| Literature DB >> 35391823 |
Gaëtan Philippot1, Kimia Hosseini1, Armine Yakub1, Yasser Mhajar1, Mariam Hamid1, Sonja Buratovic2, Robert Fredriksson1.
Abstract
Paracetamol, or acetaminophen (AAP), is the most commonly used analgesic during pregnancy and early life. While therapeutic doses of AAP are considered harmless during these periods, recent findings in both humans and rodents suggest a link between developmental exposure to AAP and behavioral consequences later in life. The aim of this study is to evaluate the impact of neonatal exposure to clinically relevant doses of AAP on adult spontaneous behavior, habituation, memory, learning, and cognitive flexibility later in life using a mouse model. Markers of oxidative stress, axon outgrowth, and glutamatergic transmission were also investigated in the hippocampus during the first 24 h after exposure. In addition, potential long-term effects on synaptic density in the hippocampus have been investigated. In a home cage setting, mice neonatally exposed to AAP (30 + 30 mg/kg, 4 h apart) on postnatal day 10 displayed altered spontaneous behavior and changed habituation patterns later in life compared to controls. These mice also displayed reduced memory, learning and cognitive flexibility compared to control animals in the Morris water maze. An increase of markers for oxidative stress was observed in the hippocampus 6 h after AAP exposure. As AAP is the first choice treatment for pain and/or fever during pregnancy and early life, these results may be of great importance for risk assessment. Here we show that AAP can have persistent negative effects on brain development and suggest that AAP, despite the relatively low doses, is capable to induce acute oxidative stress in the hippocampus.Entities:
Keywords: analgeic; developmental toxicity; mice; neurotoxcity; paracetamol
Year: 2022 PMID: 35391823 PMCID: PMC8981466 DOI: 10.3389/ftox.2022.867748
Source DB: PubMed Journal: Front Toxicol ISSN: 2673-3080
Gene-Specific Primer Sequences Used for qPCR.
| Target name | Accession No. | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|---|
| Gapdh | NM_008084.3 | GGGCTCCCTAGGCCCCTCCTCTTAT | CACCCCAGCAAGGACACTGAGCAAG |
|
| NM_008828.3 | CTCCGCTTTCATGTAGAGGAAG | GACATCTCCTAGTTTGGACAGTG |
|
| NM_010902.4 | GCCCACATTCCCAAACAAGAT | CCAGAGAGCTATTGAGGGACTG |
|
| NM_016679.4 | TGCCCCTGTGGTCAAAGTG | GGTTCGGTTACCGTCCTGC |
FIGURE 1Behavioral assessments in adulthood following neonatal exposure to AAP. (A) Spontaneous behavior in 3-month-old mice exposed to vehicle or AAP (30 + 30 mg/kg, 4 h apart) on PND 10. Distance traveled (mm) during each of the three time spells were measured when the mice were introduced to a new home cage (n = 10). (B) Swim maze performance in four-month-old mice (n = 10–12) exposed to vehicle or AAP (30 + 30 mg/kg, 4 h apart) on PND 10. Latencies (s) to locate the platform were measured during the 4 days acquisition period (trials 1–20) and (C) during re-learning period on the fifth day (trials 21–25). Statistical differences are indicated as * if significantly different vs. controls p ≤ 0.05 and ** if significantly different vs. controls p ≤ 0.01. Bars represent means ± SEM.
FIGURE 2Transcript level ratios of the genes Nrf2 and Keap1 2, 6, 12, and 24 h after exposure to vehicle or AAP (30 + 30 mg/kg, 4 h apart) on PND 10. ΔCT in Nrf2/Keap1 expression ratio is relative to that of the corresponding untreated mice at each time point (not shown). Statistics were done on the raw data (ΔCT) at each time point. **, p < 0.005 (by Student’s t test). Bars represent means ± SEM of six mice.
FIGURE 3Protein levels, presented as relative intensity of total protien levels, of (A) GLUR1 and (B) GAP-43 of male NMRI mice 24 h after exposure to either vehicle (control) or 30 + 30 mg/kg AAP. “C1-5” represent control samples in the blot; “P1-6” represents AAP samples in the blot. The height of the bars represent the mean ± SEM value of five to six animals.
FIGURE 4Immunofluorescence staining of SYP in (A) CA3 and (B) DG coronal sections of the adult mouse hippocampus (Bregma −1.94). Nucleic staining with DAPI accompanied by immunological staining for SYP. Scale bar = 100 µm. Histogram show relative immunofluorescence intensity/A.U. of SYP measured in male adult mice after neonatal exposure to either saline vehicle or AAP on PND 10 in CA3 and DG. p > 0.05. The height of the bars represent mean value ±SEM. Each exposure group contained n = 4 mice.