes whose expression is modulated by histidine synthesized intracellularly as well as that obtained extracellularly. High similarity in the gene expression profiles of GS115‐YPAH5x and X33‐YPA suggests that histidine regulates gene expression after entry into the cells via an intracellular signal transduction pathway rather than via cell surface proteins. The fact that several genes involved in mitochondrial oxidative phosphorylation are upregulated in GS115‐YPAH5x and X33‐YPA suggests that enhanced production of ATP may be one of the mechanisms by which histidine promotes growth. In S. cerevisiae, high acetate levels result in rapid ATP depletion due to its conversion to Acetyl‐Co‐A, and as a result cells enter into a prolonged lag phase and normal growth is restored only after several days [38]. Rapid depletion of ATP does not occur in cells cultured in YP or YPG, since acetate production and its conversion to Acetyl‐Co‐A is not high enough to result in ATP depletion. Thus, histidine‐mediated activation of transcription of genes required for ATP synthesis in GS115‐YPAH5x and X33‐YPA YPA may result in rapid replenishment of ATP, leading to normal growth. It is tempting to speculate that low ATP levels in K. phaffii cultured in YPA is sensed by a histidine‐mediated signaling pathway leading to upregulation of nuclear genes encoding F1F0ATPase, enhanced oxidative phosphorylation, restoration of intracellular ATP levels, and growth. Since metabolic intermediates such as amino and ketoacids are readily available in the YPA medium, the newly synthesized ATP is used for cell division and growth rather than biosynthetic processes. The fact that genes encoding several permeases and transporters are also upregulated in GS115‐YPAH5x and X33‐YPA suggests that biosynthetic intermediates can be rapidly imported into the cell, thus favoring growth. In this context, it is pertinent to note that GAP1 encoding the general amino acid permease involved in the transport of several amino acids [37] is also highly upregulated in GS115‐YPAH5x and X33‐YPA (Fig. 4H). It is possible that histidine has to compete with other amino acids and peptides in YPA for its import via GAP. One way to improve the efficiency of histidine import is by increasing the amount of histidine in the medium. Thus, histidine may be imported more efficiently in GS115 cultured in YPAH5x than YPAH1x.

Histidine is known to act as a buffer and it is possible that the buffering property of histidine added to the culture medium may enhance nutrient uptake and contribute to growth. However, this is unlikely, since histidine biosynthesized intracellularly also promotes growth of K. phaffii in YPA. It is pertinent to note that lysates of GS115 and X33 cultured in YPA, when examined by SDS‐PAGE followed by Coomassie Brilliant Blue staining, exhibit similar protein profiles (data not shown), suggesting that histidine auxotrophy does not result in the deficiency of Coomassie blue‐stainable proteins in these lysates. However, it is possible that histidine deficiency results in a decrease in the synthesis of certain histidine‐rich proteins essential for the growth of cells cultured in YPA which are less abundant and hence cannot be visualized in SDS polyacrylamide gels.

Yeast extract contains B‐complex vitamins and amino acids necessary for growth, while peptone acts as the source of nitrogen, vitamins, and minerals. They are routinely used for culturing recombinant yeast strains producing drugs, vaccines, and biotherapeutics. This study demonstrates for the first time that media containing yeast‐based organic nitrogen sources and acetate as carbon spruce are not preferable for the growth of histidine auxotrophs of K. phaffii such as GS115. We recommend using K. phaffii prototrophs rather than histidine auxotrophs for high‐density fermentation and production of acetate‐derived compounds.

Conflict of interest

The authors declare that they have no conflicts of interest for the contents of this article.

Author contributions

AG and PNR conceived and designed the project, analyzed the data, and wrote the article. AG carried out the experiments. PNR obtained funding.

Table S1. RNA seq analysis of GS115 and X33 cultured in YPA and GS115 cultured in YPAH5X.

Click here for additional data file.