| Literature DB >> 35372326 |
Chongyangzi Du1, Wanchun Yang1,2, Zongyan Yu3,4, Qiuyun Yuan1, Dejiang Pang1, Ping Tang1, Wanxiang Jiang1, Mina Chen1, Bo Xiao3,4.
Abstract
Hepatosteatosis, characterized by excessive accumulation of lipids in the liver, is a major health issue in modern society. Understanding how altered hepatic lipid metabolism/homeostasis causes hepatosteatosis helps to develop therapeutic interventions. Previous studies identify mitochondrial dysfunction as a contributor to hepatosteatosis. But, the molecular mechanisms of mitochondrial dysfunction leading to altered lipid metabolism remain incompletely understood. Our previous work shows that Rheb, a Ras-like small GTPase, not only activates mTORC1 but also promotes mitochondrial ATP production through pyruvate dehydrogenase (PDH). In this study, we further demonstrate that Rheb controls hepatic triglyceride secretion and reduces diet-induced lipid accumulation in a mouse liver. Genetic deletion of Rheb causes rapid and spontaneous steatosis in the liver, which is unexpected from the role of mTORC1 that enhances lipid synthesis, whereas Rheb transgene remarkably reduces diet-induced hepatosteatosis. Results suggest that the hepatosteatosis in Rheb KO is an outcome of impaired lipid secretion, which is linked to mitochondrial ATP production of hepatocytes. Our findings highlight an under-appreciated role of Rheb in the regulation of hepatic lipid secretion through mitochondrial energy production, with therapeutic implication.Entities:
Keywords: ATP; Rheb; VLDL; hepatosteatosis; triglyceride
Year: 2022 PMID: 35372326 PMCID: PMC8965806 DOI: 10.3389/fcell.2022.808140
Source DB: PubMed Journal: Front Cell Dev Biol ISSN: 2296-634X
FIGURE 1Hepatic deletion of Rheb causes spontaneous hepatosteatosis. (A) Body size of control and Rheb KO mice (6-week old). (B) Western blots of Rheb protein in the liver of control (Rheb f/f) and Rheb KO mice (Rheb f/f; Alb-cre); photographs of livers from control and Rheb KO mice (6-week old, lower panel). (C) Slightly increased food consumption of Rheb KO mice (control: n = 3, Rheb KO: n = 6). (D) The ratio of liver weight to body weight of control (n = 9) and Rheb KO mice (n = 10) (6-week-old). (E) H and E (left panel, scale bar, 20 μm), bodipy (middle panel, scale bar, 50 μm), and Oil Red O (right panel, scale bar, 50 μm) staining showing hepatosteatosis in the liver of Rheb KO mice (6-week-old). (F) TEM showing lipid droplets in the liver of Rheb KO mice (6-week-old). Scale bar, 1 μm. Data represent mean ± SEM. *p < 0.05. n.s. no statistical significance.
FIGURE 2Hepatic Rheb KO impairs triglyceride secretion in the liver. (A) Western blots of mTORC1 activity in the liver of Rheb KO mice. (B) Quantitative RT–qPCR detection of lipogenic genes levels in the liver of Rheb KO mice (n = 4). (C) mRNA levels of fatty acid oxidation genes unchanged in the liver of Rheb KO mice (n = 4). (D) Forest plot showing the log fold changes of lipids in the liver of Rheb KO mice over controls. Red and blue points represent significantly increased and decreased lipids of each lipid class in the liver of Rheb KO mice. Diamonds indicate the average log fold change of lipids in each lipid class. Shown here are selected lipid classes. Volcano plot showing log fold changes and significant difference of identified lipids in the liver of Rheb KO mice. Total number of differential lipids is shown in the guide. Triglycerides are represented by larger points and significantly different triglycerides are annotated. (E) Scatter diagram showing an increased liver triglyceride level and decreased serum triglyceride level of Rheb KO mice (liver: n = 12, serum: n = 10). (F) Scatter diagram showing decreased liver and serum total cholesterol levels of Rheb KO mice. (G,H) Western blots (G) and quantifications (H) showing the decreased serum ApoB100 and ApoB48 levels of Rheb KO mice (n = 4, normalized against serum Albumin). (I) Diagrams showing the decreased VLDL levels in the serum of Rheb KO mice (n = 4). Data represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001. n.s. no statistical significance.
FIGURE 3ATP supplements ameliorate hepatosteatosis in Rheb KO mice. (A) A schematic illustration that contains control and Rheb KO mice injected with saline or ATP (dosage: 125 μg/g) four times. (B) Images of Oil Red O staining showing the decreasing of lipid droplets in the liver of Rheb KO mice by ATP treatment. (C-D) Biochemical assays showing the decreased triglyceride level in the liver and increased in the serum in Rheb KO mice by ATP treatment. (E) mRNA levels of genes related to lipid droplet secretion in the liver of Rheb KO mice by ATP treatment. Data represent mean ± SEM. *p < 0.05, **p < 0.01. n.s, no statistical significance.
FIGURE 4Overexpression of Rheb ameliorates hepatosteatosis and rescues liver function. (A) H and E (upper panel) and Oil Red O (lower panel) staining showing the Rheb S16H transgene reducing lipid levels in the liver of mice on HFD. Ctrl mice, Rheb K/+, or Rheb K/K. Rheb transgene mice, Rheb S16H K/+; alb-Cre. Scale bar, 50 and 10 μm (zoom in). (B) Quantification of Oil Red O staining in Figure 4A. (C) Diagram showing decreased liver triglyceride and increased serum triglyceride levels in Rheb S16H mice on HFD (n = 7). (D) Increased ApoB proteins in the serum of Rheb S16H transgenic mice on HFD. (E) Diagram showing the total cholesterol contents in the liver and serum of Rheb S16H mice on HFD (n = 7). (F) Decreased mRNA levels of inflammatory cytokines in Rheb S16H transgenic mice (HFD, n = 3). (G) Decreased ALT and AST levels in the serum of Rheb S16H transgenic mice on HFD (n = 7). (H) A model summarizing that Rheb controls hepatic triglyceride secretion by regulating energy production. Elevation of Rheb expression resists HFD-induced fatty livers. Data represent mean ± SEM. *p < 0.05 and ***p < 0.001. n.s, no statistical significance.
qPCR primers in this study.
| Primers | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| Genes | ||
|
| GGAGCCATGGATTGCACATT | GCTTCCAGAGAGGAGGCCAG |
|
| GGAGGTGGTGATAGCCGGTAT | TGGGTAATCCATAGAGCCCAG |
|
| GAAGCTGACCTTGCTGAACC | CTGCCTCCAATGATGAGGAT |
|
| TGTTTGTGGCTGCTATAATTTGC | GCAACTTCTCAATGTAGCCTATGTTT |
|
| TGCCAGAGCTGATTGACATTC | GGCATACCAGAAGGTGGTGAG |
|
| GGAGAGAATTTCATCCACTTCCA | CTTCCCAAAGCGGTGTGAGT |
|
| TTTCGAAGACGTCAGAGTGC | TGCGACTGTAGGTCTGGTTC |
|
| TCTTTTCCTCGGAGCATGACA | GACCTCTCTACTCACTTCTCCAG |
|
| GCACGTCCGGGAAATGAAC | GCCTCACACTCGCTGATCTT |
|
| CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
|
| CAATGGCCTGCTAAGGTCAGT | GATCACAGACACGGAAGGGTC |
|
| TTTGCACGCAAGCATTCTATGT | TTGTTCTGGTTCTCACTTTCCC |
|
| TGGGCGAAATTGTGACCACC | TCCACTACGAAGATCAAGCCT |
|
| AAGCACCTGCGTAAGCTGG | GCGGGTCTGACAGGAACTTG |