Neonatal mice with heterozygous mutations in genes encoding the skin barrier proteins filaggrin and mattrin (flaky tail mice [FT+/-]) exhibit oral peanut-induced anaphylaxis after skin sensitization. As we have previously reported, sensitization in this model is achieved via skin co- exposure to the environmental allergen Alternaria alternata (Alt), peanut extract (PNE), and detergent. However, the function of Alt in initiation of peanut allergy in this model is little understood. The purpose of this study was to investigate candidate cytokines induced by Alt in the skin and determine the role of these cytokines in the development of food allergy, namely oncostatin M (Osm), amphiregulin (Areg), and IL-33. RT-qPCR analyses demonstrated that skin of FT+/- neonates expressed Il33 and Osm following Alt or Alt/PNE but not PNE exposure. By contrast, expression of Areg was induced by either Alt, PNE, or Alt/PNE sensitization in FT+/- neonates. In scRNAseq analyses, Osm, Areg, and Il33 were expressed by several cell types, including a keratinocyte cluster that was expanded in the skin of Alt/PNE-exposed FT+/- pups as compared to Alt/PNE-exposed WT pups. Areg and OSM were required for oral PNE-induced anaphylaxis since anaphylaxis was inhibited by administration of neutralizing anti-Areg or anti-OSM antibodies prior to each skin sensitization with Alt/PNE. It was then determined if intradermal injection of recombinant IL33 (rIL33), rAreg, or rOSM in the skin could substitute for Alt during skin sensitization to PNE. PNE skin sensitization with intradermal rIL33 was sufficient for oral PNE-induced anaphylaxis, whereas skin sensitization with intradermal rAreg or rOSM during skin exposure to PNE was not sufficient for anaphylaxis to oral PNE challenge. Based on these studies a pathway for IL33, Areg and OSM in Alt/PNE sensitized FT+/- skin was defined for IgE induction and anaphylaxis. Alt stimulated two pathways, an IL33 pathway and a pathway involving OSM and Areg. These two pathways acted in concert with PNE to induce food allergy in pups with skin barrier mutations.
Neonatal mice with heterozygous mutations in genes encoding the skin barrier proteins filaggrin and mattrin (flaky tail mice [FT+/-]) exhibit oral peanut-induced anaphylaxis after skin sensitization. As we have previously reported, sensitization in this model is achieved via skin co- exposure to the environmental allergen Alternaria alternata (Alt), peanut extract (PNE), and detergent. However, the function of Alt in initiation of peanut allergy in this model is little understood. The purpose of this study was to investigate candidate cytokines induced by Alt in the skin and determine the role of these cytokines in the development of food allergy, namely oncostatin M (Osm), amphiregulin (Areg), and IL-33. RT-qPCR analyses demonstrated that skin of FT+/- neonates expressed Il33 and Osm following Alt or Alt/PNE but not PNE exposure. By contrast, expression of Areg was induced by either Alt, PNE, or Alt/PNE sensitization in FT+/- neonates. In scRNAseq analyses, Osm, Areg, and Il33 were expressed by several cell types, including a keratinocyte cluster that was expanded in the skin of Alt/PNE-exposed FT+/- pups as compared to Alt/PNE-exposed WT pups. Areg and OSM were required for oral PNE-induced anaphylaxis since anaphylaxis was inhibited by administration of neutralizing anti-Areg or anti-OSM antibodies prior to each skin sensitization with Alt/PNE. It was then determined if intradermal injection of recombinant IL33 (rIL33), rAreg, or rOSM in the skin could substitute for Alt during skin sensitization to PNE. PNE skin sensitization with intradermal rIL33 was sufficient for oral PNE-induced anaphylaxis, whereas skin sensitization with intradermal rAreg or rOSM during skin exposure to PNE was not sufficient for anaphylaxis to oral PNE challenge. Based on these studies a pathway for IL33, Areg and OSM in Alt/PNE sensitized FT+/- skin was defined for IgE induction and anaphylaxis. Alt stimulated two pathways, an IL33 pathway and a pathway involving OSM and Areg. These two pathways acted in concert with PNE to induce food allergy in pups with skin barrier mutations.
Food allergy is a severe and potentially life-threatening disease that can develop early in life and affects about 8% of children (1–3). While there is no cure for food allergy, oral peanut immunotherapy is a promising therapeutic approach (4). The Learning Early About Allergy to Peanut (LEAP) trial identified that early introduction of peanut is beneficial in reducing development of peanut allergy in children (5, 6). However, although this intervention was efficacious, 9% of children were excluded from the study (7) because they were skin prick positive for peanut sensitization at the start of the study and another 5% were excluded because of reactions during oral peanut exposures (7). Notably, a number of these high-risk children who had early onset of peanut allergy also had eczema, suggesting a potential link between skin exposure to peanut and development of peanut allergy in children.Food allergy occurs in up to 35% of children with atopic dermatitis (8). In fact, early-onset of atopic dermatitis (by age 2) is associated with increased risk of food allergy (9, 10). The development of atopic dermatitis is linked to loss-of-function mutations in the skin barrier genes SPINK5, a serine protease inhibitor, FLG (filaggrin), which crosslinks keratin fibers in keratinocytes (11) and Tmem79 (mattrin), a transmembrane protein involved in stratum corneum barrier function (12). These loss-of-function mutations in skin barrier genes have been found in infants and children with peanut allergy (13–17). Interestingly, in children, barrier defects caused by FLG mutations precede clinical eczema diagnosis (18). Similarly, in neonatal mice with heterozygous skin barrier mutations Flg and Tmem79 (Flaky Tail mice, FT+/−), skin sensitization to food allergens (19) occurs well before the spontaneous development of eczema (20), suggesting that allergen sensitization can occur before the onset of atopic dermatitis. Approaches are needed for clinical food allergy studies for stratifying individuals before their development of atopic dermatitis (18).The development of atopic dermatitis and allergies is associated with exposure to environmental fungal allergens and house dust mite (HDM) allergen (21), commonly found in household dust (22–26). Studies have shown that patients with atopic dermatitis exhibit a higher frequency of IgE reactivity to HDM (27) or the fungal allergen Alternaria alternata (Alt) (28). Alternaria alternata is the most common fungi in mold contributing to asthma and the most common fungi known to be associated with allergic disease (29, 30). In a national survey of lead allergens in US homes, Alternaria antigens were found to be in 95–99% of dust samples at a concentration of 4.88 μg/g. Alternaria is very prevalent in homes in the US and can get into the household through hair, skin, clothing, pet fur, shoes, or through cracks in the house. The levels of Alternaria in the household can vary due to region, homeowner behavior, and housing characteristics but nonetheless Alternaria antigens were found in virtually all homes across the US (29).Previously published data from our lab demonstrated that heterozygous skin barrier mutations in Flg and Tmem79 together with skin co-exposure to detergent, food allergen (egg or peanut), and a ubiquitous environmental allergen (HDM or Alt) at doses commonly found in household dust mediate the development of food allergy in neonatal mice (19). Since either HDM or Alt exposure with peanut induced food allergy, the induction of food allergy was not specific to fungal allergens. Although fungal allergens can exhibit protease activity, we have reported that Alt does not degrade the proteins in peanut extract (19). Moreover, the effect of Alt is not specific to peanut because co-exposure of Alt and chicken egg ovalbumin on skin of FT+/− pups also induce food allergy to OVA (19). The detergent on the skin functions to aid skin adsorption of saline and allergens (19). In our previous manuscript, Alt was required for the sensitization to food allergen, Alt/PNE co-exposure induced IL33 expression in the skin, and blocking the receptor for IL33 blocked anaphylaxis in neonatal mice. However, it is not known whether IL33 induction required co-exposure to Alt/PNE or whether Alt alone was sufficient in the FT+/− neonates. IL-33 is induced in another food allergy model that utilizes mechanical skin disruption with tape stripping that removes layers of epidermis (31). Also, anti-IL-33 antibodies block atopic dermatitis, at least in a model with 2, 4-dinitrochlorobenzene sensitization (32). Given the critical interplay between genetic alterations in skin barrier mutations and environmental allergen exposure for the development of food allergy, it is important to characterize the mechanisms for these interactions.In skin with barrier defects, it is reported that amphiregulin (Areg) has a role in induction of itch (33) and in development of skin psoriasis (34). In atopic dermatitis in humans and mice, Areg is upregulated in several cell types in skin (35, 36). Also it is reported that Areg is induced in dendritic cells exposed to the environmental allergen Der p 1 in vitro (37). We have demonstrated that Areg is increased during allergic responses in the airways of neonatal mice (38). However, it is not known whether Areg plays a role during skin sensitization for induction of food allergy.It is reported that Areg can be induced by oncostatin M (Osm) in tumor cells (39) and that the OSM receptor functions in induction of itch in atopic dermatitis (40, 41). The OSM receptor forms a complex with the IL-31 receptor A and then IL31 binding to this receptor drives itch in atopic dermatitis (40, 41). OSM in macrophages is upregulated by histamine, a product of mast cells (42). In the lung, OSM plays a role in airway remodeling, eosinophilic airway inflammation, and airway hyperresponsiveness (43), potentially by promoting mucosal epithelial barrier dysfunction (44). Transient transgenic overexpression of Osm in lung induces B cell activation, T cell differentiation, eosinophil accumulation, and aides in DC maintenance (45). However, it is not known whether OSM plays a role during skin sensitization for induction of food allergy. Thus, here we sought to investigate the relevance of IL33, OSM, and Areg in a model of food-induced anaphylaxis that relies on Alt sensitization via the skin. We demonstrated that in neonatal FT+/− mice, the environmental allergen Alt induces skin expression of Il33, Areg, and Osm which were required for generation of PNE-specific IgE and oral PNE-induced anaphylaxis.
Materials and Methods
Mice
C57BL/6J mice, Fcer1a tm1Knt mice (FceR1a−/− mice) and Flaky Tail mice (FT−/− mice) with homozygous mutations in Flgft/ft/Tmem79ma/ma were from Jackson Laboratories, Bar Harbor, Maine. Mice were housed under specific pathogen-free barrier conditions. The Flaky tail mice on the C57BL/6 background have been previously described (12, 20, 46–48). All mice were randomly selected for the studies. The studies are approved by the Indiana University School of Medicine Institutional Review Committee for animals.
Allergens
Alternaria alternata extract (Alt, catalog #XPM1D3A2.5) was from Greer Labs. This is a standard extract from GREER used for patient immunotherapy. The protein profile in the Alt extract was assessed by SDS PAGE (Supplementary Figure 1). To generate peanut extract (PNE), peanuts (Trader Joe's roasted and unsalted Peanuts) were ground and then 25 g were homogenized in 250 ml of 20 mM Tris buffered (pH 7.2) saline (TBS) (49). This was stirred for 2 h at room temperature and centrifuged at 3,000 g for 30 min. The aqueous middle layer was collected and centrifuged at 1,600 g for 45 min to remove residual particles and fat. The aqueous layer was collected and protein concentrations were determined by Pierce BCA Protein Assay Kit (Thermo Fisher Sci). Aliquots were stored at −20°C. The Alt and PNE extracts did not contain overt protease activity because co-administration of ALT and PNE did not alter the size of the major protein bands on SDS page chromatography (19).
Allergen Sensitization
(A) Treatment of offspring (19). FT+/− offspring of the mating of wild type (WT) C57BL/6 females with FT−/− males were confirmed by genotyping (19). FT+/−FceR1−/− offspring of the mating of FceR1a−/− (C57BL/6 background) females with FT−/−FceR1−/− males was confirmed by genotyping. At 3 days old, pups were gently taped four or five times on the back with 3M surgical hypoallergenic paper tape that does not disrupt the skin (19) and wiped once with 4% SDS in sterile deionized water (50) on a sterile gauze. After 3 min, Alt extract (10 μg protein in 5 μl sterile saline) was applied to the pup skin in doses found in dust (19, 22–26). Then, immediately PNE (100 μg protein in 10 μl sterile saline) was applied to the same area on the back as we previously described in detail (19). The pups were placed in a cage without the mother for 40 min (51). Then, to prevent antigen consumption during grooming by the mother, the pups were washed gently with water on a paper towel and wiped dry to remove free antigen from the surface (51) before placing the pups back with the mother. The antigen applications were repeated 1–2 times per week as indicated in the figures, but on pups that are older than 5 days, the fur was shaved before gentle surgical paper tape application to collect the shaved fur. The taping did not overtly disrupt the skin but gently removed dried skin after birth or hair after shaving (19).(B) Intradermal administration of recombinant Areg and OSM. For studies with recombinant proteins, the pups received 5 skin sensitizations. For the pups treated with rAreg (catalog #554104, Biolegend) or rOSM (catalog #762806, Biolegend), the pups received an intradermal injection of 2.5 μg rAreg or rOSM just before each skin application of PNE. The doses for injection of these recombinant proteins were similar to those previous described for injection of mice (52–54).(C) Neutralizing Antibody Blockade of Areg and OSM. For studies with neutralizing antibodies, the pups received 5 skin sensitizations. For the pups treated with goat IgG anti-Areg (catalog #AF989, R&D Systems), goat IgG anti-OSM (catalog #AF-495-NA, R&D Systems), or IgG isotype control (catalog #BD0083, Biocell) antibodies, the pups received an intraperitoneal injection of 10 μg antibody in saline at 1 h before skin sensitization #1, 12 μg antibody at 1 h before skin sensitization #2, 15 μg antibody at 1 h before skin sensitization #3, and then 29 μg antibody at 1 h before skin sensitization #4 and #5 to adjust for increases in body weight during neonate growth. Antibody doses were similar to those previous described for intraperitoneal injection of mice (33, 54, 55).
Oral Antigen Challenge, Anaphylaxis, and Tissue Analysis
At 48 h after the last allergen skin sensitization, the pups were weighed and baseline rectal temperatures of the pups were taken using a BAT-12 Microprobe Thermometer with a RET-4 thermocouple sensor type T rectal probe for neonatal mice (Physitemp Instruments Inc). Then, the pups received PNE by gavage (100 μl of 10 mg protein/ml sterile water) using a 24 gauge gavage needle (Pet Surgical, Agoura Hills, CA). Rectal temperatures were taken every 15–20 min for up to 80 min. The pups were placed back with the mothers. Then 4 h later, the pups were euthanized and tissues collected.
RNA Isolation and Quantitative Real-Time PCR
For skin collection from euthanized mice, the skin was sprayed with RNase ERASE between the shoulders at the sites of allergen exposure, and then circular skin punches were taken between the shoulders using an 8 mm skin puncher (Catalog # 33-37, Integra Miltex Disposable Biospy Punch). The skin punches were placed in 2 mL collection tubes containing 100 μL of TriZOL (Life Technologies catalog # 15596018) and 50 μL of RNase ERASE before snap freezing in liquid nitrogen and stored in −80°C. Tissues were homogenized using Next Advance Bullet Blender Storm 24 Place Bead Homoginizer. Before homogenization, 500 μL TriZOL was added to Rino Bullet Blender Navy Bead Lysis Kit (Catalog # NAVYR5-RNA) and homogenized on level 12 for 4 min. 500 μL TriZOL was added again and beads were centrifuged at 4°C for 8 min at 1,200 rpm. Then, 200 μL chloroform (Catalog # BP1145, Fisher Scientific) was added to the lysates and tubes were placed on ice for 10 min. Skin tissue RNA was isolated using the Aurum Total RNA Fatty and Fibrous Tissue Kit (Catalog # 732-6830, Bio-Rad). The lysates were inverted periodically during 10 min on ice and then were centrifuged at 12,000 × g for 15 min at 4°C. The top aqueous layer was collected and added to an equal volume of 70% Ethanol (made using RNA-free water (Catalog # BP561, Fisher Scientific) for 10 min on ice. The rest of the RNA extraction procedure followed the spin protocol of the Aurum Total RNA Fatty and Fibrous Tissue Kit for small tissue for mass > 10 mg (Catalog # 732-6830, Bio-Rad) on ice. A DNA digest was done by incubating the samples with 10 units of Benzonase Nuclease Ultrapure (Catalog # E8263-5KU, Sigma Aldrich) before the second wash of the DNA digest. RNA concentration, A260/280 ratio, and A260/230 ratio of each RNA sample was measured using a Take3 plate and Synergy H1 Microplate Reader. cDNA was generated using the Applied Biosystems High-Capacity cDNA Archive Kit. The RT-qPCR analysis was performed with a 7500 Fast Real Time PCR System (Applied Biosystems). Multiplex reactions were ran using TaqMan multiplex real-time PCR. Reactions were set up using Applied Biosystems QSY Probes (Catalog #4482777) and TaqMan Multiplex Master Mix (Catalog #4461882). Custom oligos (Applied Biosystems) were used from sequences obtained from NCBI Blast. (IL33 probe sequence: ACCGTCGCCTGATTGACTTGCA, forward primer GTGCTACTACGCTACTATGAGTC, reverse primer TCATGTTCACCATCAGCTTCT. HPRT1 probe sequence: ATTGTGGCCCTCTGTGTGCTCAA, forward primer CGAGATGTCATGAAGGAGATGG, reverse primer AGCAGGTCAGCAAAGAACTTA). Areg, Osm, and GAPDH RT-qPCR reactions were set up with TaqMan PCR probes (ThermoFisher). (Osm probe sequence: CAGTGCCATGCTCAGGATGAGGA. Areg probe sequence: AGTATCGTTTCCAAAGGTGCACTGTGA. GAPDH probe sequence: TGCAAATGGCAGCCCTGGTG). Data were normalized to GAPDH or HPRT1, and fold-change in mRNA expression relative to GAPDH or HPRT1 control was calculated using the 2–ΔΔCt method.
Single Cell RNAseq
For single cell RNAseq, skin punches were minced and suspended in 5 mL DMEM solution containing 0.5 mg/mL Elastase (Catalog # V1891, Promega), 2.0 mg/mL Collagenase Type XI, and 10 μL/mL DNAse I 37°C with agitation. After 1.5 h, samples were filtered through sterile 70 micron nylon mesh strainer, rinsed with RPMI-1640 containing glutamine, centrifuged, and resuspended with HBSS solution containing 0.25% Trypsin and 0.01% EDTA. After an incubation in a 37°C water bath for 7 min, an equal volume of RPMI-1640 solution containing glutamine and 10% FBS was added to the samples. The cells were washed with 40 ml PBS once, resuspended with 200 Units of RNAsin (Catalog # PRN2115, Promega Corporation) and 40 Units of Superase (Catalog # AM2696, Fisher Scientific), and placed on ice. After 15 min, the samples were washed with DPBS twice. Cells were suspended to 1,000 cells/μL and then to enhance rigor, equal volumes from 7 to 8 samples were pooled per group for scRNAseq analysis. The scRNAseq was done at the Indiana University School of Medicine Genomic Core by using 10X Chromium (v3.0). NCBI: https://dataview.ncbi.nlm.nih.gov/object/PRJNA728696?reviewer=tc2t0dsh81dc1okiftcmq6pri7 and https://dataview.ncbi.nlm.nih.gov/object/PRJNA728697?reviewer=4arak8qdugui8cujekvuqhpnep.
The scRNAseq Analyses and Visualization
For scRNAseq analysis, Cell Ranger UMI matrix outputs (provided by the genomic core) were analyzed by Seurat (v4.0.3) (56). A standard pre-processing pipeline was performed prior to integration of WT and FT(+/−) transcriptomic data and subsequent generation of the unified UMAP was as described in Seurat vignettes. Curation of cluster-specific cell types on UMAPs were done first by running FindConservedMarkers to create a list of ranked and significant cluster-specific genes. Then, those cluster-specific genes were searched through web cell annotation resources including PanglaoDB (57) and Immgen (58) to identify the most fitted cell types of each clusters. This curation process was further refined by comparing and contrasting our gene list to those skin scRNAseq data from similar publications (59, 60). In addition to Suerat visualization, ggplot2 (v.3.3.2) (61) was used to generate UMAPs with overlays of OSM, Areg, and IL33.
PNE-Specific Antibody, MCPT-1, OSM, Areg, and IL33 ELISAs
Serum and plasma was collected at 4 h after oral gavage with PNE. Serum anti-peanut IgE, IgG1, and IgG2a were determined by ELISA. High binding 96 well EIA/RIA plate (Fisher Scientific, catalog #50-823-480) were coated with 50 μl of 10 μg PNE protein/ml in carbonate buffer overnight at 4°C. Plates were washed with PBS-0.05%Tween and blocked with PBS + 3% BSA for 2 h at room temperature. Plates were washed with PBS-Tween. Serum was plated in PBS + 1% BSA at a 1/10 dilution for IgE, 1/1,000 for IgG2b and 1/40,000 for IgG1 analysis and then incubated overnight at 4°C. Plates were washed with PBS-0.05%Tween and incubated for 1 h at room temperature with 100 μl of 2 μg/ml biotin-labeled secondary antibody in PBS-1% essentially immunoglobulin-free BSA. Plates were washed with PBS-Tween and incubated with 100 μl/well streptavidin-HRP (1:1,000 dilution in PBS, GE Healthcare, catalog #RPN1231-2ML). Plates were washed in TBS-Tween and incubated with 100 μl TMB substrate (eBioscience catalog#00-4201-56, 3,3′,5,5′-Tetramethylbenzidine; HRP substrate). At the indicated times in the figures, the reaction was stopped with 100 μl 2M phosphoric acid and plates read at 450 nm in a microtiter plate reader. MCPT-1 in plasma was measured by ELISA according to manufacturer's instructions (catalog #50-174-16, Fisher Scientific). Serum IL33, OSM and Areg were analyzed by ELISA according to manufacturer's instructions (IL33 Cat #DY3626-05 R&D Systems, OSM Cat #DY495-05 R&D Systems, Areg Cat#DY989 R&D Systems, MCPT1 Cat#88-7503 Invitrogen).
Genotyping for Flgft and Tmem79ma
Offspring of the mating of wild type C57BL/6 females with Flgft/ft/Tmem79ma/ma males were confirmed by genotyping. Briefly, for Flg PCR detection, murine genomic DNA was isolated from tail clips using the Quantabio Extracta DNA Prep kit (catalog #95091) and amplified with the primers: Forward: 5′-CATCTCCAGTCAGGGCTGACC-3′, Reverse: 5′-GCTGCCTGTGGCCGGACTCG-3′. PCR amplification conditions were as follows: (96°C, 5 min) x1; (96°C 30 s, 60°C 30 s, 72°C 30 s) x35; (72°C, 5 min) x1. Amplified transcripts were then digested with the restriction enzyme Acc I (New England Biolabs, catalog #R01611s) yielding either a wild type FLG band at 678 bp or two fragments of the mutant FLG at 559 and 134 bp as determined by gel electrophoresis.
Statistics
Data were analyzed by a one way ANOVA followed by Wilcoxon's non-parametric multiple comparisons test (SigmaStat, Jandel Scientific, San Ramon, CA). Presented are the means ± the standard errors. The statistical analysis for the change in temperature was done using the area of the curve by summation of the temperature changes at 15, 30, 45, 60, and 80 min for each pup. The data in the figures include both sexes of the offspring because there were no differences in food allergy outcomes by sex as previously described (19).
Results
Alt Increases Expression of Il33, Areg, and Osm in Skin of FT+/– Neonatal Mice
We previously demonstrated that co-exposure to detergent, Alt, and PNE induce peanut allergy in FT+/− neonatal mice, but not in WT neonatal mice (19). Because the function of Alt in induction of food allergy is not known, we addressed whether Alt induced expression of OSM, Areg, and IL33, which have roles in atopic dermatitis (19, 32, 33, 35, 36) and allergies in the lung (44). We performed quantitative real-time PCR (RT-qPCR) analysis for Osm, Areg, and Il33 in the skin of neonatal mice at 4 h after the last skin sensitization on postnatal day 16 (Figure 1A). Osm and Il33 gene expression was significantly increased in the Alt and Alt/PNE sensitized FT+/− neonates as compared to the saline-treated FT+/− neonates (Figures 1B,D), but not in the PNE only sensitized skin. In contrast, gene expression of Areg was induced in all three treatment groups (Alt, PNE, and Alt/PNE) (Figure 1C) as compared to saline-treated FT+/− neonates. There was no increase in expression of these genes following skin sensitization of WT neonates (Figures 1B–D).
Figure 1
Allergen skin sensitization of FT+/− neonates induced skin expression of Il33, Areg, and Osm. (A) Timeline for mating and for FT+/− pup treatments with saline, Alt, PNE, and Alt/PNE allergens. Tissues were collected 4 h after the last pup skin sensitization. Relative expression of skin expression of (B) Osm, (C) Areg, and (D) Il33 as determined by RT-qPCR. N = 8–10/group. The data in all figures include both genders for pups because there were no differences in outcomes by gender as we previously reported for Alt/PNE skin sensitization (19). *p < 0.05 as compared to the saline skin-sensitized groups or WT groups. Alt, Alternaria alternata extract; Areg, amphiregulin; FT−/−, flaky tail mice homozygous for filaggrin and mattrin mutations; FT+/−, flaky tail mice heterozygous for filaggrin and for mattrin mutations; Il33, interleukin-33; Osm, oncostatin M; PND, postnatal day; PNE, peanut extract; WT, wild type.
Allergen skin sensitization of FT+/− neonates induced skin expression of Il33, Areg, and Osm. (A) Timeline for mating and for FT+/− pup treatments with saline, Alt, PNE, and Alt/PNE allergens. Tissues were collected 4 h after the last pup skin sensitization. Relative expression of skin expression of (B) Osm, (C) Areg, and (D) Il33 as determined by RT-qPCR. N = 8–10/group. The data in all figures include both genders for pups because there were no differences in outcomes by gender as we previously reported for Alt/PNE skin sensitization (19). *p < 0.05 as compared to the saline skin-sensitized groups or WT groups. Alt, Alternaria alternata extract; Areg, amphiregulin; FT−/−, flaky tail mice homozygous for filaggrin and mattrin mutations; FT+/−, flaky tail mice heterozygous for filaggrin and for mattrin mutations; Il33, interleukin-33; Osm, oncostatin M; PND, postnatal day; PNE, peanut extract; WT, wild type.To determine which cells expressed Il33, Osm, and Areg in the Alt/PNE-exposed skin of FT+/− neonates and WT neonates, single cell RNAseq and UMAP analyses was performed (Figure 2) using skin biopsies from neonates at 4 h after the last skin sensitization (Figure 1A). Although eosinophils are present in the skin in this model as determined by histology (19), eosinophils were not detected in single cell RNAseq analyses of the skin, as has been a difficulty in the field for single cell RNAseq analyses of tissue eosinophils. The cell types in the UMAP clusters (Figure 2A) were assigned by gene expression profiles (Supplementary Table 1). Of note, cluster 6 keratinocytes had a larger number of cells in the Alt/PNE exposed FT+/− as compared to Alt/PNE exposed WT neonates (Figure 2A, red circle). The cluster 6 keratinocytes of the FT+/− neonates also expressed Osm, Areg, and Il33 (Figures 2B,C), indicating a source of these proteins not present in the WT neonates. The cell types expressing OSM that were common to Alt/PNE-treated FT+/− and WT skin were macrophages (clusters 1,2), neutrophils (clusters 4,12), mast cells (cluster 20), basophils (cluster 22), and dendritic cells (cluster 5) (Figures 2B,C). The cell types expressing Areg that were common to FT+/− and WT with Alt/PNE were T cells (cluster 9) and macrophages (cluster 1) (Figures 2B,C). The cell types expressing Il33 that were common to FT+/− and WT with Alt/PNE were fibroblasts (cluster 14) (Figures 2B,C). Thus, several cell types expressed Osm, Areg, and Il33 but a distinction for the Alt/PNE-treated FT+/− neonates was expression of these cytokines by keratinocytes in cluster 6.
Figure 2
UMAP visualization of skin scRNAseq analysis. (A) UMAPs of scRNAseq from skin punches of FT+/− and WT neonates treated with Alt or Alt/PNE with cluster-specific cell type annotation. (B) UMAP projection of skin cells expressing Osm (green), Areg (blue), and Il33 (red) above the threshold expression value (Seurat logNormalized) >1.5. Annotated cell type designation to numbered clusters in (A) is listed as follows; Dendritic, dendritic cells; Endo, endothelial cells; Fib, fibroblasts; ILC, innate lymphoid cells; KC, keratinocytes; Mac, macrophages; PMN, neutrophils; SM, smooth muscle cells; Stem, stem cells. (C) Cell clusters with abundant gene expression of Osm, Areg, and Il33.
UMAP visualization of skin scRNAseq analysis. (A) UMAPs of scRNAseq from skin punches of FT+/− and WT neonates treated with Alt or Alt/PNE with cluster-specific cell type annotation. (B) UMAP projection of skin cells expressing Osm (green), Areg (blue), and Il33 (red) above the threshold expression value (Seurat logNormalized) >1.5. Annotated cell type designation to numbered clusters in (A) is listed as follows; Dendritic, dendritic cells; Endo, endothelial cells; Fib, fibroblasts; ILC, innate lymphoid cells; KC, keratinocytes; Mac, macrophages; PMN, neutrophils; SM, smooth muscle cells; Stem, stem cells. (C) Cell clusters with abundant gene expression of Osm, Areg, and Il33.
Areg and OSM Are Required but Not Sufficient for the Induction of Peanut Allergy in FT+/– Neonatal Mice
In Figure 1, we showed that Il33, Areg, and Osm gene expression was induced following Alt/PNE skin sensitization of FT+/− neonates. Previously we reported that blocking the IL-33 receptor ST2 with anti-ST2 antibodies blocks generation of PNE-specific IgE and PNE-induced anaphylaxis (19). To address a role for IgE in this food allergy model, oral PNE-induced anaphylaxis was blocked in Alt/PNE skin sensitized FceR1a–/–FT+/− pups (Figures 3A,B) that had serum PNE-specific IgE (Figure 3C). Then, we determined whether Areg and OSM are required for the induction of peanut allergy. To test this, neutralizing anti-Areg or anti-OSM antibodies were administered at previously described doses (33, 54, 55) by intraperitoneal injection at 1 hr before each skin sensitization with Alt/PNE as in Figure 3D. Oral PNE challenge induced anaphylaxis in Alt/PNE sensitized pups (Figures 3B,E). As expected (19), neonates had a reduced ability to control temperature over the time course as compared to adults (62–65), but temperatures begin to rebound after 105 min and then pups are placed back with their mothers (19). Administration of neutralizing anti-Areg or anti-OSM during Alt/PNE sensitization of FT+/− neonates blocked oral PNE-induced anaphylaxis (Figure 3E). Together, our previous observations with anti-ST2 blockade (19) and our current findings with anti-Areg or anti-OSM suggest that ST2, OSM, and Areg are required for the induction of food allergy.
Figure 3
Areg and OSM during co-exposure to PNE was necessary but not sufficient for FcεR1-dependent oral PNE-induced anaphylaxis in FT+/− neonatal mice. (A) FT−/− FceR1a−/− males were mated with FceR1a−/− females. The pups (FT+/−FceR1a−/−) were skin sensitized four times as in the Timeline. (B) Oral PNE-induced temperature changes on day 15 for mice treated as in (A). (C) Serum anti-peanut specific IgE for pups from (B). (D) Timeline for mating of females with FT−/− males and for pup treatments with PNE, Alt, intradermal recombinant proteins and intraperitoneal injections of blocking antibodies. (E) Oral PNE-induced temperature changes on day 18. N = 8–10/group. *p < 0.05 as compared to the PNE only skin-sensitized groups. Alt, Alternaria alternata extract; Areg, amphiregulin; FT−/−, flaky tail mice homozygous for filaggrin and mattrin mutations; FT+/−, flaky tail mice heterozygous for filaggrin and for mattrin mutations; IL33, interleukin 33; OSM, oncostatin M; PND, postnatal day; PNE, peanut extract.
Areg and OSM during co-exposure to PNE was necessary but not sufficient for FcεR1-dependent oral PNE-induced anaphylaxis in FT+/− neonatal mice. (A) FT−/− FceR1a−/− males were mated with FceR1a−/− females. The pups (FT+/−FceR1a−/−) were skin sensitized four times as in the Timeline. (B) Oral PNE-induced temperature changes on day 15 for mice treated as in (A). (C) Serum anti-peanut specific IgE for pups from (B). (D) Timeline for mating of females with FT−/− males and for pup treatments with PNE, Alt, intradermal recombinant proteins and intraperitoneal injections of blocking antibodies. (E) Oral PNE-induced temperature changes on day 18. N = 8–10/group. *p < 0.05 as compared to the PNE only skin-sensitized groups. Alt, Alternaria alternata extract; Areg, amphiregulin; FT−/−, flaky tail mice homozygous for filaggrin and mattrin mutations; FT+/−, flaky tail mice heterozygous for filaggrin and for mattrin mutations; IL33, interleukin 33; OSM, oncostatin M; PND, postnatal day; PNE, peanut extract.It was also determined whether intradermal recombinant (r) OSM, rAreg, or rIL-33 during skin co-exposure with PNE was sufficient to bypass the need for Alt for induction of food allergy as measured by oral PNE-induced anaphylaxis. rOSM, rAreg, or rIL33 was administered at a concentration of 2.5 μg/neonate by intradermal injection (52–54) and immediately followed by topical application of detergent and PNE as in the timeline in Figure 3D. Skin sensitization with rIL-33/PNE was sufficient to induce anaphylaxis following oral challenge with PNE (Figure 3E). In contrast, rOSM/PNE and rAreg/PNE were not sufficient to induce anaphylaxis following oral challenge with PNE (Figure 3E), suggesting that OSM and Areg are necessary but not sufficient to induce anaphylaxis following oral challenge with PNE.
IL33, OSM, and Areg Regulate Induction of Anti-PNE IgE and Mast Cell Degranulation
Next we addressed whether these cytokines regulate IgE and mast cell degranulation in this model because anaphylaxis was dependent on FceR1 (Figure 3B), FceR1 is expressed by mast cells, and we have reported that mast cells degranulate in skin and intestine of Alt/PNE-sensitized FT+/− pups (19). At 4 h post oral gavage as in the timeline in Figure 3D, Alt/PNE, but not Alt or PNE alone, induced anti-PNE-specific IgE, IgG2b, and IgG1 (Figures 4A–C). The increase in Alt/PNE-induced anti-PNE-specific IgE was inhibited by anti-OSM neutralizing antibody, whereas there was no effect of the anti-Areg neutralizing antibody or the isotype control antibody (Figures 4A,B). However, the Alt/PNE-induced anti-PNE-specific IgG1 was not altered by anti-OSM, anti-Areg, or isotype antibodies (Figure 4C). Interestingly, rOSM/PNE, rAreg/PNE, or rIL33/PNE was sufficient to induce anti-PNE-specific IgE and IgG2b (Figures 4A,B). Anti-PNE-specific IgG1 was induced by rOSM/PNE or rAreg/PNE but not by rIL33/PNE (Figure 4C). Thus, our current findings together with our previous observations that anti-ST2 neutralizing antibodies block generation of anti-PNE-specific IgE (19) suggest that OSM and the IL33 receptor ST2 were required for the production of anti-PNE-specific IgE.
Figure 4
IL33, OSM, and Areg regulate induction of serum anti-PNE IgE, anti-PNE IgG2b, anti-PNE IgG1, and MCPT1. Serum was from pups treated as in Figure 3E. At 4 h after oral PNE-gavage, serum anti-peanut specific (A) IgE, (B) IgG2b, and (C) IgG1 were measured by ELISA. (D) Serum MCPT-1 at 4 h after oral gavage with PNE was measured by ELISA. (E) Serum MCPT-1 at 4 h after the last skin sensitization from pups treated as in Figure 3D was measured by ELISA. N = 8–10/group. *p < 0.05 as compared to the PNE only skin-treated group. Alt, Alternaria alternata extract; Areg, amphiregulin; IL33, interleukin 33; OSM, oncostatin M; PNE, peanut extract.
IL33, OSM, and Areg regulate induction of serum anti-PNE IgE, anti-PNE IgG2b, anti-PNE IgG1, and MCPT1. Serum was from pups treated as in Figure 3E. At 4 h after oral PNE-gavage, serum anti-peanut specific (A) IgE, (B) IgG2b, and (C) IgG1 were measured by ELISA. (D) Serum MCPT-1 at 4 h after oral gavage with PNE was measured by ELISA. (E) Serum MCPT-1 at 4 h after the last skin sensitization from pups treated as in Figure 3D was measured by ELISA. N = 8–10/group. *p < 0.05 as compared to the PNE only skin-treated group. Alt, Alternaria alternata extract; Areg, amphiregulin; IL33, interleukin 33; OSM, oncostatin M; PNE, peanut extract.As a measure of mast cell degranulation in these studies, the mast cell granule protein MCPT1 was determined in the serum at two time points, 4 h after skin sensitization and 4 h after oral PNE. At 4 h after oral PNE (Figure 4D), Alt/PNE-skin-sensitized and Alt-skin-sensitized FT+/− pups had increased serum MCPT1 as compared to PNE-skin-sensitized FT+/− pups. This increase in MCPT1 in the Alt-skin-sensitized FT+/− pups occurred even though the Alt-skin sensitized pups did not have elevated anti-PNE specific antibodies (Figures 4A–C) and did not have oral PNE-induced anaphylaxis (Figure 3E). This suggests that Alt induces mast cell degranulation without IgE and that MCPT1 release was not sufficient for anaphylaxis in Alt-sensitized pups. Furthermore, at 4 h after the last skin sensitization (without oral gavage with PNE), there was also increased serum MCPT1 (Figure 4E). The absolute amounts of MCPT1 after skin sensitization are not directly compared with MCPT1 amounts after oral PNE because different kits were used and they were from different experiments. Nevertheless, these levels of MCPT1 in Figures 4D,E were at levels that we previously described in neonatal FT+/− mice (19) and consistent with our report that Alt/PNE stimulated skin and intestine mast cell degranulation in FT+/− pups (19, 66). The increase in MCPT1 was not blocked by administration of anti-OSM or anti-Areg blocking antibodies during skin sensitization with Alt/PNE (Figures 4D,E). However, interestingly, there was an increase in serum MCPT1 in pups that were skin-sensitized with rOSM/PNE, rAreg/PNE, or rIL33/PNE (Figures 4D,E). Together these data indicate that skin co-sensitization with PNE and any of these cytokines was sufficient to increase MCPT1 after allergen exposure.
Pathways for Alt/PNE Induction of Skin IL33, OSM, and Areg Gene Expression
Oral PNE-stimulated anaphylaxis was induced in pups skin-sensitized with Alt/PNE but not PNE alone, Alt alone (Figure 3E) or saline (19). To determine pathways by which Alt induces expression of Il33, Osm, and Areg, RT-qPCR was performed to analyze expression of these genes in the skin of neonatal mice treated as in Figure 3D. In Figure 5A, expression of Osm was induced by Alt and Alt/PNE. The induction of Osm expression by Alt/PNE was not blocked by anti-OSM or anti-Areg and not induced by rOSM/PNE, rAreg/PNE, or rIL33/PNE. In Figure 5B, expression of Areg was induced by Alt, PNE, Alt/PNE, or rOSM/PNE, but not rIL33/PNE or rAreg/PNE. Taken together the data suggest that OSM induces Areg in these FT+/− neonates. The induction of Areg expression by Alt/PNE was blocked by anti-OSM but not by the isotype control (Figure 5B), further supporting that OSM induces Areg. The inhibition of Areg gene expression by anti-Areg co-administration with Alt/PNE suggests that Areg is regulated in an autocrine manner, consistent with other descriptions of Areg autocrine loops (39).
Figure 5
Skin Il33, Osm, and Areg gene expression in skin-sensitized FT+/− pups. Pups were treated as in Figure 3D, but with the addition of a group receiving saline on the skin. Skin was collected at 4 h after the oral PNE gavage and analyzed by RT-qPCR for expression of (A) Osm, (B) Areg, and (C) Il33. N = 6–10/group. *p < 0.05 as compared to the saline skin-treated group. Also, for skin OSM RNA (A), the Alt/PNE/anti-Areg Ab group is not significantly different than the Alt/PNE group (p = 0.69) or the Alt/PNE/isotype Ab group (p = 0.39). Alt, Alternaria alternata extract; Areg, amphiregulin; IL33, interleukin 33; OSM, oncostatin M; PNE, peanut extract.
Skin Il33, Osm, and Areg gene expression in skin-sensitized FT+/− pups. Pups were treated as in Figure 3D, but with the addition of a group receiving saline on the skin. Skin was collected at 4 h after the oral PNE gavage and analyzed by RT-qPCR for expression of (A) Osm, (B) Areg, and (C) Il33. N = 6–10/group. *p < 0.05 as compared to the saline skin-treated group. Also, for skin OSM RNA (A), the Alt/PNE/anti-Areg Ab group is not significantly different than the Alt/PNE group (p = 0.69) or the Alt/PNE/isotype Ab group (p = 0.39). Alt, Alternaria alternata extract; Areg, amphiregulin; IL33, interleukin 33; OSM, oncostatin M; PNE, peanut extract.In Figure 5C, Il33 expression was induced by Alt and Alt/PNE. This Alt/PNE-induced Il33 expression was not blocked by anti-OSM or anti-Areg (Figure 5C). Also IL33 expression was not induced by rOSM/PNE or rAreg/PNE (Figure 5C), indicating that Alt induced a pathway with Il33 and another pathway with OSM and Areg. Furthermore, putting the data together with data from Figures 3E, 5, it suggests that the rIL33/PNE was sufficient to sensitize for oral PNE-induced anaphylaxis through a combined pathway of IL33 and PNE-stimulated Areg. Also, although rOSM/PNE and rAreg/PNE induced production of anti-PNE-specific IgE (Figure 4A), these skin sensitizations were not sufficient for oral PNE-induced anaphylaxis (Figure 3E), suggesting that IL33-mediated signals were required to induce a state for responsiveness to oral PNE-induced anaphylaxis.
OSM, Areg, and IL33 Are Elevated in Plasma During Alt/PNE Induced Food Allergy
To investigate whether there were systemic plasma levels of OSM, Areg, and IL-33 in the pups from Figures 3D,E, plasma levels of OSM, Areg, and IL-33 in FT+/− pups were determined by ELISAs. Group comparisons were made to pups exposed to PNE or pups exposed to Alt/PNE/anti-Areg since they did not have anaphylaxis. Plasma OSM was elevated for neonates that were skin sensitized with Alt or Alt/PNE as compared to PNE sensitization (Figure 6A). This increase in plasma OSM for Alt/PNE-skin-sensitized neonates was not altered by anti-OSM, anti-Areg, or isotype antibodies (Figure 6A). Plasma OSM was not increased in neonates with rAreg/PNE or rIL33/PNE (Figure 6A). Interestingly, intradermal rOSM injections during skin sensitization with PNE increased plasma OSM even at 2 days after the injections, albeit not to the levels induced by Alt/PNE skin sensitizations (Figure 6A). Plasma Areg was reduced in neonates administered anti-OSM or anti-Areg but not isotype antibody during Alt/PNE-skin-sensitization (Figure 6B). The inhibition by anti-Areg is consistent with autocrine amplifying functions reported for Areg (39). Skin sensitization with rOSM/PNE, rAreg/PNE and rIL33/PNE increased plasma Areg protein concentrations, similar to concentrations induced by PNE alone (Figure 6B). This is consistent with PNE induction of skin Areg expression shown in Figure 5B. Plasma IL33 was elevated in neonate skin sensitized with Alt or Alt/PNE as compared to PNE alone (Figure 6C). Plasma IL33 was slightly increased in rOSM/PNE-sensitized pups, but anti-OSM antibodies did not significantly reduce Alt/PNE-induced IL33 expression (Figure 6C). The increase in plasma IL33 in neonates sensitized with Alt/PNE was blocked by anti-Areg antibodies. However, rAreg/PNE did not increase plasma IL33.
Figure 6
OSM, Areg and IL33 are elevated in plasma during Alt/PNE induced food allergy. Plasma was collected at 4 h after oral PNE gavage (treated as in Figure 3D). Plasma (A) OSM, (B) Areg, and (C) IL33 were measured by ELISA. N = 8–10/group. (A,C) *p < 0.05 as compared to the PNE only skin-treated group. (B) *p < 0.05 as compared to the anti-OSM/Alt/PNE treated group. Alt, Alternaria alternata extract; Areg, amphiregulin; IL33, interleukin 33; OSM, oncostatin M; PNE, peanut extract.
OSM, Areg and IL33 are elevated in plasma during Alt/PNE induced food allergy. Plasma was collected at 4 h after oral PNE gavage (treated as in Figure 3D). Plasma (A) OSM, (B) Areg, and (C) IL33 were measured by ELISA. N = 8–10/group. (A,C) *p < 0.05 as compared to the PNE only skin-treated group. (B) *p < 0.05 as compared to the anti-OSM/Alt/PNE treated group. Alt, Alternaria alternata extract; Areg, amphiregulin; IL33, interleukin 33; OSM, oncostatin M; PNE, peanut extract.
Discussion
We demonstrated that oral PNE-induced anaphylaxis in Alt/PNE-skin-sensitized FT+/− pups was dependent on FcεR1. Alt stimulated an increase in expression of Il33, Osm, and Areg in the skin of FT+/− but not WT neonates. This Alt-induced expression of Il33, Osm, and Areg functioned in concert with food allergen on the skin of FT+/− neonatal mice to sensitize neonates to food allergen, such that oral food allergen-challenge induced anaphylaxis. A model for Alt-stimulated pathways during the induction of food allergy is depicted in Figure 7. Briefly for FT+/− neonates, topical PNE alone on the skin induced expression of Areg but not Il33 or Osm. However, Alt induced skin expression of Osm, Areg, and Il33. The single cell RNAseq analyses of the skin indicated that Osm, Areg, and Il33 were expressed by several cell types. Of note, there were more cells in keratinocyte cluster 6 that expressed OSM, Il33, and Areg in FT+/− neonates than WT neonates at the site of Alt/PNE-epicutaneous exposure. Further ongoing studies will address cluster 6 keratinocyte generation and function. In antibody blocking studies, anti-OSM inhibited Alt/PNE-induced skin expression of Areg but anti-Areg did not inhibit Alt/PNE induced Osm expression. Anti-Areg and anti-OSM antibodies did not inhibit Alt/PNE-induced expression of Il33, indicating that Alt induces both an IL33-dependent pathway and an OSM/Areg-dependent pathway. Anti-Areg antibodies reduced Areg expression suggesting an autocrine Areg pathway, consistent with reports in other inflammatory processes that OSM can induce an Areg autocrine function. For example, OSM induces an Areg autocrine loop during osteoclast differentiation (39). The OSM/Areg pathway and the IL33/ST2 pathways are both important for oral PNE-induced anaphylaxis in Alt/PNE-sensitized neonates because anaphylaxis is blocked by anti-ST2 (the IL33 receptor) (19), anti-Areg, or anti-OSM antibodies. rIL33/PNE was sufficient for sensitization and oral PNE-induced anaphylaxis, since rIL33 bypassed the need for Alt induction of IL33 and the skin exposure to PNE induced Areg expression. This suggested that the co-activation of an IL33 pathway and Areg pathway was sufficient to induce food allergy in the presence of food allergens. The lack of anaphylaxis in the rOSM/PNE or rAreg/PNE sensitized neonates suggests that an OSM/Areg pathway was not sufficient. However, an OSM/Areg pathway was required for anaphylaxis since administration of anti-OSM or anti-Areg antibodies during sensitization with Alt/PNE blocked oral PNE-induced anaphylaxis. With regards to anti-PNE-specific IgE, it was induced in FT+/− neonate skin exposed to rOSM/PNE, rAreg/PNE, or rIL33/PNE. The Alt/PNE-induced generation of anti-PNE specific IgE was blocked by anti-OSM but not anti-Areg antibodies and, in our previous report, generation of anti-PNE specific IgE was blocked by anti-ST2 (19). This suggests that OSM, IL33, and PNE are needed for generation of anti-PNE-specific IgE. OSM overexpression has been reported to have a role in activation of B cells, at least in lung inflammation, but antibody production was not examined (45). Since anti-OSM blocking antibodies inhibited generation of anti-PNE IgE but not anti-PNE IgG2b or IgG1, it suggests that OSM may have a unique role in IgE production after allergen skin sensitization of FT+/− pups.
Figure 7
Model for skin cytokine network in Alt/PNE induction of food allergy. Illustrated is a working model for a network of expression of IL33, OSM and Areg during Alt/PNE treated FT+/− skin. Alt induced two pathways, an IL33 pathway and an OSM/Areg pathway in the FT+/− skin. These pathways mediate induction of anti-PNE IgE when FT+/− skin is sensitized by co-exposure of Alt with PNE antigens. The data in Figure 5B also indicated an autocrine function for Areg in the FT+/− skin. Furthermore, PNE alone on the skin induced expression of Areg. When FT+/− skin is sensitized with rIL33/PNE, the IL33 pathway, the PNE-induced Areg pathway and the PNE antigens are sufficient for sensitization and oral-PNE-induced anaphylaxis.
Model for skin cytokine network in Alt/PNE induction of food allergy. Illustrated is a working model for a network of expression of IL33, OSM and Areg during Alt/PNE treated FT+/− skin. Alt induced two pathways, an IL33 pathway and an OSM/Areg pathway in the FT+/− skin. These pathways mediate induction of anti-PNE IgE when FT+/− skin is sensitized by co-exposure of Alt with PNE antigens. The data in Figure 5B also indicated an autocrine function for Areg in the FT+/− skin. Furthermore, PNE alone on the skin induced expression of Areg. When FT+/− skin is sensitized with rIL33/PNE, the IL33 pathway, the PNE-induced Areg pathway and the PNE antigens are sufficient for sensitization and oral-PNE-induced anaphylaxis.Allergen-specific IgE does not always predict whether allergen will induce anaphylaxis. In humans, it is reported that food-specific IgE in sensitized patients does not always associate with anaphylaxis upon oral food challenge (67). Similarly, in the FT+/− pups, with different skin stimuli, anti-PNE IgE did not always associate with oral PNE-induced anaphylaxis. Briefly, oral PNE induced analphylaxis in Alt/PNE-sensitized pups and this was dependent on FcεR1 which binds IgE. Also, oral PNE induced analphylaxis in the pups skin sensitized with rIL33/PNE. In contrast, anaphylaxis was not induced by oral PNE in pups skin sensitized with rAreg/PNE or rOSM/PNE, even though these pups had serum anti-PNE-specific IgE and increased serum MCPT1 after oral PNE gavage. Therefore, although IgE binds to the FcεR1 on mast cells and basophils (68), the anti-PNE-specific IgE was not sufficient for induction of anaphylaxis in the absence of Alt stimulation of mediators such as Il33. IL33 can effect several cell types, including reports that it stimulates mast cell expansion (69).In the rAreg/PNE or rOSM/PNE sensitized FT+/− pups which had increased anti-PNE specific IgG1, the IgG1 may have limited the oral PN-induced anaphylaxis because IgG1 binds to FcγRIIb which functions to limit the acute effector functions of mast cells and basophils (68). Furthermore, in the rIL33/PNE skin sensitized FT+/− neonates, there was not an increase in anti-PNE specific IgG1 and these pups had the greatest drop in temperature upon oral gavage. This suggests that in the absence of induction of anti-PNE-specific IgG1 in the rIL33/PNE sensitized neonates, there may be increased acute IgE-mediated signals for anaphylaxis.Mast cell degranulation is induced by antigen crosslinking of IgE on FcεR1, resulting in release of granule contents and increases in serum MCPT1 (70, 71). Besides FceR1/IgE, multiple other stimuli activate mast cells and can induce differential release granule and non-granule mediators from mast cells (72–75). Furthermore, basophil mediators may also be involved in anaphylaxis as the FcεR1 receptor is also expressed on basophils (68).We have previously reported that oral PNE induces an increase in serum MCPT1 in Alt/PNE sensitized FT+/− pups and that this is blocked by anti-ST2 (19), suggesting that IL33 is necessary. Our previous publication also demonstrated by histology that in FT+/− neonates, mast cell degranulation occurs both in the skin at 4 hrs after Alt/PNE skin sensitization and 2 days later at 4 hrs after oral gavage with PNE in the intestine of the Alt/PNE-sensitized pups (19). This suggests that MCPT1 is released from mast cells both after skin sensitization and again after oral PNE challenge. The measurement of MCPT1 at 4 h is similar to the time frame for maximal serum MCPT1 in a study with intraperitoneal MCPT1 injections (76). Their study also showed that serum MPCT1 was cleared at about 24 h but that was from a single injection (76). A limitation of our current study is that it is not known whether systemic MCPT1 levels released after skin sensitization were sustained for 48 hrs and contributing to the systemic levels measured after oral PNE challenge. This is being addressed in ongoing studies of systemic mediators. Nevertheless, we now demonstrate that serum MCPT1 was also increased in FT+/− neonates sensitized with rOSM/PNE, rAreg/PNE, rIL33/PNE, or Alt as compared to PNE alone when examined 4 h after the last skin sensitization and at 4 hrs after oral PNE. Although both an IL33 pathway and an OSM/Areg pathway were sufficient for increased serum MCPT1 in this model, neutralizing antibodies for each of these cytokines did not block the increase in serum MCPT1. Together these data suggest that there is redundancy in activation of MCPT1 release by the IL33 and the OSM/Areg pathways. It is has been reported that inhibition of Alt protease activity blocks Alt-induced increases in MCPT1 levels in the lung (77). In the food allergy model with FT+/− mice, we previously reported that PNE sensitization occurs with skin co-exposure to Alt/PNE or HDM/PNE, and the Alt extract did not contain protease activity, at least not toward PNE proteins (19, 66). Further studies to define how Alt activates OSM, Areg, IL33, and mast cell degranulation in FT+/− neonate skin are under investigation in our lab and beyond the scope of this report. Nevertheless, our data indicated that skin sensitizations with these recombinant cytokines and PNE were sufficient for mast cell MCPT1 release in FT+/− neonates but not WT neonates.We also demonstrated that Alt skin sensitized FT+/− pups had an increase in plasma levels of Areg, OSM, and IL33 protein, whereas FT+/− pups that were skin sensitized with PNE did not have elevated plasma OSM or IL33. Thus, these mediators have systemic effects that may regulate activation of responses in distant sites. Intradermal administration of rAreg, rOSM, or rIL33 with topical PNE increased plasma Areg, OSM, and IL33, respectively. A systemic effect of mediators from the skin would be consistent with skin-derived factors blocking oral allergen induction of tolerance. For example, we reported that in FT+/− pups, oral PNE pre-exposure before skin sensitization induces tolerance to oral PNE (19). However, this tolerance to PNE was blocked when skin was simultaneously exposed to Alt (19), suggesting that Alt-induced signals from the skin are systemic in that they limit induction of tolerance to oral peanut in the gut. This may have implications for children because there are clinical trials aimed to induce tolerance using oral peanut, but the skin of these children are also exposed to dust that contains Alt. Systemic effects of OSM, Areg, and IL33 are currently under investigation in our lab.It has not been previously reported that Osm and Areg are present in the skin during induction of food allergy. However, Osm gene expression has been described in the lung in allergic diseases and in the skin with atopic dermatitis (54, 78). It is reported that in humans, there is an association of increased Osm gene expression in blood cells with anaphylaxis to any allergen (79). However, the function or mechanism for induction of Osm gene expression was not described. It has been reported that OSM mRNA and protein are increased in nasal passages and lung of patients with chronic rhinosinusitis and that OSM treatment of epithelial cells at air-liquid interface reduces barrier function (44), but the mechanisms for induction of Osm are not known. OSM induces Il33 expression in mouse liver endothelial cells (80) and overexpression of OSM induces mouse lung Il33 expression (81). However, in skin of FT+/− neonates, rOSM/PNE did not induce Il33 gene expression and neutralizing anti-OSM antibodies did not reduce Alt/PNE-induced Il33 gene expression. This suggests that there may be differences in pathways for induction of Il33 expression by different tissues or stimuli (78). Reports indicate that keratinocytes produce IL33 during psoriasis (82) and in the Alt/PNE-stimulated skin of FT+/− neonates, IL33 was primarily expressed by keratinocytes and fibroblasts.Areg has been studied in psoriatic skin (34). It is also reported that skin keratins induce expression of Areg that induce thymic stromal lymphopoietin (TSLP)-mediated activation of itch (33). In osteoclasts in the bone, there is an Areg autocrine loop induced by OSM during osteoclast differentiation (39). Similarly, our data suggests that Alt stimulates an Areg autocrine loop during Alt/PNE stimulation of FT+/− skin. The mechanism for Alt stimulation of keratinocytes in the skin of FT+/− neonates may be through TLR2/4 since Alt binds and activates TLR2/4 (83) and these receptors are expressed by keratinocytes, fibroblasts and leukocytes (84, 85). Alt, which can have protease activity, does not alter the molecular weight of the major peanut proteins (Ara h 1, Ara h 3 acidic subunits, Ara h 3 basic subunit, Ara h 2, and Ara h 6) (19), albeit this does not preclude potential Alt protease effects on proteins in the skin.Interestingly, in addition to a role for IL33 in initiation of food allergy (19), IL33 plays a role in re-challenge with a food allergen. This was demonstrated a study where anti-IL33 improved desensitization in peanut-allergic participants (86). As a further link between IL33 in food allergy and atopic dermatitis, patients with atopic dermatitis have a 10-fold increase in IL33 as compared to healthy controls (87). In our studies, the FT+/− neonatal mice (without allergen stimulation) did not have elevated skin expression of IL33 at baseline as compared to WT pups. Moreover, the FT+/− pups did not develop atopic dermatitis until a few months old (20). Moreover, in the FT+/− pups, Alt but not PNE stimulated an increase in IL33 and this occurred well before FT+/− pups spontaneously develop atopic dermatitis. Thus, because FT+/− pups can develop atopic dermatitis at a few months old without food allergy and because food allergy can develop before atopic dermatitis, it suggests that with these skin barrier mutations in FT+/− mice, food allergy or atopic dermatitis can develop independently.In conclusion (Figure 7), PNE on the skin of FT+/− neonates induced Areg, but did not induce Osm, Il33, anti-PNE-specific IgE, or oral PNE-induced anaphylaxis. In contrast, Alt induced two pathways, an IL33 pathway and an OSM/Areg pathway. Although Il33, Osm, and Areg expression occurred in several cell types in Alt/PNE-stimulated FT+/− neonate skin, there was a keratinocyte cluster, expressing Osm, Il33, and Areg, that was not present in Alt/PNE-stimulated skin of WT neonates (Figure 2). Since the effect of Alt only occurred in skin of FT+/− but not WT neonates, it suggests that keratinocyte function is altered in the FT+/− neonates. Functionally, the Alt-induced Osm and Il33 participated in generation of anti-PNE-specific IgE and IgG2b in FT+/− neonates. An IL33 pathway and an OSM/Areg pathway mediated activation of mast cells as demonstrated by elevated serum MCPT1 in FT+/− neonates. Also OSM was required for the Alt-induction of Areg in FT+/− neonates. The data also indicate that there is an Areg autocrine loop. Areg may function in induction of keratinocyte proliferation since Areg is reported to induce keratinocyte proliferation (55) (Figure 7). In addition to local effects in the skin, FT+/− skin exposure to Alt generated systemic levels of Areg, OSM, and IL33 as these were increased in the plasma. Importantly, OSM, Areg, and IL33 functioned in Alt/PNE sensitization of FT+/− neonates for generation of sensitivity to oral PNE-induced anaphylaxis. Interestingly, the Alt induction of IL33, Areg and OSM occurred in neonates well before the development of atopic dermatitis in the FT+/− mice. These data have important implications for studies of detection of risks for sensitization to food allergens.
Data Availability Statement
The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA BioProject, accession numbers: PRJNA728696 and PRJNA728697 (private).
Ethics Statement
The animal study was reviewed and approved by Indiana University School of Medicine Institutional Review Committee for animals.
Author Contributions
LB participated in performing and interpreting experiments, data and statistical analysis, and manuscript preparation. AH analyzed the RNAseq data and generated figures, as well as participated in performing and interpreting experiments and participated in manuscript preparation. KT did the experiments for RNAseq analyses. LS-C participated in performing and interpreting experiments. DC participated in data interpretation and manuscript preparation. JC-M conceived of the study design and participated in performing experiments, statistical analysis, interpretations, and manuscript preparation. All authors contributed to the article and approved the submitted version.
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher's Note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.
Authors: Päivi M Salo; Samuel J Arbes; Patrick W Crockett; Peter S Thorne; Richard D Cohn; Darryl C Zeldin Journal: J Allergy Clin Immunol Date: 2008-02-06 Impact factor: 10.793
Authors: Abbie Francis; Erika Bosio; Shelley F Stone; Daniel M Fatovich; Glenn Arendts; Stephen P J MacDonald; Sally Burrows; Simon G A Brown Journal: J Innate Immun Date: 2018-09-06 Impact factor: 7.349
Authors: George du Toit; Peter H Sayre; Graham Roberts; Kaitie Lawson; Michelle L Sever; Henry T Bahnson; Helen R Fisher; Mary Feeney; Suzana Radulovic; Monica Basting; Marshall Plaut; Gideon Lack Journal: J Allergy Clin Immunol Date: 2017-10-31 Impact factor: 10.793
Authors: Sean P Saunders; Christabelle S M Goh; Sara J Brown; Colin N A Palmer; Rebecca M Porter; Christian Cole; Linda E Campbell; Marek Gierlinski; Geoffrey J Barton; Georg Schneider; Allan Balmain; Alan R Prescott; Stephan Weidinger; Hansjörg Baurecht; Michael Kabesch; Christian Gieger; Young-Ae Lee; Roger Tavendale; Somnath Mukhopadhyay; Stephen W Turner; Vishnu B Madhok; Frank M Sullivan; Caroline Relton; John Burn; Simon Meggitt; Catherine H Smith; Michael A Allen; Jonathan N W N Barker; Nick J Reynolds; Heather J Cordell; Alan D Irvine; W H Irwin McLean; Aileen Sandilands; Padraic G Fallon Journal: J Allergy Clin Immunol Date: 2013-09-29 Impact factor: 10.793