| Literature DB >> 35400106 |
Minghong Tang1,2, Rejun Fang1,2, Junjing Xue1,2, Kaili Yang1,2, Yi Lu3.
Abstract
The objective of this experiment was to study the effects of catalase (CAT) on growth performance, antioxidant capacity, intestinal morphology, and microbial composition of yellow broilers. Male Lingnan yellow broilers (360), aged 1 day, were randomly divided into control group (CON) (fed with a basic diet), R1 group (fed with basic diet + 150 U/kg catalase), and R2 group (fed with basic diet + 200 U/kg catalase). Each group had 8 replicates and 15 chickens in each replicate. The test is divided into the early stage (1-30 days) and the later stage (31-60 days). The results showed that compared with the control group, groups R1 and R2 significantly (p < 0.05) increased the weight gain and reduced (p < 0.05) the ratio of feed to gain in the early and the whole stages; prominently increased (p < 0.05) the concentration of total antioxidant capacity (T-AOC), the activities of CAT, superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) in livers, the activities of CAT and GSH-Px in serum, and CAT in the jejunum in the early and the later stages; markedly increased (p < 0.05) the villus height and the ratio of villus height to crypt depth of the duodenum in the early and the later stages, the villus height and the villus height:crypt depth ratio of the jejunum and ileum in the early stage, and significantly lowered (p < 0.05) the crypt depth of the duodenum (in the early and the later stages), jejunum, and ileum (in early stage); memorably (p < 0.05) increased the number of total bacteria and Bacteroidetes in ceca, as well as the number of Lactobacillus in the jejunum (p < 0.05) on the 30th; significantly (p < 0.05) increased the mRNA expression of junction adhesion molecule 2 (JAM2), mucin 2 (MCU2), and occlusal protein (occludin) in the duodenum in the early stage, and increased (p < 0.05) the mRNA expression of JAM2 in the jejunum in the later stage. Collectively, adding catalase (CAT) to the diet of yellow broilers can improve the growth performance and the antioxidant capacity, promoting the integrity of intestinal morphology, optimizing the composition of intestinal microorganisms, and upregulating the mRNA expression of tight junction protein.Entities:
Keywords: antioxidant capacity; catalase; growth performance; intestinal morphology; junction protein; microbial composition; yellow broilers
Year: 2022 PMID: 35400106 PMCID: PMC8988485 DOI: 10.3389/fvets.2022.802051
Source DB: PubMed Journal: Front Vet Sci ISSN: 2297-1769
Composition and nutrient levels of basal diets (air-dry basis).
|
|
|
|
| ||
|---|---|---|---|---|---|
|
|
|
|
| ||
| Corn | 46.0 | 45.1 | Metabolizable energy (MJ/kg) | 12.55 | 13.39 |
| Wheat | 10.0 | 15.0 | Crude protein (%) | 21.00 | 19.0 |
| Soybean meal (cp 43%) | 32.5 | 25.1 | Calcium (%) | 0.90 | 0.85 |
| Corn protein meal (cp 60%) | 3.0 | 4.0 | Available phosphorus (%) | 0.45 | 0.42 |
| Limestone | 1.16 | 1.15 | Lysine (%) | 1.16 | 1.02 |
| Dicalcium phosphate | 1.67 | 1.55 | Methionine (%) | 0.5 | 0.46 |
| Lard | 3.85 | 6.25 | |||
| Sodium chloride | 0.3 | 0.30 | |||
| 0.36 | 0.40 | ||||
| 0.16 | 0.15 | ||||
| Premix | 1.00 | 1.0 | |||
The premix provided the following per kg of diets: VA 7,800 IU, VD.
Nutrient levels were measured except for metabolizable energy (ME). ME was a calculated value.
Primers used for bacterial count real-time PCR.
|
|
|
|
|
|---|---|---|---|
| Total bacteria | F: GTGSTGCAYGGYYGTCGTCA | 200 | ( |
| Firmicutes | F: GGAGYATGTGGTTTAATTCGAAGCA | 126 | ( |
| Bacteroidea | F: GGARCATGTGGTTTAATTCGATGAT | 126 | ( |
| F: GCACAAGCAGTGGAGT | 239 | ( | |
| F: CGGTACCTGACTAAGAAGC | 190 | ( | |
|
| F: AGCAGTAGGGAATCTTCCA | 345 | ( |
|
| F: CATGCCGCGTGTATGAAGAA | 95 | ( |
Primers used for real-time PCR analysis.
|
|
|
|
|
|---|---|---|---|
| F: AGCCTCAAATGGGATTGGATT | 59 | ( | |
|
| F: GCCTGCCCAGGAAATCAAG | 59 | ( |
| Occludin | F: GAGCCCAGACTACCAAAGCAA | 68 | ( |
| F: CCGCAGTCGTTCACGATCT | 63 | ( | |
|
| F: GGCACGCCATCACTATC | 128 | ( |
JAM2, junction adhesion molecule 2; occludin, occlusal protein; ZO-1, cyclic protein-1; GADPH, glyceraldehyde-3-phosphate dehydrogenase.
Effects of catalase (CAT) on growth performance of yellow broilers.
|
|
|
|
| |
|---|---|---|---|---|
| 1– | CON | 499.20 ± 12.31 | 1011.42 ± 16.17 | 2.03 ± 0.05 |
| 30 days | R1 | 559.12 ± 8.45 | 1046.17 ± 15.91 | 1.87 ± 0.02 |
| R2 | 585.73 ± 14.60 | 1019.43 ± 11.29 | 1.74 ± 0.05 | |
| 31– | CON | 729.34 ± 61.58 | 2034.35 ± 40.28 | 2.81 ± 0.22 |
| 60 days | R1 | 783.58 ± 76.02 | 2056.45 ± 33.87 | 2.65 ± 0.25 |
| R2 | 781.15 ± 67.82 | 2043.47 ± 36.26 | 2.63 ± 0.18 | |
| 1– | CON | 1228.54 ± 68.37 | 3045.77 ± 50.32 | 2.48 ± 0.12 |
| 60 days | R1 | 1342.71 ± 76.50 | 3102.62 ± 32.80 | 2.35 ± 0.14 |
| R2 | 1366.88 ± 67.01 | 3062.90 ± 40.00 | 2.24 ± 0.08 | |
Data are the mean ± SEM (n = 8). CON-broilers fed the basal diet, R1-broilers fed the basal diet supplemented with 150 U/kg of CAT, R2-broilers fed the basal diet supplemented with 200 U/kg of CAT.
Values within the same period and the same column with different letters differ (p < 0.05).
Effects of CAT on antioxidant indices of yellow broilers.
|
|
|
|
|
|
| ||
|---|---|---|---|---|---|---|---|
| 30th day |
|
|
|
|
|
| |
| Liver | CON | 0.12 ± 0.02 | 19.59 ± 6.23 | 941.63 ± 189.63 | 33.22 ± 18.79 | 0.42 ± 0.12 | |
| R1 | 0.18 ± 0.02 | 53.58 ± 15.00 | 1,182.80 ± 181.60 | 64.90 ± 13.96 | 0.36 ± 0.15 | ||
| R2 | 0.21 ± 0.05 | 66.60 ± 18.87 | 1,234.62 ± 422.53 | 66.29 ± 22.55 | 0.33 ± 0.12 | ||
|
|
|
|
|
|
| ||
| Serum | CON | 11.65 ± 1.86 | 3.44 ± 0.80 | 121.80 ± 13.83 | 570.36 ± 73.19 | 3.29 ± 0.58 | |
| R1 | 13.13 ± 1.75 | 4.43 ± 0.60 | 135.03 ± 16.14 | 695.69 ± 87.93 | 3.10 ± 0.52 | ||
| R2 | 13.50 ± 3.11 | 4.82 ± 0.72 | 139.13 ± 25.98 | 715.43 ± 125.54 | 2.72 ± 0.30 | ||
|
|
|
|
|
|
| ||
| Jejunum | CON | 0.11 ± 0.02 | 5.68 ± 2.37 | 621.84 ± 63.73 | 71.87 ± 25.70 | 2.23 ± 1.70 | |
| R1 | 0.12 ± 0.03 | 16.63 ± 7.97 | 680.65 ± 140.05 | 100.03 ± 44.63 | 1.82 ± 1.31 | ||
| R2 | 0.12 ± 0.03 | 23.22 ± 4.48 | 696.81 ± 90.19 | 103.76 ± 33.04 | 1.65 ± 0.96 | ||
| 60th day |
|
|
|
|
|
| |
| Liver | CON | 0.11 ± 0.02 | 33.55 ± 21.07 | 1,056.54 ± 212.78 | 26.50 ± 14.87 | 0.36 ± 0.14 | |
| R1 | 0.15 ± 0.05 | 69.29 ± 54.80 | 1,269.69 ± 180.37 | 53.56 ± 14.24 | 0.30 ± 0.13 | ||
| R2 | 0.17 ± 0.02 | 76.91 ± 45.35 | 1,303.23 ± 193.14 | 54.56 ± 15.32 | 0.26 ± 0.09 | ||
|
|
|
|
|
|
| ||
| Serum | CON | 13.04 ± 1.55 | 4.53 ± 1.03 | 167.24 ± 13.85 | 678.52 ± 110.56 | 2.53 ± 0.54 | |
| R1 | 17.00 ± 2.24 | 6.29 ± 0.73 | 179.54 ± 18.75 | 869.29 ± 139.07 | 2.45 ± 0.34 | ||
| R2 | 17.54 ± 1.50 | 8.07 ± 1.79 | 184.16 ± 17.86 | 1,005.47 ± 143.97 | 2.40 ± 0.34 | ||
|
|
|
|
|
|
| ||
| Jejunum | CON | 0.10 ± 0.03 | 5.25 ± 2.20 | 590.41 ± 60.51 | 68.55 ± 20.21 | 2.13 ± 1.59 | |
| R1 | 0.11 ± 0.02 | 16.00 ± 7.07 | 626.38 ± 106.40 | 92.92 ± 38.89 | 1.77 ± 1.27 | ||
| R2 | 0.12 ± 0.03 | 20.74 ± 3.29 | 643.46 ± 125.67 | 97.29 ± 30.46 | 1.72 ± 1.30 |
Data are the mean ± SEM (n = 8). CON-broilers fed the basal diet, R1-broilers fed the basal diet supplemented with 150 U/kg CAT, R2-broilers fed the basal diet supplemented with 200 U/kg of CAT.
Values within the same period and the same column with different letters differ (p < 0.05). T-AOC, total antioxidant capacity; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; MDA, malondialdehyde.
Effects of CAT on intestinal morphology of yellow broilers.
|
|
|
|
| ||||||
|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|
|
|
|
|
| |
|
| |||||||||
| CON | 1,078.73 ± 173.30 | 148.76 ± 28.17 | 7.46 ± 1.72 | 814.71 ± 41.87 | 135.79 ± 25.58 | 6.19 ± 1.21 | 620.03 ± 41.26 | 121.00 ± 17.85 | 5.21 ± 0.74 |
| R1 | 1,259.76 ± 136.30 | 106.53 ± 16.41 | 12.1 ± 2.44 | 969.73 ± 58.93 | 93.21 ± 9.92 | 10.06 ± 0.75 | 707.88 ± 32.53 | 91.15 ± 24.69 | 8.20 ± 1.95 |
| R2 | 1,301.29 ± 65.09 | 104.66 ± 18.56 | 12.77 ± 2.33 | 933.25 ± 65.53 | 85.14 ± 21.27 | 12.33 ± 4.44 | 719.67 ± 33.07 | 83.20 ± 15.14 | 8.91 ± 1.70 |
|
| |||||||||
| CON | 1,409.31 ± 83.85 | 211.68 ± 28.28 | 6.74 ± 0.80 | 758.50 ± 42.89 | 164.95 ± 43.08 | 4.89 ± 1.33 | 832.47 ± 77.48 | 141.07 ± 32.12 | 6.21 ± 1.60 |
| R1 | 1,587.57 ± 115.14 | 175.50 ± 47.54 | 9.60 ± 2.39 | 1,086.34 ± 42.56 | 156.06 ± 17.06 | 7.04 ± 0.84 | 879.54 ± 38.84 | 133.21 ± 37.30 | 7.29 ± 2.90 |
| R2 | 1,542.84 ± 103.74 | 121.91 ± 16.20 | 12.79 ± 1.36 | 1,098.19 ± 70.71 | 150.31 ± 20.54 | 7.48 ± 1.44 | 863.99 ± 32.06 | 102.13 ± 21.54 | 8.80 ± 1.88 |
Data are the mean ± SEM (n = 8). CON-broilers fed the basal diet, R1-broilers fed the basal diet supplemented with 150 U/kg of CAT, R2-broilers fed the basal diet supplemented with 200 U/kg of CAT.
Values within the same period and the same column with different letters differ (p < 0.05).
Effects of CAT on the intestinal microbial composition of 30-day old yellow broilers.
|
|
|
| ||||
|---|---|---|---|---|---|---|
|
|
|
|
|
|
| |
| Total bacteria | 9.50 ± 0.59 | 10.25 ± 0.1.11 | 9.52 ± 3.45 | 11.20 ± 0.24 | 12.06 ± 0.54 | 12.16 ± 0.69 |
| Firmicutes | 8.75 ± 0.39 | 8.70 ± 1.23 | 10.40 ± 0.59 | 10.65 ± 0.34 | 11.28 ± 0.62 | 11.56 ± 0.80 |
| Bacteroidetes | 8.06 ± 6.74 | 8.78 ± 1.25 | 9.28 ± 1.20 | 10.47 ± 0.55 | 11.37 ± 0.45 | 11.38 ± 0.69 |
| – | – | – | 10.46 ± 0.28 | 11.17 ± 0.26 | 10.75 ± 0.63 | |
| 6.75 ± 0.50 | 6.90 ± 0.39 | 6.42 ± 0.61 | 10.81 ± 0.53 | 11.58 ± 0.48 | 11.28 ± 0.70 | |
| Lactobacillus | 8.90 ± 0.51 | 10.30 ± 1.04 | 11.37 ± 0.32 | 9.81 ± 0.57 | 11.44 ± 0.77 | 9.85 ± 1.14 |
|
| 7.21 ± 0.49 | 6.73 ± 0.76 | 6.49 ± 0.99 | 9.93 ± 0.70 | 9.32 ± 1.15 | 8.82 ± 0.94 |
Data are the mean ± SEM (n = 8). CON-broilers fed the basal diet, R1-broilers fed the basal diet supplemented with 150 U/kg of CAT, R2-broilers fed the basal diet supplemented with 200 U/kg of CAT.
Values within the same intestinal segment and the same row with different letters differ (p < 0.05).
Figure 1Effects of dietary catalase supplementation on intestinal microbial composition of 30-day-old yellow broilers. Data are the mean ± SEM (n = 8). CON-broilers fed the basal diet, R1-broilers fed the basal diet supplemented with 150U/kg CAT, R2-broilers fed the basal diet supplemented with 200U/kg CATa,b,c within the same intestinal segment and the same strain, means with different superscript letters differ (P < 0.05).
Figure 2Effects of dietary catalase supply on tight junction protein mRNA expression in the intestinal mucosa of yellow broilers. Data are the mean ± SEM (n = 8). CON-broilers fed the basal diet, R1-broilers fed the basal diet supplemented with 150 U/kg CAT, R2-broilers fed the basal diet supplemented with 200 U/kg CATa,b,c within the same intestinal segment and the same protein, means with different superscript letters differ (p < 0.05).