| Literature DB >> 35409961 |
Tao Yuan1, Zi-Bo Lin2, Sen Cheng2, Rui Wang2, Ping Lu2.
Abstract
A majority of subsidence lakes were reclaimed as fish ponds, but the widespread use of antibiotics has caused the pollution of antibiotic resistance genes (ARGs). This paper uses zeolite as a filter material to construct a horizontal submersible wastewater treatment device and explores its effect on the removal of conventional pollutants and sulfonamide ARGs in wastewater. The results showed that the removal of total nitrogen and ammonia nitrogen by the zeolite filter media were 59.0% and 63.8%, respectively, which were higher than the removal of total phosphorus and COD. The absolute abundances of sul1 and sul2 in wastewater were 2.81 × 104 copies·L-1 and 2.42 × 103 copies·L-1. On average, 60.62% of sul1 and 75.84% of sul2 can be removed, and more than 90% of sul1 and sul2 can be removed. Experiments showed that the residence time of wastewater in the treatment device had a significant impact on removal. The microbial community structure of aquaculture wastewater was quite different before and after wastewater treatment. The abundance changes of Saccharimonadales and Mycobacterium affect the removal of sulfonamide ARGs.Entities:
Keywords: antibiotic resistance genes; aquaculture wastewater; microbial communities; water treatment
Mesh:
Substances:
Year: 2022 PMID: 35409961 PMCID: PMC8998867 DOI: 10.3390/ijerph19074281
Source DB: PubMed Journal: Int J Environ Res Public Health ISSN: 1660-4601 Impact factor: 3.390
Figure 1Schematic diagram of wastewater treatment device.
Gene sequencing primers.
| Gene Name | Primer Name | Primer Sequence (5′ → 3′) | Product Size/bp | Annealing Temperature/°C |
|---|---|---|---|---|
|
| CACCGGAAACATCGCTGCA | 159 | 58 | |
| AAGTTCCGCCGCAAGGCT | ||||
|
| CTCCGATGGAGGCCGGTAT | 191 | 58 | |
| GGGAATGCCATCTGCCTTGA | ||||
| 16S rRNA | 16S-F | TGTGTAGCGGTGAAATGCG | 140 | 62 |
| 16S-R | CATCGTTTACGGCGTGGAC |
Figure 2Removals of Conventional pollutants.
Figure 3Removal of ARGs.
Figure 4Relative abundance of sulfonamide ARGs.
Figure 5Microbial community structure in the influent and effluent of the device.